Restriction Map of YDL050C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

YDL050C on chromosome IV from coordinates 364817 to 364446.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 TfiI HinfI SduI MboII BseRI HgiAI* \ \ \ ATGATAATGAGATACGAGAACCAGAAGAAACACAAGAATCACTCCTTGTGCTCCTCATCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTATTACTCTATGCTCTTGGTCTTCTTTGTGTTCTTAGTGAGGAACACGAGGAGTAGC / // / | |BseRI HgiAI* | HinfI SduI | TfiI MboII M I M R Y E N Q K K H K N H S L C S S S * * * D T R T R R N T R I T P C A P H R D N E I R E P E E T Q E S L L V L L I V ----:----|----:----|----:----|----:----|----:----|----:----| X I I L Y S F W F F C L F * E K H E E D X S L S I R S G S S V C S D S R T S R M H Y H S V L V L L F V L I V G Q A G * R MlyI PleI |MboII ||PleI ||BceAI |||MlyI Ksp632I* |||MboII | BsrDI |||| HinfI Ksp632I* MnlI | | HinfI |||| | MnlI | MboII \ \ \ \ \\\\ \ \ \ \ TCATCGGCAATGGCAGAAGAGTCCTCTTTTGACTCTTCCTTGCCGTTTTTCTTCTTATTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGCCGTTACCGTCTTCTCAGGAGAAAACTGAGAAGGAACGGCAAAAAGAAGAATAAA / / / / ///// / / // MnlI | | | ||||| | HinfI |Ksp632I* | | | ||||| MnlI MboII | | | ||||BceAI | | | |||PleI | | | |||MlyI | | | ||MboII | | | |PleI | | | MboII | | | MlyI | | HinfI | Ksp632I* BsrDI S S A M A E E S S F D S S L P F F F L F H R Q W Q K S P L L T L P C R F S S Y F I G N G R R V L F * L F L A V F L L I F ----:----|----:----|----:----|----:----|----:----|----:----| D D A I A S S D E K S E E K G N K K K N T M P L P L L T R K Q S K R A T K R R I * R C H C F L G R K V R G Q R K E E * K CfrI | CviJI | HaeIII | | MseI | | | FalI | | | FalI | | | | MboI | | | | XhoII | | | | | DpnI | | | | | |BstKTI | | | | | ||Hpy178III* | | | | | |||BsaBI | | | | | ||||MboI | | | | | ||||| DpnI ApoI | | | | | ||||| BinI* TspEI | | | | | ||||| |BstKTI |FalI MboII | | | | | ||||| || AciI |FalI | BceAI | | | | | ||||| || | NspBII* \\ \ \ \ \ \ \ \ \\\\\ \\ \ \ TTGGGGAATTTAGGCAAGTTTTTCTTCTTATGGCCGTTAAAGGATCTTGATCTACCGCTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCCTTAAATCCGTTCAAAAAGAAGAATACCGGCAATTTCCTAGAACTAGATGGCGAC / / / / /// / // /////// / FalI | MboII BceAI ||| | || ||||||MboI NspBII* FalI TspEI ||| | || |||||BinI* AciI ApoI ||| | || ||||DpnI ||| | || |||BstKTI ||| | || ||Hpy178III* ||| | || |BsaBI ||| | || XhoII ||| | || MboI ||| | |DpnI ||| | BstKTI ||| MseI ||CfrI |FalI |FalI HaeIII CviJI L G N L G K F F F L W P L K D L D L P L W G I * A S F S S Y G R * R I L I Y R * G E F R Q V F L L M A V K G S * S T A E ----:----|----:----|----:----|----:----|----:----|----:----| K P F K P L N K K K H G N F S R S R G S K P S N L C T K R R I A T L P D Q D V A Q P I * A L K E E * P R * L I K I * R Q StuI CviJI HaeIII Eco57I MnlI TaqI Eco57MI MnlI Tsp4CI* DdeI \ \ \ \ \ \ AAGTTTTTGGACTTCGAGGCCTCTCTCTGTAAATCAAACTGTTTTTTCGTCAAAACACTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAAAACCTGAAGCTCCGGAGAGAGACATTTAGTTTGACAAAAAAGCAGTTTTGTGAG / // / / / / MnlI || HaeIII MnlI Tsp4CI* TspDTI || CviJI || StuI |Eco57MI |Eco57I TaqI K F L D F E A S L C K S N C F F V K T L S F W T S R P L S V N Q T V F S S K H S V F G L R G L S L * I K L F F R Q N T Q ----:----|----:----|----:----|----:----|----:----|----:----| F N K S K S A E R Q L D F Q K K T L V S S T K P S R P R E R Y I L S N K R * F V L K Q V E L G R E T F * V T K E D F C E Hin4II* | ApoI MmeI | TspEI BspCNI | | Hin4I |SetI | | Hin4I |BseMII | | | MlyI HinfI Hin4I TspDTI || NdeI | | | PleI | Eam1105I Hin4I \ \\ \ \ \ \ \ \ \ \ AGTTTCTTACCTTCATATGACAAAATTTCGTTGGACTCATCGTCATTGGAATACGATTTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAAGAATGGAAGTATACTGTTTTAAAGCAACCTGAGTAGCAGTAACCTTATGCTAAAG / /// / // /// // / DdeI ||BseMII | |Hin4I ||PleI |Eam1105I Hin4I |BspCNI | |Hin4I |MlyI HinfI Hin4I |MmeI | Hin4II* TspEI SetI NdeI ApoI S F L P S Y D K I S L D S S S L E Y D F V S Y L H M T K F R W T H R H W N T I S F L T F I * Q N F V G L I V I G I R F Q ----:----|----:----|----:----|----:----|----:----|----:----| L K K G E Y S L I E N S E D D N S Y S K * N R V K M H C F K T P S M T M P I R N T E * R * I V F N R Q V * R * Q F V I E HindIII Tsp4CI* | AluI MseI | MseI | CviJI Hpy178III* | ApoI |Csp6I | ApoI | | SetI | TspEI | TspEI ||RsaI | TspEI \ \ \ \ \ \ \ \\\ \ \ AAAAAAGCTTCACATTCTGGAATTGTCTTAAATTCCACCAAGACCGTACCATTAAATTTC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTCGAAGTGTAAGACCTTAACAGAATTTAAGGTGGTTCTGGCATGGTAATTTAAAG / / / / / / / / // / / | | HindIII | TspEI | TspEI | |Csp6I | TspEI | CviJI Hpy178III* | ApoI | RsaI | ApoI | AluI MseI Tsp4CI* MseI SetI K K A S H S G I V L N S T K T V P L N F K K L H I L E L S * I P P R P Y H * I S K S F T F W N C L K F H Q D R T I K F L ----:----|----:----|----:----|----:----|----:----|----:----| L F A E C E P I T K F E V L V T G N F K * F L K V N Q F Q R L N W W S R V M L N F F S * M R S N D * I G G L G Y W * I E TTGTTTCTGTGA 370 ----:----|-- AACAAAGACACT L F L * C F C X V S V X ----:----|-- K N R H R T E T Q K Q S # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AluI 1 AluBI ApoI 4 AcsI,XapI BceAI 2 BinI* 1 AlwI,BspPI,AclWI BsaBI 1 Bse8I,BseJI BseMII 1 BseRI 1 BspCNI 1 BsrDI 1 BseMI,Bse3DI BstKTI 2 CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CviJI 3 CviKI-1 DdeI 1 BstDEI,HpyF3I DpnI 2 MalI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57I 1 AcuI Eco57MI 1 FalI 2 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I Hin4I 2 Hin4II* 1 HpyAV HindIII 1 HinfI 4 Hpy178III* 2 Hpy188III Ksp632I* 2 Eam1104I,EarI,Bst6I MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MlyI 3 SchI MmeI 1 MnlI 4 MseI 3 Tru1I,Tru9I NdeI 1 FauNDI NspBII* 1 MspA1I PleI 3 PpsI RsaI 1 AfaI SduI 1 MhlI,Bsp1286I SetI 2 StuI 1 Eco147I,PceI,SseBI,AatI TaqI 1 TfiI 1 PfeI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 5 TasI,Tsp509I,Sse9I XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaXI BseBI BseGI BsePI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I ClaI CspCI CviAII CviRI* DinI DraII DraIII DrdI DsaI* EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FatI FauI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiCI* HgiJII* HhaI Hin6I HindII HinP1I HpaI HpaII HphI Hpy166II Hpy188I Hpy8I Hpy99I HspAI KasI KpnI MaeI MaeII MaeIII MauBI McrI* MfeI MluI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI ScrFI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StyD4I StyI SwaI TaiI TaqII TatI TauI TseI TsoI Tsp45I TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769