Restriction Map of PMT1/YDL095W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PMT1/YDL095W on chromosome IV from coordinates 287059 to 289512.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.19596

MaeII | Csp6I | |RsaI | |SetI | |TaiI | |MboII BinI* | || MaeII | MboI | || AflIII | | DpnI FokI Ksp632I* | || | SetI | | |BseGI |SduI BsrI | Hpy188I | || | TaiI | | |BstKTI |BseSI |EcoRV \ \ \ \\ \ \ \ \ \\ \\ \\ ATGTCGGAAGAGAAAACGTACAAACGTGTAGAGCAGGATGATCCCGTGCCCGAACTGGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCCTTCTCTTTTGCATGTTTGCACATCTCGTCCTACTAGGGCACGGGCTTGACCTA / / /// / / / / // / / / / / Ksp632I* | ||| | | AflIII | || | BseSI | | EcoRV Hpy188I | ||| | MaeII | || | SduI | BsrI | ||| TaiI | || MboI FokI | ||| SetI | |DpnI | ||Csp6I | BstKTI | |RsaI | BseGI | MboII BinI* | MaeII TaiI SetI M S E E K T Y K R V E Q D D P V P E L D C R K R K R T N V * S R M I P C P N W I V G R E N V Q T C R A G * S R A R T G Y ----:----|----:----|----:----|----:----|----:----|----:----| X D S S F V Y L R T S C S S G T G S S S X T P L S F T C V H L A P H D R A R V P H R F L F R V F T Y L L I I G H G F Q I AsuI* DraII Bsp120I |AsuI* |DraII |BmgT120I ||CviJI ||NlaIV ||HaeIII TspEI ||BmgT120I MaeIII | BglI |||NlaIV |BinI* | MwoI ||||ApaI || MboI | | CviJI ||||SduI || | DpnI | | HaeIII ||||BseSI || | |BstKTI | | | BcgI ||||HgiJII* BcgI || | || Hpy188I | | | MaeIII \\\\\ \ \\ \ \\ \ \ \ \ \ ATCAAGCAGGGCCCCGTAAGACCCTTTATTGTTACCGATCCGAGTGCCGAATTGGCCTCG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTCGTCCCGGGGCATTCTGGGAAATAACAATGGCTAGGCTCACGGCTTAACCGGAGC / /// / / / // / / / / / | ||Bsp120I BcgI | | || Hpy188I | | | BcgI | ||DraII | | || MboI | | HaeIII | ||AsuI* | | |DpnI | | CviJI | |BmgT120I | | BstKTI | TspEI | |DraII | MaeIII MwoI | |AsuI* BinI* BglI | |NlaIV | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* BseSI SduI ApaI I K Q G P V R P F I V T D P S A E L A S S S R A P * D P L L L P I R V P N W P R Q A G P R K T L Y C Y R S E C R I G L V ----:----|----:----|----:----|----:----|----:----|----:----| I L C P G T L G K I T V S G L A S N A E Y * A P G R L V R * Q * R D S H R I P R D L L A G Y S G K N N G I R T G F Q G R MnlI | FatI | NcoI | StyI | SecI* | DsaI* | |CviAII | || MaeIII AluI CviJI | || Tsp45I CviJI HaeIII | || NlaIII MseI | SetI | MwoI \ \\ \ \ \ \ \ \ TTACGAACCATGGTCACTCTTAAAGAGAAGCTGTTAGTGGCCTGTCTTGCTGTCTTTACA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AATGCTTGGTACCAGTGAGAATTTCTCTTCGACAATCACCGGACAGAACGACAGAAATGT // / // / / / / / / || | || | MseI | CviJI | MwoI || | || Tsp45I | AluI HaeIII || | || MaeIII SetI CviJI || | |DsaI* || | |SecI* || | |StyI || | |NcoI || | |FatI || | CviAII || NlaIII |MnlI MaeIII L R T M V T L K E K L L V A C L A V F T Y E P W S L L K R S C * W P V L L S L Q T N H G H S * R E A V S G L S C C L Y S ----:----|----:----|----:----|----:----|----:----|----:----| N R V M T V R L S F S N T A Q R A T K V T V F W P * E * L S A T L P R D Q Q R * * S G H D S K F L L Q * H G T K S D K C FatI CviRI* |CviAII || NlaIII || |CviJI || || FatI || || |CviAII || || || NlaIII TatI AciI || || || |CviJI |Csp6I NspBII* || || || |HaeIII ||RsaI \ \\ \\ \\ \\ \\\ GCGGTCATTAGATTGCATGGCTTGGCATGGCCTGACAGCGTGGTGTTTGATGAAGTACAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCAGTAATCTAACGTACCGAACCGTACCGGACTGTCGCACCACAAACTACTTCATGTA / / / /// / /// /// | AciI | ||| | ||HaeIII ||TatI NspBII* | ||| | ||CviJI |Csp6I | ||| | |FatI RsaI | ||| | CviAII | ||| NlaIII | ||CviJI | |FatI | CviAII CviRI* NlaIII A V I R L H G L A W P D S V V F D E V H R S L D C M A W H G L T A W C L M K Y I G H * I A W L G M A * Q R G V * * S T F ----:----|----:----|----:----|----:----|----:----|----:----| A T M L N C P K A H G S L T T N S S T C L P * * I A H S P M A Q C R P T Q H L V R D N S Q M A Q C P R V A H H K I F Y M FokI | FatI | |CviAII | || BslFI | || NlaIII | || |MslI | || ||BseRI | || ||| BsaBI MslI | || ||| |BseGI FokI | TspDTI MnlI TspDTI | || ||| |CviRI* | SfaNI \ \ \ \ \ \\ \\\ \\ \ \ TTCGGTGGGTTTGCCTCGCAATACATTAGGGGGACTTACTTCATGGATGTGCATCCTCCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCCACCCAAACGGAGCGTTATGTAATCCCCCTGAATGAAGTACCTACACGTAGGAGGA // / / // /// /// |TspDTI MnlI TspDTI || ||| ||CviRI* MslI || ||| |BsaBI || ||| BslFI || ||| BseGI || ||MslI || |BseRI || |FatI || CviAII |FokI NlaIII F G G F A S Q Y I R G T Y F M D V H P P S V G L P R N T L G G L T S W M C I L L R W V C L A I H * G D L L H G C A S S S ----:----|----:----|----:----|----:----|----:----|----:----| K P P N A E C Y M L P V * K M S T C G G N R H T Q R A I C * P S K S * P H A D E E T P K G R L V N P P S V E H I H M R R NlaIV |BssKI |EcoRII CviRI* ||SecI* |MnlI |||ScrFI || MnlI BtgZI MwoI SfaNI |||BseBI \\ \ \ \ \ \\\\ CTTGCAAAGATGTTGTATGCTGGTGTGGCATCGCTTGGTGGGTTCCAGGGTGATTTTGAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGTTTCTACAACATACGACCACACCGTAGCGAACCACCCAAGGTCCCACTAAAACTG / / / / / / / / / / | | MnlI | MwoI | | | EcoRII HphI | CviRI* BtgZI | | | BssKI | SfaNI | | | SecI* | MnlI | | BseBI FokI | | ScrFI | NlaIV SfaNI L A K M L Y A G V A S L G G F Q G D F D L Q R C C M L V W H R L V G S R V I L T C K D V V C W C G I A W W V P G * F * L ----:----|----:----|----:----|----:----|----:----|----:----| R A F I N Y A P T A D S P P N W P S K S E Q L S T T H Q H P M A Q H T G P H N Q K C L H Q I S T H C R K T P E L T I K V BccI |AcyI || Hpy99I || | MaeII || | AflIII AluI || | |HgaI HphI SspI CviJI || | |BsaAI |TaqI | MaeIII | SetI || | || SetI |AsuII | Tsp45I | | HphI || | || TaiI \\ \ \ \ \ \ \\ \ \\ \ TTCGAAAATATTGGTGACAGCTTTCCATCTACGACGCCATACGTGTTGATGAGATTTTTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTTTTATAACCACTGTCGAAAGGTAGATGCTGCGGTATGCACAACTACTCTAAAAAG / / / / / / / / / // / / | SspI | | HphI | | | | || | HgaI AsuII | CviJI | | | | || AflIII TaqI | AluI | | | | |MaeII Tsp45I | | | | BsaAI MaeIII | | | TaiI SetI | | | SetI | | AcyI | BccI Hpy99I F E N I G D S F P S T T P Y V L M R F F S K I L V T A F H L R R H T C * * D F S R K Y W * Q L S I Y D A I R V D E I F L ----:----|----:----|----:----|----:----|----:----|----:----| K S F I P S L K G D V V G Y T N I L N K S R F Y Q H C S E M * S A M R T S S I K E F I N T V A K W R R R W V H Q H S K E TatI Bsp1407I |Csp6I ||RsaI |||FatI ||||CviAII CviJI ||||| NlaIII | SduI ||||| | MaeII | HgiJII* ||||| | | SetI | | Tsp4CI* ||||| | | TaiI \ \ \ \\\\\ \ \ \ TCTGCTTCTTTGGGGGCTCTTACTGTTATTTTGATGTACATGACTTTACGTTATTCTGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGAAGAAACCCCCGAGAATGACAATAAAACTACATGTACTGAAATGCAATAAGACCA / / / /// // / / | CviJI Tsp4CI* ||| |FatI | MaeII HgiJII* ||| | TaiI SduI ||| | SetI ||| CviAII ||Bsp1407I ||TatI |NlaIII |Csp6I RsaI S A S L G A L T V I L M Y M T L R Y S G L L L W G L L L L F * C T * L Y V I L V C F F G G S Y C Y F D V H D F T L F W C ----:----|----:----|----:----|----:----|----:----|----:----| E A E K P A R V T I K I Y M V K R * E P R Q K K P P E * Q * K S T C S K V N N Q R S R Q P S K S N N Q H V H S * T I R T SplI* BceAI |Csp6I |Hin6I ||RsaI ||GlaI |||MaeII ||Eco47III ||||MaeIII |||HhaI ||||Tsp45I ||||HaeII ||||| SetI ||||| MwoI ||||| TaiI \\\\\ \ \\\\\ \ GTTCGTATGTGGGTTGCTTTGATGAGCGCTATCTGCTTTGCCGTTGAAAACTCGTACGTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGCATACACCCAACGAAACTACTCGCGATAGACGAAACGGCAACTTTTGAGCATGCAG ///// //// / ||||MwoI |||| MmeI |||Hin6I |||MaeII ||Eco47III ||SplI* ||BceAI |Csp6I ||GlaI RsaI |HhaI TaiI HaeII SetI V R M W V A L M S A I C F A V E N S Y V F V C G L L * * A L S A L P L K T R T S S Y V G C F D E R Y L L C R * K L V R H ----:----|----:----|----:----|----:----|----:----|----:----| T R I H T A K I L A I Q K A T S F E Y T H E Y T P Q K S S R * R S Q R Q F S T R N T H P N S Q H A S D A K G N F V R V D BsrDI | TseI | CviRI* | |BisI | ||BlsI | |||TseI | |||AluI | |||CviJI | |||PvuII | |||NspBII* | ||||BisI | ||||SfeI* | |||||BlsI | |||||SetI | ||||||CviRI* | ||||||| PstI | ||||||| |BdaI BdaI | ||||||| |BdaI BdaI TspDTI | ||||||| ||AccI MmeI MaeIII | AcyI |HgaI BbvI | ||||||| |||Hpy166II \ \ \ \ \\ \ \ \\\\\\\ \\\\ ACTATTTCTCGTTACATTCTGTTGGACGCCCCATTGATGTTTTTCATTGCAGCTGCAGTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAAAGAGCAATGTAAGACAACCTGCGGGGTAACTACAAAAAGTAACGTCGACGTCAG / / / / / / // ///////// / Tsp45I MaeIII BdaI | TspDTI | |BbvI ||||||||| Hpy166II MaeIII BdaI AcyI | BsrDI ||||||||SfeI* HgaI |||||||BdaI |||||||BdaI ||||||CviRI* ||||||TseI |||||BisI ||||BlsI ||||PstI |||NspBII* |||PvuII |||CviJI |||TseI |||AluI ||BisI |BlsI |SetI CviRI* T I S R Y I L L D A P L M F F I A A A V L F L V T F C W T P H * C F S L Q L Q S Y F S L H S V G R P I D V F H C S C S L ----:----|----:----|----:----|----:----|----:----|----:----| V I E R * M R N S A G N I N K M A A A T * * K E N C E T P R G M S T K * Q L Q L S N R T V N Q Q V G W Q H K E N C S C D Csp6I BbvI Hpy178III* |RsaI \ \ \\ TACTCTTTCAAGAAATACGAAATGTACCCTGCCAACTCGCTCAATGCTTACAAGTCCTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGAAAGTTCTTTATGCTTTACATGGGACGGTTGAGCGAGTTACGAATGTTCAGGAAC / / / // | BbvI Hpy178III* |Csp6I AccI RsaI Y S F K K Y E M Y P A N S L N A Y K S L T L S R N T K C T L P T R S M L T S P C L F Q E I R N V P C Q L A Q C L Q V L A ----:----|----:----|----:----|----:----|----:----|----:----| * E K L F Y S I Y G A L E S L A * L D K R S K * S I R F T G Q W S A * H K C T R V R E L F V F H V R G V R E I S V L G Q FokI BseGI TaqII BsrI | MboII | SfaNI | MaeIII Cac8I | BarI | TspDTI | | MslI BarI | Tsp4CI* \ \ \ \ \ \ \ \ \ \ \ CTTGCTACTGGTATTGCTCTTGGTATGGCATCTTCATCCAAATGGGTTGGTCTTTTCACG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGATGACCATAACGAGAACCATACCGTAGAAGTAGGTTTACCCAACCAGAAAAGTGC / / // / / / // / / Cac8I BsrI || FokI BseGI | |BarI | Tsp4CI* BarI |MboII | SfaNI TaqII TspDTI MslI L A T G I A L G M A S S S K W V G L F T L L L V L L L V W H L H P N G L V F S R C Y W Y C S W Y G I F I Q M G W S F H G ----:----|----:----|----:----|----:----|----:----|----:----| S A V P I A R P I A D E D L H T P R K V A Q * Q Y Q E Q Y P M K M W I P Q D K * K S S T N S K T H C R * G F P N T K E R FatI BspHI |CviAII |Hpy178III* MboII FatI BsmAI || NlaIII BbvII* |CviAII | Hpy178III* || | GsuI | DdeI || NlaIII | | TspDTI || | Eco57MI | |Tth111I \\ \ \ \ \ \\ \ \ \ \\ GTTACATGGGTGGGTCTTTTATGTATCTGGAGACTATGGTTCATGATTGGGGATTTGACT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGTACCCACCCAGAAAATACATAGACCTCTGATACCAAGTACTAACCCCTAAACTGA // // // / /// // / || |FatI |Hpy178III* | ||Eco57MI || BbvII* || CviAII TspDTI | ||GsuI |FalI |MaeIII BsmAI | |BspHI |FalI NlaIII | |FatI |AjuI | Hpy178III* MboII | CviAII NlaIII V T W V G L L C I W R L W F M I G D L T L H G W V F Y V S G D Y G S * L G I * L Y M G G S F M Y L E T M V H D W G F D * ----:----|----:----|----:----|----:----|----:----|----:----| T V H T P R K H I Q L S H N M I P S K V P * M P P D K I Y R S V I T * S Q P N S N C P H T K * T D P S * P E H N P I Q S AjuI FalI FalI | TspEI | | BglI | | MwoI AjuI | | | TaqII FalI | | | CviJI Hin4II* FalI MboII BccI AjuI | | | HaeIII | AjuI \ \ \ \ \ \ \ \ \ \ AAGTCTTCCAAGTCCATCTTCAAAGTAGCATTTGCCAAATTGGCCTTCTTGTTGGGTGTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGAAGGTTCAGGTAGAAGTTTCATCGTAAACGGTTTAACCGGAAGAACAACCCACAC // / / / / / / / / |DdeI MboII BccI FalI | | HaeIII | AjuI Tth111I AjuI FalI | | CviJI Hin4II* AjuI | TspEI | TaqII MwoI BglI K S S K S I F K V A F A K L A F L L G V S L P S P S S K * H L P N W P S C W V C V F Q V H L Q S S I C Q I G L L V G C A ----:----|----:----|----:----|----:----|----:----|----:----| L D E L D M K L T A N A L N A K K N P T * T K W T W R * L L M Q W I P R R T P H L R G L G D E F Y C K G F Q G E Q Q T H MboII BbvII* | BsiYI* MseI BccI \ \ \ \ CCTTTTGCCCTTTATCTGGTCTTCTTTTATATCCACTTCCAATCATTAACTTTGGACGGG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAAACGGGAAATAGACCAGAAGAAAATATAGGTGAAGGTTAGTAATTGAAACCTGCCC // / / / || BbvII* MseI BccI |BsiYI* MboII P F A L Y L V F F Y I H F Q S L T L D G L L P F I W S S F I S T S N H * L W T G F C P L S G L L L Y P L P I I N F G R G ----:----|----:----|----:----|----:----|----:----|----:----| G K A R * R T K K * I W K W D N V K S P A K Q G K D P R R K Y G S G I M L K P R R K G K I Q D E K I D V E L * * S Q V P Hin6I |GlaI |BseGI ||HhaI ||| Cac8I ||| HindIII MboI BinI* ||| | AluI BglII | MboI ||| | CviJI XhoII | XhoII ||| | | SetI ApoI | DpnI | | DpnI ||| | | FokI TspEI | |BstKTI | | |BstKTI \\\ \ \ \ \ \ \\ \ \ \\ GATGGCGCAAGCTTCTTTTCGCCTGAATTTAGATCTACACTAAAGAACAATAAGATCCCC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCGCGTTCGAAGAAAAGCGGACTTAAATCTAGATGTGATTTCTTGTTATTCTAGGGG //// / / / / / // / / // / |||| | | | FokI | || XhoII | || XhoII |||| | | HindIII | || BglII | || MboI |||| | CviJI | || MboI | |DpnI |||| | AluI | |DpnI | BstKTI |||| Cac8I | BstKTI BinI* |||| SetI TspEI |||Hin6I ApoI ||GlaI |HhaI BseGI D G A S F F S P E F R S T L K N N K I P M A Q A S F R L N L D L H * R T I R S P W R K L L F A * I * I Y T K E Q * D P P ----:----|----:----|----:----|----:----|----:----|----:----| S P A L K K E G S N L D V S F F L L I G P H R L S R K A Q I * I * V L S C Y S G I A C A E K R R F K S R C * L V I L D G FatI NcoI AluI StyI CviJI CviJI SecI* |NlaIV | SetI DsaI* || HgaI | Cac8I |CviAII \\ \ \ \ \\ CAAAATGTCGTTGCTGATGTCGGCATTGGCTCCATTATCAGCTTGCGTCATCTCTCTACC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTACAGCAACGACTACAGCCGTAACCGAGGTAATAGTCGAACGCAGTAGAGAGATGG // / / / / |NlaIV | | Cac8I NlaIII CviJI | CviJI | AluI SetI HgaI Q N V V A D V G I G S I I S L R H L S T K M S L L M S A L A P L S A C V I S L P K C R C * C R H W L H Y Q L A S S L Y H ----:----|----:----|----:----|----:----|----:----|----:----| W F T T A S T P M P E M I L K R * R E V G F H R Q Q H R C Q S W * * S A D D R * L I D N S I D A N A G N D A Q T M E R G AluI CviJI PvuII NlaIII BsmI NspBII* Hpy188I | AciI CviRI* TspEI | SetI | TstI \ \ \ \ \ \ \ \ ATGGGCGGTTATTTGCATTCTCATTCACACAATTATCCAGCTGGTTCGGAACAACAACAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCGCCAATAAACGTAAGAGTAAGTGTGTTAATAGGTCGACCAAGCCTTGTTGTTGTT // / / / / / / / / || AciI | CviRI* | | | | TstI |DsaI* BsmI | | | Hpy188I |SecI* | | NspBII* |StyI | | PvuII |NcoI | | CviJI |FatI | | AluI CviAII | SetI TspEI M G G Y L H S H S H N Y P A G S E Q Q Q W A V I C I L I H T I I Q L V R N N N K G R L F A F S F T Q L S S W F G T T T K ----:----|----:----|----:----|----:----|----:----|----:----| M P P * K C E * E C L * G A P E S C C C W P R N N A N E N V C N D L Q N P V V V H A T I Q M R M * V I I W S T R F L L L SfaNI | FatI | |CviAII | || MslI | || |NlaIII | || || MmeI | || || MnlI | || || | TstI | || || | |BseGI FokI BssKI \ \\ \\ \ \\ \ \ AGCACTTTATATCCTCACATGGATGCCAATAACGATTGGTTGTTGGAACTTTACAACGCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTGAAATATAGGAGTGTACCTACGGTTATTGCTAACCAACAACCTTGAAATGTTGCGT // /// / / || ||| BseGI FokI || ||MnlI || |TstI || |FatI || |MmeI || CviAII || MslI |NlaIII SfaNI S T L Y P H M D A N N D W L L E L Y N A A L Y I L T W M P I T I G C W N F T T H H F I S S H G C Q * R L V V G T L Q R T ----:----|----:----|----:----|----:----|----:----|----:----| L V K Y G * M S A L L S Q N N S S * L A F C K I D E C P H W Y R N T T P V K C R A S * I R V H I G I V I P Q Q F K V V C Acc65I HgiCI* |Csp6I HpaII ||RsaI ScrFI ||NlaIV CauII* BccI ||| StyI | TfiI |BaeI ||| KpnI SetI | HinfI MseI |SetI ||| SecI* | Hpy188I \ \ \ \\ \\\ \ \ \ CCCGGCGAATCTTTAACAACATTCCAAAACCTAACCGATGGTACCAAGGTCAGACTATTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCCGCTTAGAAATTGTTGTAAGGTTTTGGATTGGCTACCATGGTTCCAGTCTGATAAG /// / / // / / /// / / / / ||| | MseI || BccI | ||| | | Hpy188I TspRI ||| HinfI |SetI | ||| | SecI* BaeI ||| TfiI BaeI | ||| | StyI ||BssKI | ||| SetI |HpaII | ||HgiCI* CauII* | ||Acc65I ScrFI | |Csp6I | NlaIV | RsaI KpnI P G E S L T T F Q N L T D G T K V R L F P A N L * Q H S K T * P M V P R S D Y S R R I F N N I P K P N R W Y Q G Q T I P ----:----|----:----|----:----|----:----|----:----|----:----| G P S D K V V N W F R V S P V L T L S N V R R I K L L M G F G L R H Y W P * V I G A F R * C C E L V * G I T G L D S * E MslI |FatI BaeI |BspHI |MaeIII ||CviAII Hpy188I |Tsp4CI* ||Hpy178III* | TseI || TspRI ||| NlaIII CviJI | |BisI \\ \ \\\ \ \ \ \\ CACACTGTTACAAGATGTAGATTACACTCTCATGACCATAAGCCACCCGTTTCAGAAAGC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTGACAATGTTCTACATCTAATGTGAGAGTACTGGTATTCGGTGGGCAAAGTCTTTCG / / // // / / / | MaeIII || |BspHI CviJI | BlsI Tsp4CI* || |FatI Hpy188I || Hpy178III* || CviAII |NlaIII MslI H T V T R C R L H S H D H K P P V S E S T L L Q D V D Y T L M T I S H P F Q K A H C Y K M * I T L S * P * A T R F R K Q ----:----|----:----|----:----|----:----|----:----|----:----| W V T V L H L N C E * S W L G G T E S L G C Q * L I Y I V S E H G Y A V R K L F V S N C S T S * V R M V M L W G N * F A MaeIII | BcgI BlsI | | AciI | AlwNI | | NspBII* | |Hin4II* | | | TfiI | || MnlI | | | HinfI | || |BsrI TsoI | | | |SfaNI Hpy99I | || ||BbvI SetI | | | || TaqI Tsp4CI* \ \\ \\\ \ \ \ \ \\ \ \ AGCGACTGGCAGAAGGAGGTTTCTTGTTATGGTTACAGCGGATTCGACGGTGATGCTAAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTGACCGTCTTCCTCCAAAGAACAATACCAATGTCGCCTAAGCTGCCACTACGATTA // / / // / / / / / / / / / || | BsrI || TsoI | | | | | | Tsp4CI* HphI || | MnlI |SetI | | | | | SfaNI || Hin4II* BbvI | | | | | TaqI |AlwNI | | | | Hpy99I |TseI | | | | HinfI BisI | | | | TfiI | | | AciI | | NspBII* | MaeIII BcgI S D W Q K E V S C Y G Y S G F D G D A N A T G R R R F L V M V T A D S T V M L M R L A E G G F L L W L Q R I R R * C * * ----:----|----:----|----:----|----:----|----:----|----:----| L S Q C F S T E Q * P * L P N S P S A L C R S A S P P K K N H N C R I R R H H * A V P L L L N R T I T V A S E V T I S I PfoI BssKI ApoI EcoRII BcgI TspEI | ScrFI BsiYI* HphI | BsrI BfiI EcoRI | BseBI |BsiYI* \ \ \ \ \ \ \ \\ GATGACTGGGTTGTTGAGATTGATAAAAAGAATTCTGCTCCTGGAGTTGCCCAAGAACGG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGACCCAACAACTCTAACTATTTTTCTTAAGACGAGGACCTCAACGGGTTCTTGCC / / / / / / // / | BsrI BfiI EcoRI | EcoRII || Eco57MI BcgI TspEI | BssKI || GsuI ApoI | PfoI |BsiYI* BseBI BsiYI* ScrFI D D W V V E I D K K N S A P G V A Q E R M T G L L R L I K R I L L L E L P K N G * L G C * D * * K E F C S W S C P R T G ----:----|----:----|----:----|----:----|----:----|----:----| S S Q T T S I S L F F E A G P T A W S R H H S P Q Q S Q Y F S N Q E Q L Q G L V I V P N N L N I F L I R S R S N G L F P GsuI Eco57MI FatI | AluI |CviAII | CviJI || NspI | | SetI BsmAI || NlaIII CviJI \ \ \ \ \\ \ \ GTCATAGCTTTGGACACAAAGTTTAGATTGAGACATGCTATGACAGGCTGTTATTTGTTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTATCGAAACCTGTGTTTCAAATCTAACTCTGTACGATACTGTCCGACAATAAACAAA / / / / // / | CviJI | | |FatI CviJI | AluI | | CviAII SetI | NlaIII | NspI BsmAI V I A L D T K F R L R H A M T G C Y L F S * L W T Q S L D * D M L * Q A V I C F H S F G H K V * I E T C Y D R L L F V F ----:----|----:----|----:----|----:----|----:----|----:----| T M A K S V F N L N L C A I V P Q * K N P * L K P C L T * I S V H * S L S N N T D Y S Q V C L K S Q S M S H C A T I Q K Cac8I | AluI | CviJI MaeIII | | SetI TaqI | BseRI | | |BsiYI* AsuII | | SetI \ \ \\ \ \ \ \ TCCCACGAAGTCAAGTTGCCAGCTTGGGGGTTCGAACAACAAGAAGTTACCTGTGCCTCC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGTGCTTCAGTTCAACGGTCGAACCCCCAAGCTTGTTGTTCTTCAATGGACACGGAGG / / / / / / | BsiYI* AsuII | | MaeIII | CviJI TaqI | SetI | AluI BseRI Cac8I SetI S H E V K L P A W G F E Q Q E V T C A S P T K S S C Q L G G S N N K K L P V P P P R S Q V A S L G V R T T R S Y L C L L ----:----|----:----|----:----|----:----|----:----|----:----| E W S T L N G A Q P N S C C S T V Q A E K G R L * T A L K P T R V V L L * R H R G V F D L Q W S P P E F L L F N G T G G BetI* |HpaII || AccI || MnlI || |Hpy166II || || FatI Csp6I || || MnlI |RsaI || || |CviAII ||MaeII || || || NlaIII ||| SetI MaeIII || || || | MseI ||| TaiI Tsp4CI* MaeIII \\ \\ \\ \ \ \\\ \ \ \ TCCGGTAGACATGATTTAACATTGTGGTACGTTGAGAACAACAGTAACCCATTGTTACCA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCCATCTGTACTAAATTGTAACACCATGCAACTCTTGTTGTCATTGGGTAACAATGGT // /// // / // / / / / || ||| |FatI MseI || MaeII | MaeIII MaeIII || ||| CviAII |Csp6I Tsp4CI* || ||NlaIII RsaI || |MnlI TaiI || |AccI SetI || Hpy166II |BetI* |MnlI HpaII S G R H D L T L W Y V E N N S N P L L P P V D M I * H C G T L R T T V T H C Y Q R * T * F N I V V R * E Q Q * P I V T R ----:----|----:----|----:----|----:----|----:----|----:----| E P L C S K V N H Y T S F L L L G N N G R R Y V H N L M T T R Q S C C Y G M T V G T S M I * C Q P V N L V V T V W Q * W TspDTI | SetI | |CviRI* | || Cac8I | || HindIII | || | AluI | || | CviJI | || | |BspMI ApoI TfiI MboII | || | ||SetI TspEI HinfI \ \ \\ \ \\\ \ \ GAAGATACCAAGCGTATTTCCTATAAACCTGCAAGCTTCATTTCTAAATTTATTGAATCC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTATGGTTCGCATAAAGGATATTTGGACGTTCGAAGTAAAGATTTAAATAACTTAGG / // / / / / / / / MboII |SetI | | | | BspMI TspEI HinfI | | | | HindIII ApoI TfiI | | | CviJI | | | AluI | | Cac8I | | SetI | CviRI* TspDTI E D T K R I S Y K P A S F I S K F I E S K I P S V F P I N L Q A S F L N L L N P R Y Q A Y F L * T C K L H F * I Y * I P ----:----|----:----|----:----|----:----|----:----|----:----| S S V L R I E * L G A L K M E L N I S D L L Y W A Y K R Y V Q L S * K * I * Q I F I G L T N G I F R C A E N R F K N F G FatI SetI |CviAII || NlaIII || |MslI || || MnlI || || | TfiI ApoI || || | HinfI TspEI TaqI || || | | TspDTI \ \ \\ \\ \ \ \ CATAAAAAGATGTGGCATATCAATAAAAATTTGGTCGAACCTCATGTTTATGAATCACAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTTTTCTACACCGTATAGTTATTTTTAAACCAGCTTGGAGTACAAATACTTAGTGTT / // / /// / // TspEI || | ||| MnlI |HinfI ApoI || | ||MslI |TfiI || | |FatI TspDTI || | CviAII || NlaIII |SetI TaqI H K K M W H I N K N L V E P H V Y E S Q I K R C G I S I K I W S N L M F M N H N * K D V A Y Q * K F G R T S C L * I T T ----:----|----:----|----:----|----:----|----:----|----:----| W L F I H C I L L F K T S G * T * S D C G Y F S T A Y * Y F N P R V E H K H I V M F L H P M D I F I Q D F R M N I F * L TspDTI | FatI | |BstXI | |CviAII | || CfrI | || |NlaIII | || ||BalI MaeII | || ||CviJI |BsaAI | || ||HaeIII || SetI HphI | || ||| MwoI || TaiI MaeIII BsrI BfiI | MaeII \ \\ \\\ \ \\ \ \ \ \ \ \ CCAACTTCATGGCCATTCTTGCTACGTGGTATAAGTTACTGGGGTGAAAATAACAGAAAC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGAAGTACCGGTAAGAACGATGCACCATATTCAATGACCCCACTTTTATTGTCTTTG // / /// // / // / / / / / || | ||| |MwoI | |MaeII | BsrI BfiI | TaiI || | ||| CfrI | BsaAI MaeIII | SetI || | ||HaeIII TaiI HphI || | ||CviJI SetI || | ||BalI || | |FatI || | CviAII || NlaIII |BstXI TspDTI P T S W P F L L R G I S Y W G E N N R N Q L H G H S C Y V V * V T G V K I T E T N F M A I L A T W Y K L L G * K * Q K R ----:----|----:----|----:----|----:----|----:----|----:----| G V E H G N K S R P I L * Q P S F L L F V L K M A M R A V H Y L N S P H F Y C F W S * P W E Q * T T Y T V P T F I V S V HphI | CviJI MboI | | TspDTI | DpnI | | MaeIII | |PvuI | | Tsp45I SetI | |McrI* | | | MwoI BdaI TaiI SetI | |BstKTI | | | |AciI BdaI \ \ \ \\ \ \ \ \\ \ GTCTATCTATTAGGTAATGCGATCGTATGGTGGGCTGTCACCGCTTTCATCGGTATTTTC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CAGATAGATAATCCATTACGCTAGCATACCACCCGACAGTGGCGAAAGTAGCCATAAAAG / / // / / / / / / / / MaeII SetI || MboI HphI | | | AciI BdaI Hpy188I |DpnI | | Tsp45I BdaI BstKTI | | MaeIII McrI* | MwoI PvuI TspDTI CviJI V Y L L G N A I V W W A V T A F I G I F S I Y * V M R S Y G G L S P L S S V F S L S I R * C D R M V G C H R F H R Y F R ----:----|----:----|----:----|----:----|----:----|----:----| T * R N P L A I T H H A T V A K M P I K R R D I L Y H S R I T P Q * R K * R Y K D I * * T I R D Y P P S D G S E D T N E DdeI SetI | AluI BplI Hpy188I | CviJI BplI | BseMII | TspRI |Hpy166II | |BspCNI | | SetI || TspEI | ||BplI | | | BsiI* || |Hin4II* | ||BplI | | | |BdaI || || MlyI | ||BsaBI | | | |BdaI || || PleI HinfI \ \\\ \ \ \ \\ \\ \\ \ \ GGATTGATTGTTATCACTGAGCTGTTCTCGTGGCAGTTAGGTAAACCAATTTTGAAGGAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAACTAACAATAGTGACTCGACAAGAGCACCGTCAATCCATTTGGTTAAAACTTCCTG /// / / /// / / // / / /// ||| | TspRI ||| BdaI BsiI* |SetI | | ||PleI ||| BsaBI ||| BdaI BplI | | |MlyI ||BspCNI ||CviJI BplI | | TspEI |BseMII ||AluI | Hin4II* BplI |DdeI Hpy166II BplI SetI G L I V I T E L F S W Q L G K P I L K D D * L L S L S C S R G S * V N Q F * R T I D C Y H * A V L V A V R * T N F E G L ----:----|----:----|----:----|----:----|----:----|----:----| P N I T I V S S N E H C N P L G I K F S R I S Q * * Q A T R T A T L Y V L K S P S Q N N D S L Q E R P L * T F W N Q L V SetI | MseI | |HpaI | |HindII | |Hpy166II | || MaeII | || | SetI | || | TaiI StyI | || | |BsiYI* SecI* | || | || SetI BceAI \ \ \\ \ \\ \ \ TCCAAGGTTGTTAACTTCCACGTTCAGGTTATTCACTACTTATTGGGTTTTGCCGTCCAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTCCAACAATTGAAGGTGCAAGTCCAATAAGTGATGAATAACCCAAAACGGCAGGTA / / / // / // / / | | SecI* |MseI | || SetI BceAI | | StyI | | |MaeII | SetI | | BsiYI* HinfI | TaiI | SetI Hpy166II HindII HpaI S K V V N F H V Q V I H Y L L G F A V H P R L L T S T F R L F T T Y W V L P S I Q G C * L P R S G Y S L L I G F C R P L ----:----|----:----|----:----|----:----|----:----|----:----| E L T T L K W T * T I * * K N P K A T W S W P Q * S G R E P * E S S I P N Q R G G L N N V E V N L N N V V * Q T K G D M CviRI* | MaeII BccI | | SetI |MseI | | TaiI CviRI* SfaNI SetI BspMI \\ \ \ \ \ \ \ \ TATGCTCCATCTTTCTTAATGCAACGTCAAATGTTTTTGCATCACTACTTACCTGCTTAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| ATACGAGGTAGAAAGAATTACGTTGCAGTTTACAAAAACGTAGTGATGAATGGACGAATA / / / / / / / / | | | | MaeII CviRI* | SfaNI | | | TaiI SetI | | | SetI | | CviRI* | MseI BccI Y A P S F L M Q R Q M F L H H Y L P A Y M L H L S * C N V K C F C I T T Y L L I C S I F L N A T S N V F A S L L T C L L ----:----|----:----|----:----|----:----|----:----|----:----| * A G D K K I C R * I N K C * * K G A * N H E M K R L A V D F T K A D S S V Q K I S W R E * H L T L H K Q M V V * R S I StyI SecI* | CfrI | | BalI | | CviJI | | HaeIII | | | StyI AciI | | | SecI* | TseI | | | |PflMI | |BisI | | | |BsiYI* | |BsmAI \ \ \ \\ \ \\ TATTTCGGTATTCTTGCCCTTGGCCACGCCTTGGACATAATAGTTTCTTATGTTTTCCGC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAGCCATAAGAACGGGAACCGGTGCGGAACCTGTATTATCAAAGAATACAAAAGGCG / // / / / // BspMI || | | SecI* |BlsI || | | StyI AciI || | BsiYI* || | PflMI || CfrI |HaeIII |CviJI |BalI SecI* StyI Y F G I L A L G H A L D I I V S Y V F R I S V F L P L A T P W T * * F L M F S A F R Y S C P W P R L G H N S F L C F P Q ----:----|----:----|----:----|----:----|----:----|----:----| * K P I R A R P W A K S M I T E * T K R N N R Y E Q G Q G R R P C L L K K H K G I E T N K G K A V G Q V Y Y N R I N E A CviJI | AciI | FnuDII* | | MboI | | BclI MboII | | |BbvI TseI | Eco57I | | ||DpnI |BisI | Eco57MI BlsI BbvI | | |||BstKTI ||BlsI | | Hin4I \ \ \ \ \\\\ \\\ \ \ \ AGCAAGAGACAAATGGGCTACGCGGTAGTGATCACTTTCCTTGCTGCTTCTGTGTATTTC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTCTCTGTTTACCCGATGCGCCATCACTAGTGAAAGGAACGACGAAGACACATAAAG // / / / / / // // /// / / || BsmAI | | | AciI || |BbvI ||| | Eco57MI |TseI | | FnuDII* || BclI ||| | Eco57I BisI | CviJI || MboI ||| | Hin4I BbvI |DpnI ||| MboII BstKTI ||TseI |BisI BlsI S K R Q M G Y A V V I T F L A A S V Y F A R D K W A T R * * S L S L L L L C I S Q E T N G L R G S D H F P C C F C V F L ----:----|----:----|----:----|----:----|----:----|----:----| L L L C I P * A T T I V K R A A E T Y K C C S V F P S R P L S * K G Q Q K Q T N A L S L H A V R Y H D S E K S S R H I E Bce83I* | Tsp4CI* | |Csp6I | |Hin4I | ||RsaI | |||Hpy166II | |||| MlyI | |||| PleI | |||| |FatI | |||| |NcoI | |||| |StyI | |||| |SecI* | |||| |DsaI* | |||| ||CviAII | |||| ||| NlaIII Hpy178III* | |||| ||| |HinfI | AluI | |||| ||| || SmlI | CviJI | |||| ||| || | Hpy178III* | | SetI TspEI | |||| ||| || | | TspEI \ \ \ \ \ \\\\ \\\ \\ \ \ \ TTCAAGAGCTTCAGTCCAATTATTTACGGTACACCATGGACTCAAGAATTGTGTCAAAAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTCTCGAAGTCAGGTTAATAAATGCCATGTGGTACCTGAGTTCTTAACACAGTTTTT // / / / / // // // / / / || CviJI | | | || || || | | TspEI || AluI | | | || || || | Hpy178III* |SetI | | | || || || | SmlI Hpy178III* | | | || || || HinfI | | | || || |DsaI* | | | || || |SecI* | | | || || |StyI | | | || || |NcoI | | | || || |FatI | | | || || CviAII | | | || |NlaIII | | | || |PleI | | | || MlyI | | | |Hpy166II | | | |Csp6I | | | RsaI | | Tsp4CI* | Bce83I* | Hin4I TspEI F K S F S P I I Y G T P W T Q E L C Q K S R A S V Q L F T V H H G L K N C V K N Q E L Q S N Y L R Y T M D S R I V S K I ----:----|----:----|----:----|----:----|----:----|----:----| K L L K L G I I * P V G H V * S N H * F R * S S * D L * K R Y V M S E L I T D F E L A E T W N N V T C W P S L F Q T L F MfeI TspEI | MaeIII | | BslFI BtsI | | | MboII TatI TspRI | | | TspDTI Ksp632I* |Csp6I \ \ \ \ \ \ \\ TCGCAGTGGTTGTCTGGTTGGGACTACAATTGTAACACATACTTTTCTTCATTAGAAGAG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGTCACCAACAGACCAACCCTGATGTTAACATTGTGTATGAAAAGAAGTAATCTTCTC / / / /// / TspRI BtsI | ||BslFI Ksp632I* | |MboII | MaeIII | TspDTI TspEI MfeI S Q W L S G W D Y N C N T Y F S S L E E R S G C L V G T T I V T H T F L H * K S A V V V W L G L Q L * H I L F F I R R V ----:----|----:----|----:----|----:----|----:----|----:----| D C H N D P Q S * L Q L V Y K E E N S S I A T T T Q N P S C N Y C M S K K M L L R L P Q R T P V V I T V C V K R * * F L SetI | AciI | BisI | |BlsI | ||TauI | ||| BspMI | ||| |SpeI MaeII | ||| ||MaeI | SetI | ||| ||| TatI | TaiI | ||| ||| |Csp6I | |TfiI | ||| ||| ||RsaI RsaI MboII SetI | |HinfI | ||| ||| ||| Tsp4CI* \ \ \ \ \\ \ \\\ \\\ \\\ \ TACAAAAACCAAACCTTGACTAAACGTGAATCTCAACCTGCCGCCACTAGTACAGTTGAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTTTTGGTTTGGAACTGATTTGCACTTAGAGTTGGACGGCGGTGATCATGTCAACTT /// / / / / / / //// ///// ||| MboII SetI | | | SetI |||AciI ||||Tsp4CI* ||TatI | | HinfI ||BisI ||||TatI |Csp6I | | TfiI |BlsI |||Csp6I RsaI | MaeII TauI ||RsaI TaiI |SpeI SetI BspMI MaeI Y K N Q T L T K R E S Q P A A T S T V E T K T K P * L N V N L N L P P L V Q L K Q K P N L D * T * I S T C R H * Y S * R ----:----|----:----|----:----|----:----|----:----|----:----| Y L F W V K V L R S D * G A A V L V T S T C F G F R S * V H I E V Q R W * Y L Q V F V L G Q S F T F R L R G G S T C N F AsuI* AvaII RsrII Tsp4CI* |BmgT120I ||Eam1105I ||| Hpy99I ||| |BslFI ||| || MboI ||| || BglII ||| || XhoII ||| || | DpnI ||| || | |BstKTI ||| || | || FatI ||| || | || BspHI ||| || | || |MnlI ||| || | || |Hin4I ||| || | || |Hin4I ||| || | || |CviAII ||| || | || |Hpy178III* Hin4II* ||| || | || || NlaIII |SfeI* ||| || | || || |BccI || Hin4I ||| || | || || |MboII || Hin4I ||| || | || || ||TspDTI || MboII ||| || | || || ||| FalI BseGI || | TspGWI ||| || | || || ||| FalI |TspDTI \\ \ \ \\\ \\ \ \\ \\ \\\ \ \\ GAAATCACTATAGAAGGGGACGGTCCGTCGTATGAAGATCTCATGAACGAGGATGGCAAG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAGTGATATCTTCCCCTGCCAGGCAGCATACTTCTAGAGTACTTGCTCCTACCGTTC // / / / /// / // // // / // || | TspGWI | ||Hpy99I | || || || BccI |TspDTI || | SfeI* | ||RsrII | || || |TspDTI BseGI || MboII | ||AvaII | || || |MboII |Hin4II* | ||AsuI* | || || |BspHI Hin4I | |BmgT120I | || || |FatI Hin4I | Eam1105I | || || Hpy178III* Tsp4CI* | || || CviAII | || || FalI | || || FalI | || |NlaIII | || |MnlI | || XhoII | || BglII | || MboI | |DpnI | BstKTI | Hin4I | Hin4I BslFI E I T I E G D G P S Y E D L M N E D G K K S L * K G T V R R M K I S * T R M A R N H Y R R G R S V V * R S H E R G W Q E ----:----|----:----|----:----|----:----|----:----|----:----| S I V I S P S P G D Y S S R M F S S P L L F * * L L P R D T T H L D * S R P H C F D S Y F P V T R R I F I E H V L I A L FalI FalI | SetI | | BinI* | | | MaeI | | | | MboI | | | | XhoII | | | | | DpnI FokI | | | | | |BstKTI | MseI | | | | | ||Hpy178III* Ksp632I* | |AhaIII* | | | | | |||MmeI |MnlI | || Hin4II* | | | | | |||| TspDTI || MnlI \ \\ \ \ \ \ \ \ \\\\ \ \\ \ AAAATCTTTAAAGACACAGAAGGTAATGAACTAGATCCAGAAGTTGTCAAAAAAATGTTG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAGAAATTTCTGTGTCTTCCATTACTTGATCTAGGTCTTCAACAGTTTTTTTACAAC /// / / / / ///// / / / ||| | | SetI | ||||| Hpy178III* | Ksp632I* ||| | FalI | ||||| TspDTI | MnlI ||| | FalI | ||||XhoII MnlI ||| Hin4II* | ||||MboI ||MseI | |||MmeI |AhaIII* | ||DpnI FokI | |BstKTI | MaeI BinI* K I F K D T E G N E L D P E V V K K M L K S L K T Q K V M N * I Q K L S K K C W N L * R H R R * * T R S R S C Q K N V G ----:----|----:----|----:----|----:----|----:----|----:----| F I K L S V S P L S S S G S T T L F I N S F R * L C L L Y H V L D L L Q * F F T F D K F V C F T I F * I W F N D F F H Q AluI CviJI MboII | SetI | | BseRI | | | MseI | | | |AhaIII* CviJI \ \ \ \\ \ GAAGAGGAGGGAGCTAACATTTTAAAAGTAGAAAAAAGGGCTGTTTTGGAATAA 2410 2420 2430 2440 2450 ----:----|----:----|----:----|----:----|----:----|---- CTTCTCCTCCCTCGATTGTAAAATTTTCATCTTTTTTCCCGACAAAACCTTATT /// / // / ||| BseRI |MseI CviJI ||CviJI AhaIII* ||AluI |MboII SetI E E E G A N I L K V E K R A V L E * K R R E L T F * K * K K G L F W N X R G G S * H F K S R K K G C F G I X ----:----|----:----|----:----|----:----|----:----|---- S S S P A L M K F T S F L A T K S Y P L P P L * C K L L L F F P Q K P I F L L S S V N * F Y F F P S N Q F L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 7 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AhaIII* 2 DraI AjuI 2 AluI 12 AluBI AlwNI 1 CaiI ApaI 1 ApoI 4 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 2 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 1 BpuEI BceAI 2 BcgI 2 BclI 1 FbaI,Ksp22I BdaI 4 BetI* 1 BsaWI BfiI 2 BmrI,BmuI BglI 2 BglII 2 BinI* 4 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 3 BplI 2 BsaAI 2 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 1 BseRI 3 BseSI 2 BaeGI,BstSLI BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 6 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BspHI 3 CciI,PagI,RcaI BspMI 3 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstKTI 8 BstXI 1 BtgZI 1 BtsI 1 Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI Csp6I 10 CviQI,RsaNI CviAII 16 CviJI 27 CviKI-1 CviRI* 9 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 8 MalI DraII 2 EcoO109I DsaI* 3 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 3 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 4 FatI 16 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 7 GlaI 2 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 7 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 5 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 2 HinfI 7 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 6 Hpy99I 3 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 11 HpyCH4IV MaeIII 15 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 2 SchI MmeI 3 MnlI 12 MseI 8 Tru1I,Tru9I MslI 6 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NcoI 3 Bsp19I NlaIII 16 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 4 MspA1I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 2 PpsI PstI 1 PvuI 1 MvrI,Ple19I,BpvUI PvuII 2 RsaI 10 AfaI RsrII 1 CspI,Rsr2I,CpoI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 37 SfaNI 6 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SplI* 1 Pfl23II,PspLI,BsiWI SspI 1 StyI 7 Eco130I,EcoT14I,ErhI,BssT1I TaiI 11 TaqI 4 TaqII 2 TatI 4 TauI 1 TfiI 5 PfeI TseI 5 ApeKI TsoI 1 Tsp45I 4 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI TstI 1 Tth111I 1 PflFI,PsyI,AspI XhoII 4 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflII AgeI AlfI AloI ApaLI AscI AvaI AvrII BamHI BbvCI BciVI BmeT110I BmtI Bpu10I BsaXI BsePI BseYI BsgI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI Cfr10I Cfr9I ClaI CspCI DinI DraIII DrdI EciI Ecl136II Eco31I EcoICRI EcoNI EcoP15I EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GsaI HgiAI* KasI MauBI MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PmaCI PmeI PpiI PpuMI PshAI PsiI PspXI PsrI SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SrfI Sse232I* Sse8387I StuI SwaI TspMI VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769