Restriction Map of SUB2/YDL084W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SUB2/YDL084W on chromosome IV from coordinates 305237 to 306577.


HphI MaeIII | MboII Tsp45I | | MboII | Hin4II* | | |TatI ApoI | | OliI | | ||Csp6I TspEI | | MslI | | |||RsaI |SfaNI | | | SetI | | |||ScaI Hpy188I || TspEI \ \ \ \ \ \ \\\\ \ \\ \ ATGTCACACGAAGGTGAAGAAGATTTATTGGAGTACTCCGATAACGAACAAGAAATTCAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTGTGCTTCCACTTCTTCTAAATAACCTCATGAGGCTATTGCTTGTTCTTTAAGTT / / / / / / /// / // | | MslI | | | ||| Hpy188I |SfaNI | | OliI | | | ||TatI TspEI | | SetI | | | |Csp6I ApoI | Tsp45I | | | ScaI | MaeIII | | | RsaI Hin4II* | | MboII | MboII HphI M S H E G E E D L L E Y S D N E Q E I Q C H T K V K K I Y W S T P I T N K K F K V T R R * R R F I G V L R * R T R N S N ----:----|----:----|----:----|----:----|----:----|----:----| X D C S P S S S K N S Y E S L S C S I * X T V R L H L L N I P T S R Y R V L F E H * V F T F F I * Q L V G I V F L F N L KasI HgiCI* |AcyI |NarI |Hin6I ||GlaI ||DinI DdeI ||BsrI | BglI ||NlaIV | MwoI |||HhaI | | CviJI ||||AciI | | HaeIII ||||BisI | | |AciI ||||HaeII | | |BisI ||||Eco57I | | ||BlsI ||||Eco57MI | | ||MnlI |||||BlsI | | |||TauI ||||||TauI | | |||NspBII* ||||||| GsuI | | |||| MwoI ||||||| Eco57MI | | |||| | AluI ||||||| | MwoI | | |||| | CviJI ||||||| | | CviRI* | | |||| | | SetI ||||||| | | Hin4II* \ \ \\\\ \ \ \ \\\\\\\ \ \ \ ATTGATGCCTCTAAGGCCGCTGAAGCTGGAGAAACTGGCGCCGCCACTTCTGCAACTGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTACGGAGATTCCGGCGACTTCGACCTCTTTGACCGCGGCGGTGAAGACGTTGACTT / / / //// / / /////// // // / TspEI | | |||| | CviJI ||||||| |MwoI |CviRI* SetI | | |||| | AluI ||||||| | Hin4II* | | |||| SetI ||||||| Eco57MI | | |||NspBII* ||||||| GsuI | | |||MwoI ||||||AciI | | |||AciI |||||BisI | | ||BisI ||||HgiCI* | | |MnlI ||||KasI | | |BlsI ||||BlsI | | HaeIII |||Hin6I | | CviJI |||NarI | | TauI |||AcyI | DdeI |||TauI MwoI ||Eco57MI BglI ||Eco57I ||NlaIV ||DinI ||GlaI |HhaI HaeII BsrI I D A S K A A E A G E T G A A T S A T E L M P L R P L K L E K L A P P L L Q L K * C L * G R * S W R N W R R H F C N * R ----:----|----:----|----:----|----:----|----:----|----:----| I S A E L A A S A P S V P A A V E A V S F Q H R * P R Q L Q L F Q R R W K Q L Q N I G R L G S F S S F S A G G S R C S F HphI | BtsI | Eco57I | Eco57MI | | SfeI* | | | TseI | | | CviRI* | | | |BisI | | | ||BlsI | | | ||PstI | | | ||TspRI | | | |||AluI | | | |||CviJI | | | |||PvuII | | | |||NspBII* | | | |||| SetI SetI SetI | | | |||| Cac8I BbvI NlaIV \ \ \ \ \\\\ \ \ \ GGTGATAATAATAACAACACTGCAGCTGGCGACAAGAAAGGTTCCTATGTTGGTATCCAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTATTATTATTGTTGTGACGTCGACCGCTGTTCTTTCCAAGGATACAACCATAGGTA / / / //// / / / | | | |||| Cac8I | NlaIV | | | |||NspBII* BbvI | | | |||PvuII SetI | | | |||CviJI | | | |||TseI | | | |||AluI | | | ||SfeI* | | | ||BisI | | | |BlsI | | | |SetI | | | CviRI* | | PstI | Eco57MI | Eco57I | TspRI | BtsI HphI G D N N N N T A A G D K K G S Y V G I H V I I I T T L Q L A T R K V P M L V S I * * * * Q H C S W R Q E R F L C W Y P F ----:----|----:----|----:----|----:----|----:----|----:----| P S L L L L V A A P S L F P E * T P I W L H Y Y Y C C Q L Q R C S L N R H Q Y G T I I I V V S C S A V L F T G I N T D M AgeI BetI* BciVI BccI Cfr10I Hpy178III* |FokI |HpaII CviJI | CviJI || Tsp4CI* \\ \ \ \ \\ \ TCCACCGGTTTCAAAGATTTCTTGCTAAAGCCAGAACTATCAAGAGCCATCATTGACTGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTGGCCAAAGTTTCTAAAGAACGATTTCGGTCTTGATAGTTCTCGGTAGTAACTGACA / // / / / // / | |Cfr10I CviJI | CviJI || FokI | |BetI* Hpy178III* |Tsp4CI* | |AgeI BccI | HpaII BciVI S T G F K D F L L K P E L S R A I I D C P P V S K I S C * S Q N Y Q E P S L T V H R F Q R F L A K A R T I K S H H * L W ----:----|----:----|----:----|----:----|----:----|----:----| E V P K L S K K S F G S S D L A M M S Q N W R N * L N R A L A L V I L L W * Q S G G T E F I E Q * L W F * * S G D N V T BaeI TspEI | MnlI | |FatI | ||CviAII | ||| BspCNI | ||| |Acc65I DdeI | ||| |HgiCI* |Hpy188I | ||| |NlaIII || AsuI* | ||| |BseMII BseMII || AvaII | ||| ||Csp6I |BseGI || |BmgT120I | ||| |||RsaI |BspCNI || ||SetI TspDTI | ||| |||NlaIV || MnlI || ||Hin4II* |DdeI | ||| |||| KpnI \\ \ \\ \\\ \\ \ \\\ \\\\ \ GGTTTTGAACATCCTTCTGAGGTCCAGCAACATACCATTCCTCAGTCAATTCATGGTACC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAAACTTGTAGGAAGACTCCAGGTCGTTGTATGGTAAGGAGTCAGTTAAGTACCATGG // / / // /// / / / / ///// /// || MnlI | || ||AvaII | | DdeI | ||||| ||HgiCI* |BspCNI | || ||AsuI* | BaeI | ||||| ||Acc65I |BseGI | || |BmgT120I TspDTI | ||||| |Csp6I BseMII | || Hin4II* | ||||| NlaIV | |DdeI | ||||| RsaI | SetI | ||||FatI Hpy188I | ||||KpnI | |||CviAII | ||BseMII | |BspCNI | NlaIII | TspEI MnlI G F E H P S E V Q Q H T I P Q S I H G T V L N I L L R S S N I P F L S Q F M V P F * T S F * G P A T Y H S S V N S W Y R ----:----|----:----|----:----|----:----|----:----|----:----| P K S C G E S T W C C V M G * D I * P V H N Q V D K Q P G A V Y W E E T L E H Y T K F M R R L D L L M G N R L * N M T G AluI CviJI PvuII PshAI NspBII* BaeI SetI | SetI \ \ \ \ GATGTCTTGTGTCAAGCAAAGTCTGGTTTAGGTAAGACAGCTGTCTTTGTCTTATCCACT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAGAACACAGTTCGTTTCAGACCAAATCCATTCTGTCGACAGAAACAGAATAGGTGA / / / / BaeI SetI | NspBII* | PshAI | PvuII | CviJI | AluI SetI D V L C Q A K S G L G K T A V F V L S T M S C V K Q S L V * V R Q L S L S Y P L C L V S S K V W F R * D S C L C L I H S ----:----|----:----|----:----|----:----|----:----|----:----| S T K H * A F D P K P L V A T K T K D V R H R T D L L T Q N L Y S L Q R Q R I W I D Q T L C L R T * T L C S D K D * G S CviRI* | MfeI | TspEI | | AsuI* | | AvaII | | |BmgT120I | | ||NlaIV | | ||| BceAI | | ||| |EcoNI | | ||| ||BssKI | | ||| ||EcoRII | | ||| |||BsiYI* | | ||| ||||ScrFI | | ||| ||||BseBI | | ||| ||||| SetI HphI MaeI \ \ \\\ \\\\\ \ \ \ CTGCAACAATTGGACCCTGTTCCAGGTGAAGTTGCCGTTGTTGTCATTTGTAATGCTAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GACGTTGTTAACCTGGGACAAGGTCCACTTCAACGGCAACAACAGTAAACATTACGATCT / / // / / // / / / CviRI* | || | | || EcoRII HphI MaeI | || | | || BssKI | || | | |BseBI | || | | |ScrFI | || | | SetI | || | EcoNI | || | BceAI | || BsiYI* | |AvaII | |AsuI* | BmgT120I | NlaIV TspEI MfeI L Q Q L D P V P G E V A V V V I C N A R C N N W T L F Q V K L P L L S F V M L E A T I G P C S R * S C R C C H L * C * R ----:----|----:----|----:----|----:----|----:----|----:----| R C C N S G T G P S T A T T T M Q L A L E A V I P G Q E L H L Q R Q Q * K Y H * Q L L Q V R N W T F N G N N D N T I S S MaeII CviJI ApoI | MseI HaeIII TspEI | SetI |BsrI | MaeIII | TaiI \\ \ \ \ \ GAACTGGCCTATCAAATTCGTAACGAGTATTTGAGATTTTCCAAATATATGCCAGACGTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGACCGGATAGTTTAAGCATTGCTCATAAACTCTAAAAGGTTTATATACGGTCTGCAA // / / / / |HaeIII TspEI MaeIII | MaeII |CviJI ApoI TaiI BsrI SetI E L A Y Q I R N E Y L R F S K Y M P D V N W P I K F V T S I * D F P N I C Q T L T G L S N S * R V F E I F Q I Y A R R * ----:----|----:----|----:----|----:----|----:----|----:----| S S A * * I R L S Y K L N E L Y I G S T L V P R D F E Y R T N S I K W I Y A L R F Q G I L N T V L I Q S K G F I H W V N TspEI Tsp4CI* |SfaNI MseI | Csp6I || DdeI FokI PshAI | |RsaI || EcoP15I BseGI |AhaIII* \ \ \\ \\ \ \ \\ AAGACAGCAGTCTTTTACGGTGGTACTCCAATTTCTAAGGATGCTGAACTTTTAAAGAAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGTCGTCAGAAAATGCCACCATGAGGTTAAAGATTCCTACGACTTGAAAATTTCTTA / / / // // // / // / / MseI PshAI | |Csp6I || |DdeI BseGI || | BseRI | RsaI || EcoP15I || FokI Tsp4CI* |SfaNI |MseI TspEI AhaIII* K T A V F Y G G T P I S K D A E L L K N R Q Q S F T V V L Q F L R M L N F * R I D S S L L R W Y S N F * G C * T F K E * ----:----|----:----|----:----|----:----|----:----|----:----| L V A T K * P P V G I E L S A S S K F F * S L L R K R H Y E L K * P H Q V K L S L C C D K V T T S W N R L I S F K * L I CviRI* | BssKI | EcoRII | | ScrFI | | BseBI GsuI | | | SetI Eco57MI | | | | MseI BseRI | MnlI | | | | |AhaIII* \ \ \ \ \ \ \ \\ AAAGATACTGCTCCTCACATTGTTGTTGCAACTCCAGGTCGTTTAAAAGCGTTAGTGAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTATGACGAGGAGTGTAACAACAACGTTGAGGTCCAGCAAATTTTCGCAATCACTCT / / / // / // | MnlI CviRI* || | |MseI Eco57MI || | AhaIII* GsuI || EcoRII || BssKI |BseBI |ScrFI SetI K D T A P H I V V A T P G R L K A L V R K I L L L T L L L Q L Q V V * K R * * E R Y C S S H C C C N S R S F K S V S E R ----:----|----:----|----:----|----:----|----:----|----:----| L S V A G * M T T A V G P R K F A N T L Y L Y Q E E C Q Q Q L E L D N L L T L S F I S S R V N N N C S W T T * F R * H S MaeIII Tsp45I | AflIII | | MaeII | | |BtrI | | || SetI | | || TaiI SetI | | || |Hpy178III* TspDTI \ \ \\ \\ \ GAAAAATACATTGATTTGTCACACGTCAAGAACTTTGTCATAGATGAATGTGATAAGGTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTATGTAACTAAACAGTGTGCAGTTCTTGAAACAGTATCTACTTACACTATTCCAA / // / / / | || Hpy178III* | TspDTI | |AflIII SetI | |MaeII | BtrI Tsp45I MaeIII TaiI SetI E K Y I D L S H V K N F V I D E C D K V K N T L I C H T S R T L S * M N V I R F K I H * F V T R Q E L C H R * M * * G F ----:----|----:----|----:----|----:----|----:----|----:----| S F Y M S K D C T L F K T M S S H S L T L F I C Q N T V R * S S Q * L H I H Y P F F V N I Q * V D L V K D Y I F T I L N FatI Hpy188I |CviAII CviRI* | AluI |Ksp632I* | MboII | CviJI ||MboII | | ApoI | | SetI TspEI ||| NlaIII | | TspEI | | | BsmAI \ \\\ \ \ \ \ \ \ \ \ TTAGAAGAATTAGACATGAGAAGAGATGTGCAAGAAATTTTCAGAGCTACTCCAAGAGAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTCTTAATCTGTACTCTTCTCTACACGTTCTTTAAAAGTCTCGATGAGGTTCTCTG / // // // / / / / / | || |Ksp632I* |MboII | | | CviJI BsmAI | || |FatI CviRI* | | | AluI | || CviAII | | SetI | |MboII | Hpy188I | NlaIII TspEI TspEI ApoI L E E L D M R R D V Q E I F R A T P R D * K N * T * E E M C K K F S E L L Q E T R R I R H E K R C A R N F Q S Y S K R Q ----:----|----:----|----:----|----:----|----:----|----:----| K S S N S M L L S T C S I K L A V G L S K L L I L C S F L H A L F K * L * E L L * F F * V H S S I H L F N E S S S W S V DrdI | FatI | BspHI | |CviAII | |Hpy178III* | || NlaIII SmlI | || | Bce83I* | Hpy178III* AccI | || | | CviJI | | TspEI TspEI |Hpy166II \ \\ \ \ \ \ \ \ \ \\ AAACAAGTCATGATGTTTTCAGCCACACTTTCTCAAGAAATTAGACCAATTTGTAGACGC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTTCAGTACTACAAAAGTCGGTGTGAAAGAGTTCTTTAATCTGGTTAAACATCTGCG / / // / / / / / // DrdI | || | CviJI | TspEI | |AccI | || Bce83I* Hpy178III* | Hpy166II | |BspHI SmlI TspEI | |FatI | Hpy178III* | CviAII NlaIII K Q V M M F S A T L S Q E I R P I C R R N K S * C F Q P H F L K K L D Q F V D A T S H D V F S H T F S R N * T N L * T L ----:----|----:----|----:----|----:----|----:----|----:----| L C T M I N E A V S E * S I L G I Q L R C V L * S T K L W V K E L F * V L K Y V F L D H H K * G C K R L F N S W N T S A AluI CviJI |DdeI |EspI* ||SetI ||| AluI ||| CviJI ||| | SetI ||| | | TspDTI ||| | | |MwoI ||| | | ||SetI TaqI ||| | | ||| CviRI* HgaI | Hpy99I ||| | | ||| | BsiYI* | TfiI ApoI | | FalI ||| | | ||| | | MwoI | HinfI TspEI | | FalI ||| | | ||| | | BstAPI \ \ \ \ \ \ \\\ \ \ \\\ \ \ \ TTCTTACAGAATCCATTGGAAATTTTCGTCGATGATGAAGCTAAGCTAACCTTGCACGGG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAATGTCTTAGGTAACCTTTAAAAGCAGCTACTACTTCGATTCGATTGGAACGTGCCC / / / / / / / / /// / // / | HinfI | | | TaqI | | ||| | || BstAPI | TfiI | | FalI | | ||| | || MwoI HgaI | | FalI | | ||| | |CviRI* | Hpy99I | | ||| | BsiYI* TspEI | | ||| TspDTI ApoI | | ||| MwoI | | ||| SetI | | ||CviJI | | ||AluI | | |EspI* | | |DdeI | | SetI | CviJI | AluI SetI F L Q N P L E I F V D D E A K L T L H G S Y R I H W K F S S M M K L S * P C T G L T E S I G N F R R * * S * A N L A R V ----:----|----:----|----:----|----:----|----:----|----:----| K K C F G N S I K T S S S A L S V K C P S R V S D M P F K R R H H L * A L R A R E * L I W Q F N E D I I F S L * G Q V P MaeII Tsp4CI* CviRI* |AjuI | TspEI | FalI || SetI | | BsiYI* | FalI || TaiI | | | CviJI | | SspI TspEI || | MboII | | | | TspEI \ \ \ \ \\ \ \ \ \ \ \ \ TTGCAACAATATTATATCAAATTAGAAGAACGTGAAAAGAACCGTAAATTGGCTCAATTA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTGTTATAATATAGTTTAATCTTCTTGCACTTTTCTTGGCATTTAACCGAGTTAAT / / / / / / / / / / / / // | CviRI* SspI | | | | MboII | | | CviJI |TspEI FalI | | | MaeII | | TspEI AjuI FalI | | TaiI | BsiYI* | | SetI Tsp4CI* | AjuI TspEI L Q Q Y Y I K L E E R E K N R K L A Q L C N N I I S N * K N V K R T V N W L N Y A T I L Y Q I R R T * K E P * I G S I I ----:----|----:----|----:----|----:----|----:----|----:----| N C C Y * I L N S S R S F F R L N A * N T A V I N Y * I L L V H F S G Y I P E I Q L L I I D F * F F T F L V T F Q S L * AluI CviJI AjuI MseI | SetI \ \ \ \ TTAGATGATTTGGAGTTCAATCAAGTCATTATTTTCGTTAAATCTACCACAAGAGCTAAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTACTAAACCTCAAGTTAGTTCAGTAATAAAAGCAATTTAGATGGTGTTCTCGATTA / / / MseI | CviJI | AluI SetI L D D L E F N Q V I I F V K S T T R A N * M I W S S I K S L F S L N L P Q E L M R * F G V Q S S H Y F R * I Y H K S * * ----:----|----:----|----:----|----:----|----:----|----:----| N S S K S N L * T M I K T L D V V L A L I L H N P T * D L * * K R * I * W L L * * I I Q L E I L D N N E N F R G C S S I HphI Tsp4CI* MnlI | FatI |HpaII | |CviAII HindII || CviJI | || NlaIII Hpy166II MseI || TspDTI | || | NdeI \ \ \\ \ \ \\ \ \ GAGTTGACCAAACTATTAAACGCCTCTAACTTTCCGGCTATCACCGTTCATGGTCATATG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAACTGGTTTGATAATTTGCGGAGATTGAAAGGCCGATAGTGGCAAGTACCAGTATAC / / / /// / / // / Hpy166II MseI | ||CviJI | | |FatI NdeI HindII | |HpaII | | CviAII | TspDTI | NlaIII MnlI Tsp4CI* HphI E L T K L L N A S N F P A I T V H G H M S * P N Y * T P L T F R L S P F M V I * V D Q T I K R L * L S G Y H R S W S Y E ----:----|----:----|----:----|----:----|----:----|----:----| S N V L S N F A E L K G A I V T * P * I H T S W V I L R R * S E P * * R E H D Y L Q G F * * V G R V K R S D G N M T M H MaeII |TspDTI || SetI || TaiI MaeII || | MboII | SetI || | | MaeIII CviJI | TaiI \\ \ \ \ \ \ \ AAACAAGAAGAACGTATTGCTCGTTACAAGGCTTTCAAAGATTTTGAAAAACGTATTTGC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTTCTTCTTGCATAACGAGCAATGTTCCGAAAGTTTCTAAAACTTTTTGCATAAACG / / / / / / / | | MboII | CviJI | MaeII | MaeII MaeIII TaiI TspDTI SetI TaiI SetI K Q E E R I A R Y K A F K D F E K R I C N K K N V L L V T R L S K I L K N V F A T R R T Y C S L Q G F Q R F * K T Y L R ----:----|----:----|----:----|----:----|----:----|----:----| F C S S R I A R * L A K L S K S F R I Q S V L L V Y Q E N C P K * L N Q F V Y K F L F F T N S T V L S E F I K F F T N A MaeII | SetI | TaiI SetI | | MseI | TaqI | | VspI CviJI Hpy166II MnlI | ClaI | | |TspEI | TspEI \ \ \ \ \ \ \\ \ \ GTGTCCACAGATGTTTTTGGTAGAGGTATCGATATTGAACGTATTAATTTAGCCATCAAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CACAGGTGTCTACAAAAACCATCTCCATAGCTATAACTTGCATAATTAAATCGGTAGTTA / / / / / / / / / Hpy166II MnlI SetI ClaI | | | | CviJI TaqI | | | TspEI | | VspI | | MseI | MaeII TaiI SetI V S T D V F G R G I D I E R I N L A I N C P Q M F L V E V S I L N V L I * P S I V H R C F W * R Y R Y * T Y * F S H Q L ----:----|----:----|----:----|----:----|----:----|----:----| T D V S T K P L P I S I S R I L K A M L R T W L H K Q Y L Y R Y Q V Y * N L W * H G C I N K T S T D I N F T N I * G D I AluI AluI CviJI SspI CviJI BccI TsoI | SetI |TspDTI | SetI \ \ \ \ \\ \ \ TACGATTTGACTAATGAAGCTGACCAATATTTACATCGTGTCGGTAGAGCTGGTAGATTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTAAACTGATTACTTCGACTGGTTATAAATGTAGCACAGCCATCTCGACCATCTAAA // / / / // / / || TsoI | CviJI |SspI | CviJI |BccI | AluI TspDTI | AluI TspEI SetI SetI Y D L T N E A D Q Y L H R V G R A G R F T I * L M K L T N I Y I V S V E L V D L R F D * * S * P I F T S C R * S W * I W ----:----|----:----|----:----|----:----|----:----|----:----| * S K V L S A S W Y K C R T P L A P L N N R N S * H L Q G I N V D H R Y L Q Y I V I Q S I F S V L I * M T D T S S T S K Csp6I MboII |RsaI | BinI* ||TsoI TspDTI | |CviJI |||DdeI | CviJI MboII MnlI TsoI | ||DdeI \\\\ \ \ \ \ \ \ \\\ GGTACTAAGGGTTTGGCTATTTCATTCGTTTCTTCAAAGGAAGATGAGGAAGTCTTGGCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGATTCCCAAACCGATAAAGTAAGCAAAGAAGTTTCCTTCTACTCCTTCAGAACCGA /// // / / / / / / ||| |TspDTI CviJI MboII MnlI TsoI MboII CviJI ||| DdeI BinI* ||Csp6I |RsaI TsoI G T K G L A I S F V S S K E D E E V L A V L R V W L F H S F L Q R K M R K S W L Y * G F G Y F I R F F K G R * G S L G * ----:----|----:----|----:----|----:----|----:----|----:----| P V L P K A I E N T E E F S S S S T K A Q Y * P N P * K M R K K L P L H P L R P T S L T Q S N * E N R * L F I L F D Q S Hin4II* | BsiYI* | |TspGWI | || BinI* MboI | || | MboI XhoII ApoI | || | |MboII | DpnI TspEI | || | ||DpnI | |BstKTI TaqI EcoRI | || | |||BstKTI \ \\ \ \ \ \\ \ \\\\ AAGATCCAAGAGCGTTTCGATGTCAAAATCGCTGAATTCCCAGAAGAAGGCATTGATCCG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGGTTCTCGCAAAGCTACAGTTTTAGCGACTTAAGGGTCTTCTTCCGTAACTAGGC /// / / // / / / /// / ||| XhoII TaqI || | | | ||| MboI ||| MboI || | | | ||DpnI ||DpnI || | | | |BstKTI |BstKTI || | | | MboII DdeI || | | BinI* || | TspGWI || BsiYI* |Hin4II* EcoRI TspEI ApoI K I Q E R F D V K I A E F P E E G I D P R S K S V S M S K S L N S Q K K A L I R D P R A F R C Q N R * I P R R R H * S V ----:----|----:----|----:----|----:----|----:----|----:----| L I W S R K S T L I A S N G S S P M S G * S G L A N R H * F R Q I G L L L C Q D L D L L T E I D F D S F E W F F A N I R TspEI Hpy166II | MseI \ \ \ TCCACTTATTTGAATAATTAA 1330 1340 ----:----|----:----|- AGGTGAATAAACTTATTAATT / // Hpy166II |MseI TspEI S T Y L N N * P L I * I I X H L F E * L X ----:----|----:----|- D V * K F L * T W K N S Y N G S I Q I I L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 1 AluI 9 AluBI ApoI 5 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 2 Bce83I* 1 BpuEI BceAI 1 BciVI 1 BfuI BetI* 1 BsaWI BglI 1 BinI* 2 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 2 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BseRI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 2 BspHI 1 CciI,PagI,RcaI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 2 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 4 CviJI 20 CviKI-1 CviRI* 7 HpyCH4V DdeI 7 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 2 MalI DrdI 1 AasI,DseDI Eco57I 2 AcuI Eco57MI 4 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 4 FokI 2 GlaI 1 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 4 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 1 HpaII 2 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 3 Hpy99I 1 KasI 1 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 4 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 MfeI 1 MunI MnlI 7 MseI 7 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NarI 1 Mly113I NdeI 1 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 3 MspA1I OliI 1 AleI PshAI 2 BstPAI,BoxI PstI 1 PvuII 2 RsaI 4 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SetI 25 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 2 TaiI 6 TaqI 3 TatI 1 TauI 2 TfiI 1 PfeI TseI 1 ApeKI TsoI 3 Tsp45I 2 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 18 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI VspI 1 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflII AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BalI BamHI BarI BbvCI BbvII* BcgI BclI BdaI BfiI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI CauII* Cfr9I CfrI CspCI DraII DraIII DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoRV EcoT22I Esp3I FaqI FauI FnuDII* FseI FspAI GsaI HgiAI* HgiJII* Hin4I HindIII HpaI MauBI McrI* MluI MlyI MmeI Mph1103I MroNI MstI* NaeI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* SchI SduI SecI* SexAI SfiI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TspMI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769