Restriction Map of IDP1/YDL066W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

IDP1/YDL066W on chromosome IV from coordinates 334835 to 336121.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.30320

MnlI XbaI MboII |TseI |MaeI |BbvI ||BisI |Hpy178III* || SetI |||BlsI MseI \\ \\ \ \\\\ \ ATGAGTATGTTATCTAGAAGATTATTTTCCACCTCTCGCCTTGCTGCTTTCAGTAAGATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCATACAATAGATCTTCTAATAAAAGGTGGAGAGCGGAACGACGAAAGTCATTCTAA // / / / / /// |XbaI | | BbvI | ||TseI Hpy178III* | SetI | |BisI MaeI MboII | BlsI MnlI M S M L S R R L F S T S R L A A F S K I * V C Y L E D Y F P P L A L L L S V R L E Y V I * K I I F H L S P C C F Q * D * ----:----|----:----|----:----|----:----|----:----|----:----| X L I N D L L N N E V E R R A A K L L I X S Y T I * F I I K W R E G Q Q K * Y S H T H * R S S * K G G R A K S S E T L N BdaI MmeI BdaI SetI TaqI |Tsp4CI* HphI TspDTI \ \ \\ \ \ AAGGTCAAACAACCCGTTGTCGAGTTGGACGGTGATGAAATGACCCGTATCATTTGGGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCAGTTTGTTGGGCAACAGCTCAACCTGCCACTACTTTACTGGGCATAGTAAACCCTA / / / / / / / | MmeI TaqI | Tsp4CI* HphI TspDTI MseI BdaI SetI BdaI K V K Q P V V E L D G D E M T R I I W D R S N N P L S S W T V M K * P V S F G I G Q T T R C R V G R * * N D P Y H L G * ----:----|----:----|----:----|----:----|----:----|----:----| L T L C G T T S N S P S S I V R I M Q S * P * V V R Q R T P R H H F S G Y * K P L D F L G N D L Q V T I F H G T D N P I MboI | DpnI | BdaI | BdaI | |BstKTI | ||Hpy178III* | ||| TspEI TatI | ||| | TfiI MaeII |Csp6I | ||| | HinfI | SetI ||RsaI | ||| | | MboII | TaiI ||ScaI \ \\\ \ \ \ \ \ \\\ AAGATCAAGAAGAAATTGATTCTACCCTACTTGGACGTAGATTTGAAGTACTACGACTTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGTTCTTCTTTAACTAAGATGGGATGAACCTGCATCTAAACTTCATGATGCTGAAT /// / / / // / / /// / ||| | | | |HinfI | MaeII ||TatI DrdI ||| | | | |TfiI TaiI |Csp6I ||| | | | MboII SetI ScaI ||| | | TspEI RsaI ||| | Hpy178III* ||| MboI ||DpnI |BstKTI BdaI BdaI K I K K K L I L P Y L D V D L K Y Y D L R S R R N * F Y P T W T * I * S T T T Y D Q E E I D S T L L G R R F E V L R L I ----:----|----:----|----:----|----:----|----:----|----:----| L I L F F N I R G * K S T S K F Y * S K Y S * S S I S E V R S P R L N S T S R S L D L L F Q N * G V Q V Y I Q L V V V * DrdI | TaqI | | TfiI | | BsaXI | | Hin4I | | HinfI | | | BsiI* | | | | MaeIII | | | | Tsp45I | | | | Hpy178III* | | | | | AcyI | | | | | | EcoP15I | | | | | | | SetI | | | | | | | HgaI | | | | | | | | Hpy188I | | | | | | | | | BbvI | | | | | | | | | MnlI | | | | | | | | | SfaNI | | | | | | | | | | BsaXI | | | | | | | | | | |DdeI | | | | | | | | | | ||Hin4I | | | | | | | | | | |||Hpy178III* | | | | | | | | | | ||||BseMII | | | | | | | | | | |||||BspCNI | | | | | | | | | | |||||| MnlI | | | | | | | | | | |||||| |TseI | | | | | | | | | | |||||| ||BisI | | | | | | | | | | |||||| |||BlsI | | | | | | | | | | |||||| |||BseGI | | | | | | | | | | |||||| |||| DdeI | | | | | | | | | | |||||| |||| MmeI | | | | | | | | | | |||||| |||| BbvCI | | | | | | | | | | |||||| |||| Bpu10I | | | | | | | | | | |||||| |||| |BspCNI | | | | | | | | | | |||||| |||| ||MwoI | | | | | | | | | | |||||| |||| ||BseMII | | | | | | | | | | |||||| |||| ||| FokI | | | | | | | | | | |||||| |||| ||| |MboI | | | | | | | | | | |||||| |||| ||| || DpnI | | | | | | | | | | |||||| |||| ||| || |BstKTI | | | | | | | | | | |||||| |||| ||| || ||Hpy178III* \ \ \ \ \ \ \ \ \ \ \\\\\\ \\\\ \\\ \\ \\\ TCTGTCGAATCTCGTGACGCCACCTCCGACAAGATTACTCAGGATGCTGCTGAGGCGATC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGACAGCTTAGAGCACTGCGGTGGAGGCTGTTCTAATGAGTCCTACGACGACTCCGCTAG / / / / / // / / / / / / //// / ///// / //// | | | | | || | | | | | | |||| | ||||| | |||MboI | | | | | || | | | | | | |||| | ||||| | ||FokI | | | | | || | | | | | | |||| | ||||| | |DpnI | | | | | || | | | | | | |||| | ||||| | BstKTI | | | | | || | | | | | | |||| | ||||| Bpu10I | | | | | || | | | | | | |||| | ||||| BbvCI | | | | | || | | | | | | |||| | ||||| DdeI | | | | | || | | | | | | |||| | ||||BseMII | | | | | || | | | | | | |||| | |||BspCNI | | | | | || | | | | | | |||| | |||MwoI | | | | | || | | | | | | |||| | |||TseI | | | | | || | | | | | | |||| | ||MmeI | | | | | || | | | | | | |||| | ||BisI | | | | | || | | | | | | |||| | |BlsI | | | | | || | | | | | | |||| | BseGI | | | | | || | | | | | | |||| MnlI | | | | | || | | | | | | |||Hpy178III* | | | | | || | | | | | | ||DdeI | | | | | || | | | | | | |BspCNI | | | | | || | | | | | | BseMII | | | | | || | | | | | SfaNI | | | | | || | | | | | BbvI | | | | | || | | | | Hin4I | | | | | || | | | | BsaXI | | | | | || | | | MnlI | | | | | || | | HgaI | | | | | || | Hpy188I | | | | | || EcoP15I | | | | | || SetI | | | | | |AcyI | | | | | Tsp45I | | | | | MaeIII | | | | Hpy178III* | | | | BsiI* | | | HinfI | | | TfiI | | TaqI | BsaXI Hin4I S V E S R D A T S D K I T Q D A A E A I L S N L V T P P P T R L L R M L L R R S C R I S * R H L R Q D Y S G C C * G D Q ----:----|----:----|----:----|----:----|----:----|----:----| D T S D R S A V E S L I V * S A A S A I I Q R I E H R W R R C S * E P H Q Q P S R D F R T V G G G V L N S L I S S L R D BccI Hpy178III* | BdaI | BdaI | | AluI | | CviJI | | |BsiI* | | ||SetI | | ||BsaXI | | ||Hin4II* | | ||| TstI TstI | | ||| | BsgI BsaXI | | ||| | | TspDTI \ \ \ \\\ \ \ \ AAGAAGTATGGTGTTGGTATCAAATGTGCCACCATCACTCCTGATGAAGCTCGTGTGAAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTCATACCACAACCATAGTTTACACGGTGGTAGTGAGGACTACTTCGAGCACACTTC / / / /// //// // / Hpy178III* | BsaXI ||| |||| || TspDTI TstI ||| |||| |BsiI* ||| |||| BsgI ||| |||Hin4II* ||| ||CviJI ||| ||AluI ||| |BsaXI ||| |TstI ||| SetI ||BdaI ||BdaI |Hpy178III* BccI K K Y G V G I K C A T I T P D E A R V K R S M V L V S N V P P S L L M K L V * R E V W C W Y Q M C H H H S * * S S C E G ----:----|----:----|----:----|----:----|----:----|----:----| L F Y P T P I L H A V M V G S S A R T F * S T H H Q Y * I H W W * E Q H L E H S L L I T N T D F T G G D S R I F S T H L NmeAIII | Acc65I SetI | HgiCI* ApoI |CviRI* | |Csp6I XmnI || BspMI | ||RsaI TspEI || | BdaI | ||NlaIV Hpy188I EcoRI || | BdaI | ||| KpnI | BccI AciI \ \\ \ \ \ \\\ \ \ \ \ GAATTCAACCTGCACAAGATGTGGAAATCTCCTAATGGTACCATCAGAAACATTCTCGGC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAGTTGGACGTGTTCTACACCTTTAGAGGATTACCATGGTAGTCTTTGTAAGAGCCG / / / / / / / / /// / / | | SetI | | BspMI | | ||| | BccI | EcoRI | BdaI | | ||| Hpy188I | TspEI | BdaI | | ||HgiCI* | ApoI CviRI* | | ||Acc65I XmnI | | |Csp6I | | NlaIV | | RsaI | KpnI NmeAIII E F N L H K M W K S P N G T I R N I L G N S T C T R C G N L L M V P S E T F S A I Q P A Q D V E I S * W Y H Q K H S R R ----:----|----:----|----:----|----:----|----:----|----:----| S N L R C L I H F D G L P V M L F M R P P I * G A C S T S I E * H Y W * F C E R F E V Q V L H P F R R I T G D S V N E A Csp6I |RsaI || Tsp4CI* || | TspRI || | | Hpy188I || | | | CviJI || | | | | SduI AsuI* || | | | | HgiJII* AvaII || | | | | | TfiI |BmgT120I || | | | | | HinfI ||BsrI || | | | | | | MaeI ||NlaIV || | | | | | | | BslFI ||| MaeII || | | | | | | | |ApoI ||| | SetI || | | | | | | | |TspEI ||| | TaiI || | | | | | | | |EcoRI MaeI ||| | BsiYI* \\ \ \ \ \ \ \ \ \\ \ \\\ \ \ GGTACAGTGTTCAGAGAGCCCATTGTGATTCCTAGAATTCCTAGACTGGTCCCACGTTGG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGTCACAAGTCTCTCGGGTAACACTAAGGATCTTAAGGATCTGACCAGGGTGCAACC ///// / / / / / // / / // // / ||||| | | CviJI | | || MaeI | || || MaeII ||||| | HgiJII* | | |EcoRI | || |BsiYI* ||||| | SduI | | |TspEI | || TaiI ||||| Hpy188I | | |ApoI | || SetI ||||Tsp4CI* | | BslFI | |AvaII |||Csp6I | MaeI | |AsuI* ||RsaI HinfI | BmgT120I |TspRI TfiI | NlaIV AciI BsrI G T V F R E P I V I P R I P R L V P R W V Q C S E S P L * F L E F L D W S H V G Y S V Q R A H C D S * N S * T G P T L G ----:----|----:----|----:----|----:----|----:----|----:----| P V T N L S G M T I G L I G L S T G R Q R Y L T * L A W Q S E * F E * V P G V N T C H E S L G N H N R S N R S Q D W T P BbvII* | SecI* | DsaI* | | MboII | | | Tsp4CI* | | | | MboI HphI | | | | BclI | AluI | | | | | DpnI | CviJI | | | | | |BstKTI | | SetI BinI* \ \ \ \ \ \\ \ \ \ \ GAAAAACCAATCATTATTGGAAGACACGCCCACGGTGATCAATATAAAGCTACGGACACA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTGGTTAGTAATAACCTTCTGTGCGGGTGCCACTAGTTATATTTCGATGCCTGTGT / // // / / / / / / | || || BclI | | CviJI | BinI* | || || MboI | | AluI TspRI | || |DpnI | SetI | || BstKTI HphI | |DsaI* | |SecI* | Tsp4CI* BbvII* MboII E K P I I I G R H A H G D Q Y K A T D T K N Q S L L E D T P T V I N I K L R T H K T N H Y W K T R P R * S I * S Y G H T ----:----|----:----|----:----|----:----|----:----|----:----| S F G I M I P L C A W P S * Y L A V S V P F V L * * Q F V R G R H D I Y L * P C F F W D N N S S V G V T I L I F S R V C MboI | DpnI | |TspRI | |BstKTI | ||BssKI | ||SecI* | ||EcoRII | |||TspGWI | ||||ScrFI | ||||BseBI | ||||| AsuI* | ||||| |CviJI | ||||| |HaeIII | ||||| |BmgT120I | ||||| ||BssKI | ||||| ||SecI* | ||||| ||EcoRII | ||||| |||BsiYI* | ||||| ||||ScrFI | ||||| ||||BseBI AccI | ||||| ||||| MboI BsrI | ||||| ||||| XhoII |Hpy166II | ||||| ||||| | DpnI || CviJI | ||||| ||||| | |BstKTI || |BseGI | ||||| ||||| | || BinI* || || Hpy188I | ||||| ||||| | || | FokI || || | BccI CspCI \ \\\\\ \\\\\ \ \\ \ \ \\ \\ \ \ \ CTGATCCCAGGCCCAGGATCTTTGGAACTGGTCTACAAGCCATCCGACCCTACGACTGCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GACTAGGGTCCGGGTCCTAGAAACCTTGACCAGATGTTCGGTAGGCTGGGATGCTGACGA //// ///// //// / / // // // / / / |||| ||||| |||| | | || || || | | CspCI |||| ||||| |||| | | || || || | BccI |||| ||||| |||| | | || || || Hpy188I |||| ||||| |||| | | || || |CviJI |||| ||||| |||| | | || || BseGI |||| ||||| |||| | | || |AccI |||| ||||| |||| | | || Hpy166II |||| ||||| |||| | | |FokI |||| ||||| |||| | | BsrI |||| ||||| |||| | BinI* |||| ||||| |||| XhoII |||| ||||| |||| MboI |||| ||||| |||DpnI |||| ||||| ||EcoRII |||| ||||| ||BstKTI |||| ||||| ||BssKI |||| ||||| |SecI* |||| ||||| BseBI |||| ||||| ScrFI |||| ||||AsuI* |||| |||BmgT120I |||| ||EcoRII |||| ||HaeIII |||| ||BssKI |||| ||CviJI |||| |BsiYI* |||| |SecI* |||| BseBI |||| ScrFI |||MboI ||TspGWI |DpnI BstKTI L I P G P G S L E L V Y K P S D P T T A * S Q A Q D L W N W S T S H P T L R L L D P R P R I F G T G L Q A I R P Y D C S ----:----|----:----|----:----|----:----|----:----|----:----| S I G P G P D K S S T * L G D S G V V A V S G L G L I K P V P R C A M R G * S Q Q D W A W S R Q F Q D V L W G V R R S S BtsI TspRI | CfrI | | BalI | | CviJI | | HaeIII | | |FatI | | |NcoI | | |StyI | | |SecI* | | |DsaI* | | ||CviAII | | ||| CfrI | | ||| |NlaIII | | ||| ||BalI | | ||| ||MslI | | ||| ||CviJI | | ||| ||HaeIII | | ||| |||FatI | | ||| |||CspCI | | ||| ||||CviAII | | ||| ||||| TatI | | ||| ||||| Bsp1407I | | ||| ||||| |Csp6I | | ||| ||||| |NlaIII MmeI CspCI CspCI | | ||| ||||| ||RsaI \ \ \ \ \ \\\ \\\\\ \\\ CAACCACAAACTTTGAAAGTGTATGACTACAAGGGCAGTGGTGTGGCCATGGCCATGTAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGGTGTTTGAAACTTTCACATACTGATGTTCCCGTCACCACACCGGTACCGGTACATG / / / / / /// ///// ///// MmeI CspCI CspCI TspRI BtsI ||| ||||| ||||Bsp1407I ||| ||||| ||||TatI ||| ||||| |||Csp6I ||| ||||| ||RsaI ||| ||||| |FatI ||| ||||| CviAII ||| ||||CfrI ||| |||NlaIII ||| ||HaeIII ||| ||CviJI ||| ||MslI ||| ||BalI ||| |CspCI ||| |DsaI* ||| |SecI* ||| |StyI ||| |NcoI ||| |FatI ||| CviAII ||CfrI |NlaIII HaeIII CviJI BalI Q P Q T L K V Y D Y K G S G V A M A M Y N H K L * K C M T T R A V V W P W P C T T T N F E S V * L Q G Q W C G H G H V Q ----:----|----:----|----:----|----:----|----:----|----:----| * G C V K F T Y S * L P L P T A M A M Y E V V F K S L T H S C P C H H P W P W T L W L S Q F H I V V L A T T H G H G H V BcgI | AluI BcgI | CviJI | TfiI | | CfrI | HinfI | | SetI | | Hin4II* | | Cac8I | | | TaqI | | | BalI | | | | BsiYI* | | | CviJI | | | | | BccI | | | HaeIII \ \ \ \ \ \ \ \ \ \ AATACTGACGAATCCATCGAAGGGTTTGCTCATTCGTCTTTCAAGCTGGCCATTGACAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGACTGCTTAGGTAGCTTCCCAAACGAGTAAGCAGAAAGTTCGACCGGTAACTGTTT / // / / / / / / / / / BcgI || | | BccI | | | | | CfrI || | TaqI | | | | HaeIII || BsiYI* | | | | CviJI |HinfI | | | | BalI |TfiI | | | Cac8I Hin4II* | | CviJI | | AluI | SetI BcgI N T D E S I E G F A H S S F K L A I D K I L T N P S K G L L I R L S S W P L T K Y * R I H R R V C S F V F Q A G H * Q K ----:----|----:----|----:----|----:----|----:----|----:----| L V S S D M S P N A * E D K L S A M S L C Y Q R I W R L T Q E N T K * A P W Q C I S V F G D F P K S M R R E L Q G N V F AluI MboII CviJI HindII |Tsp4CI* | SetI Hpy166II || McrI* \ \ \ \\ \ AAGCTAAATCTTTTCTTGTCAACCAAGAACACTATTTTGAAGAAATATGACGGTCGGTTC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGATTTAGAAAAGAACAGTTGGTTCTTGTGATAAAACTTCTTTATACTGCCAGCCAAG / / / /// | CviJI Hpy166II ||McrI* | AluI HindII |Tsp4CI* SetI MboII K L N L F L S T K N T I L K K Y D G R F S * I F S C Q P R T L F * R N M T V G S A K S F L V N Q E H Y F E E I * R S V Q ----:----|----:----|----:----|----:----|----:----|----:----| F S F R K K D V L F V I K F F Y S P R N F A L D K R T L W S C * K S S I H R D T L * I K E Q * G L V S N Q L F I V T P E TspDTI BinI* | ApoI |MaeI AluI | TspEI || MboI CviJI | | TaqI || BamHI | SetI | | AsuII || XhoII \ \ \ \ \ \\ \ AAAGACATTTTCCAAGAAGTTTATGAAGCTCAATATAAATCCAAATTCGAACAACTAGGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTGTAAAAGGTTCTTCAAATACTTCGAGTTATATTTAGGTTTAAGCTTGTTGATCCC / / / / / / / / | CviJI TspDTI | AsuII | | BstKTI | AluI | TaqI | MaeI SetI TspEI BinI* ApoI K D I F Q E V Y E A Q Y K S K F E Q L G K T F S K K F M K L N I N P N S N N * G R H F P R S L * S S I * I Q I R T T R D ----:----|----:----|----:----|----:----|----:----|----:----| L S M K W S T * S A * Y L D L N S C S P * L C K G L L K H L E I Y I W I R V V L F V N E L F N I F S L I F G F E F L * P DpnI Tsp4CI* NlaIV | MseI |BstKTI | |TspEI || BinI* | || TspDTI SetI \\ \ \ \\ \ \ ATCCACTATGAACACCGTTTAATTGATGATATGGTCGCTCAAATGATAAAATCTAAAGGT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGTGATACTTGTGGCAAATTAACTACTATACCAGCGAGTTTACTATTTTAGATTTCCA / / / / / / / | | BinI* | | TspEI SetI | XhoII | TspDTI | BamHI | MseI | MboI Tsp4CI* NlaIV DpnI I H Y E H R L I D D M V A Q M I K S K G S T M N T V * L M I W S L K * * N L K V P L * T P F N * * Y G R S N D K I * R W ----:----|----:----|----:----|----:----|----:----|----:----| I W * S C R K I S S I T A * I I F D L P S G S H V G N L Q H Y P R E F S L I * L D V I F V T * N I I H D S L H Y F R F T Bce83I* FatI | HphI |CviAII | | Hpy188I || NlaIII | | | Tth111I || |Hin6I | | | | Hpy99I || ||GlaI | | | | |SmlI || |||HhaI Hin4I Tsp4CI* | | | | ||Hin4I CviJI || ||||HaeII Hin4I | DrdI | | | | ||Hin4I \ \\ \\\\\ \ \ \ \ \ \ \ \\\ GGCTTTATCATGGCGCTAAAGAACTATGACGGTGATGTCCAATCTGACATCGTCGCTCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAAATAGTACCGCGATTTCTTGATACTGCCACTACAGGTTAGACTGTAGCAGCGAGTT / / ///// / / / / / / / / / CviJI | ||||| Hin4I | DrdI | | | | Hin4I SmlI | ||||| Hin4I Tsp4CI* | | | | Hin4I | ||||Hin6I | | | Tth111I | |||GlaI | | | Hpy99I | ||HhaI | | Hpy188I | |HaeII | HphI | |FatI Bce83I* | CviAII NlaIII G F I M A L K N Y D G D V Q S D I V A Q A L S W R * R T M T V M S N L T S S L K L Y H G A K E L * R * C P I * H R R S R ----:----|----:----|----:----|----:----|----:----|----:----| P K I M A S F F * S P S T W D S M T A * H S * * P A L S S H R H H G I Q C R R E A K D H R * L V I V T I D L R V D D S L Tsp4CI* | BdaI CviJI | BdaI |NlaIV | | BbvI || DdeI DdeI | | | TaqI || SauI* SetI | MaeIII | | | AsuII \\ \ \ \ \ \ \ \ \ GGATTTGGCTCCTTAGGTTTGATGACTTCTATCTTAGTTACACCAGACGGTAAAACTTTC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAAACCGAGGAATCCAAACTACTGAAGATAGAATCAATGTGGTCTGCCATTTTGAAAG // // / / / / || |SauI* DdeI MaeIII | BdaI || |DdeI | BdaI || SetI Tsp4CI* |NlaIV CviJI G F G S L G L M T S I L V T P D G K T F D L A P * V * * L L S * L H Q T V K L S I W L L R F D D F Y L S Y T R R * N F R ----:----|----:----|----:----|----:----|----:----|----:----| P N P E K P K I V E I K T V G S P L V K L I Q S R L N S S K * R L * V L R Y F K S K A G * T Q H S R D * N C W V T F S E TseI AluI CviJI |BisI ||BlsI ||SetI ||| FatI ||| |CviAII ||| || Acc65I ||| || HgiCI* ||| || NlaIII ||| || |Csp6I ||| || ||RsaI ||| || ||NlaIV ||| || ||| KpnI ||| || ||| |MaeIII ||| || ||| |Tsp45I ||| || ||| |Tsp4CI* ||| || ||| || BdaI Csp6I ||| || ||| || BdaI |RsaI \\\ \\ \\\ \\ \ \\ GAAAGTGAAGCTGCTCATGGTACCGTGACAAGACATTATAGAAAGTACCAAAAGGGTGAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCACTTCGACGAGTACCATGGCACTGTTCTGTAATATCTTTCATGGTTTTCCCACTT / / //// / // /// / / // AsuII | |||| | || ||| | Tsp45I |Csp6I TaqI | |||| | || ||| | MaeIII RsaI BbvI | |||| | || ||| BdaI | |||| | || ||| BdaI | |||| | || ||Tsp4CI* | |||| | || ||HgiCI* | |||| | || ||Acc65I | |||| | || |Csp6I | |||| | || NlaIV | |||| | || RsaI | |||| | |FatI | |||| | |KpnI | |||| | CviAII | |||| NlaIII | |||TseI | ||BisI | |BlsI | CviJI | AluI SetI E S E A A H G T V T R H Y R K Y Q K G E K V K L L M V P * Q D I I E S T K R V K K * S C S W Y R D K T L * K V P K G * R ----:----|----:----|----:----|----:----|----:----|----:----| S L S A A * P V T V L C * L F Y W F P S R F H L Q E H Y R S L V N Y F T G F P H F T F S S M T G H C S M I S L V L L T F SfaNI | FnuDII* | | MnlI | | | TaqI | | | |Hpy178III* HphI BsrDI | | | || SetI | FokI | BseGI | | | || |Ksp632I* | |MboII | CviRI* | | | || || MnlI \ \\ \ \ \ \ \ \\ \\ \ GAAACTTCTACAAACTCCATTGCATCCATTTTCGCGTGGTCGAGAGGTCTATTGAAGAGA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGAAGATGTTTGAGGTAACGTAGGTAAAAGCGCACCAGCTCTCCAGATAACTTCTCT / / / / / / /// /// // / | | | | | CviRI* ||MnlI ||SetI || SetI | | | | BseGI |SfaNI || |Ksp632I* | | | BsrDI FnuDII* || MnlI | | FokI |Hpy178III* | MboII TaqI HphI E T S T N S I A S I F A W S R G L L K R K L L Q T P L H P F S R G R E V Y * R E N F Y K L H C I H F R V V E R S I E E R ----:----|----:----|----:----|----:----|----:----|----:----| S V E V F E M A D M K A H D L P R N F L L F K * L S W Q M W K R T T S L D I S S F S R C V G N C G N E R P R S T * Q L S EciI SspI | BstXI SetI | | TfiI |TspEI ApoI | | HinfI || MboII HphI TspEI | | | AciI \\ \ \ \ \ \ \ \ GGTGAATTGGACAATACTCCTGCTTTGTGTAAATTTGCCAATATTTTGGAATCCGCCACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTTAACCTGTTATGAGGACGAAACACATTTAAACGGTTATAAAACCTTAGGCGGTGA / / / / /// / / | | HphI | ||SspI | AciI | TspEI | |BstXI HinfI MboII | EciI TfiI TspEI ApoI G E L D N T P A L C K F A N I L E S A T V N W T I L L L C V N L P I F W N P P L * I G Q Y S C F V * I C Q Y F G I R H F ----:----|----:----|----:----|----:----|----:----|----:----| P S N S L V G A K H L N A L I K S D A V L H I P C Y E Q K T Y I Q W Y K P I R W T F Q V I S R S Q T F K G I N Q F G G S Tsp4CI* CviJI | FatI | Cac8I | BspHI | |BcgI | |CviAII | ||AciI | |Hin4II* | ||| MaeIII | |Hpy178III* | ||| | FalI Tsp4CI* | || NlaIII CviJI | ||| | FalI \ \ \\ \ \ \ \\\ \ \ TTGAACACAGTTCAGCAAGACGGTATCATGACGAAGGACTTGGCTTTGGCTTGCGGTAAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTGTGTCAAGTCGTTCTGCCATAGTACTGCTTCCTGAACCGAAACCGAACGCCATTG / / / // / //// / / Tsp4CI* | | |BspHI CviJI |||| AciI MaeIII | | |FatI |||FalI | | Hpy178III* |||FalI | | CviAII ||Cac8I | Hin4II* |BcgI | NlaIII CviJI Tsp4CI* L N T V Q Q D G I M T K D L A L A C G N * T Q F S K T V S * R R T W L W L A V T E H S S A R R Y H D E G L G F G L R * Q ----:----|----:----|----:----|----:----|----:----|----:----| K F V T * C S P I M V F S K A K A Q P L K S C L E A L R Y * S S P S P K P K R Y Q V C N L L V T D H R L V Q S Q S A T V BcgI | BceAI MboI | |FalI BglII | |FalI XhoII | ||SfaNI | DpnI | |||ApoI MboII | |BstKTI MaeIII | |||TspEI | BseGI FokI \ \\ \ \ \\\\ \ \ \ AACGAAAGATCTGCTTATGTTACCACAGAAGAATTTTTGGATGCCGTTGAAAAAAGACTA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTTCTAGACGAATACAATGGTGTCTTCTTAAAAACCTACGGCAACTTTTTTCTGAT // / // / // / / / || XhoII |BcgI | || | BseGI FokI || BglII |FalI | || MboII || MboI |FalI | |TspEI |DpnI MaeIII | |ApoI BstKTI | SfaNI BceAI N E R S A Y V T T E E F L D A V E K R L T K D L L M L P Q K N F W M P L K K D Y R K I C L C Y H R R I F G C R * K K T T ----:----|----:----|----:----|----:----|----:----|----:----| L S L D A * T V V S S N K S A T S F L S C R F I Q K H * W L L I K P H R Q F F V V F S R S I N G C F F K Q I G N F F S * TaqI |MboI || DpnI || |TaqI || |PvuI || |McrI* || |BstKTI \\ \\ CAAAAAGAAATCAAGTCGATCGAGTAA 1270 1280 ----:----|----:----|----:-- GTTTTTCTTTAGTTCAGCTAGCTCATT // // || |TaqI || MboI |DpnI BstKTI McrI* TaqI PvuI Q K E I K S I E * K K K S S R S S X K R N Q V D R V X ----:----|----:----|----:-- C F S I L D I S Y V F L F * T S R T L F F D L R D L L # Enzymes that cut Frequency Isoschizomers Acc65I 2 Asp718I AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 6 AluBI ApoI 5 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 3 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvCI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 1 BpuEI BceAI 1 BcgI 2 BclI 1 FbaI,Ksp22I BdaI 6 BglII 1 BinI* 4 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 2 Bpu10I 1 BsaXI 2 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 2 BsgI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 8 BstXI 1 BtsI 1 Cac8I 2 BstC8I CfrI 3 AcoI,EaeI Csp6I 6 CviQI,RsaNI CspCI 2 CviAII 5 CviJI 16 CviKI-1 CviRI* 2 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 8 MalI DrdI 2 AasI,DseDI DsaI* 2 BtgI,BstDSI EciI 1 EcoP15I 1 EcoRI 2 EcoRII 2 AjnI,Psp6I,PspGI FalI 2 FatI 5 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 1 HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 5 HphI 5 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 5 Hpy99I 1 KpnI 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 5 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 McrI* 2 BsiEI,BstMCI,Bsh1285I MmeI 3 MnlI 5 MseI 2 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NmeAIII 1 PvuI 1 MvrI,Ple19I,BpvUI RsaI 6 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 16 SfaNI 3 LweI SmlI 1 SmoI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 8 TatI 2 TfiI 5 PfeI TseI 3 ApeKI Tsp45I 2 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI TstI 1 Tth111I 1 PflFI,PsyI,AspI XbaI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AvaI AvrII BaeI BarI BciVI BetI* BfiI BglI BmeT110I BmtI BplI BsaAI BsaBI BsePI BseRI BseSI BseYI BsmAI BsmI Bsp120I BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I ClaI DinI DraII DraIII Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GsaI GsuI HgiAI* HindIII HpaI HpaII KasI MauBI MfeI MluI MlyI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SanDI SapI SchI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI TsoI TspMI VspI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769