Restriction Map of ARP2/YDL029W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ARP2/YDL029W on chromosome IV from coordinates 399340 to 400638.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26701

AsuI* AvaII |BmgT120I MfeI MfeI ||NlaIV TspEI MnlI TspEI \\\ \ \ \ ATGGACCCACATAATCCAATTGGTATGTTGTTGATATTTTTAGTGTTTGTGGAGGCAATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTGGGTGTATTAGGTTAACCATACAACAACTATAAAAATCACAAACACCTCCGTTAA // / / / |AvaII TspEI MnlI TspEI |AsuI* MfeI MfeI BmgT120I NlaIV M D P H N P I G M L L I F L V F V E A I W T H I I Q L V C C * Y F * C L W R Q L G P T * S N W Y V V D I F S V C G G N * ----:----|----:----|----:----|----:----|----:----|----:----| X S G C L G I P I N N I N K T N T S A I X P G V Y D L Q Y T T S I K L T Q P P L H V W M I W N T H Q Q Y K * H K H L C N AluI CviJI Ecl136II | SetI | SduI | SacI | HgiAI* | HgiJII* | | HgiCI* | | | NlaIV MwoI | | | | SduI | CviRI* | | | | BseSI CviJI | | MnlI \ \ \ \ \ \ \ \ \ GAGCTCGGTGCCCCTTTTGGCTTTGCCTCTTTTGCATTTTAGTTCTTTTACCCCTATATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGAGCCACGGGGAAAACCGAAACGGAGAAAACGTAAAATCAAGAAAATGGGGATATAA / / // / / / // | | || HgiCI* CviJI MwoI |MnlI | | |NlaIV CviRI* | | BseSI | | SduI | Ecl136II | CviJI | AluI HgiJII* HgiAI* SacI SduI SetI E L G A P F G F A S F A F * F F Y P Y I S S V P L L A L P L L H F S S F T P I L A R C P F W L C L F C I L V L L P L Y Y ----:----|----:----|----:----|----:----|----:----|----:----| S S P A G K P K A E K A N * N K * G * I Q A R H G K Q S Q R K Q M K T R K G R Y L E T G R K A K G R K C K L E K V G I N MboI BclI |EcoNI ||DpnI |||BstKTI Hpy178III* |||BsiYI* MseI |TaqI |||| Csp6I VspI || BccI TsoI |||| |RsaI BsrI TspEI \ \\ \ \ \\\\ \\ \ \ ATTAATACTAACCATCTCGATATAGTCCTTGATCAGGGTACTGGTTTCGTCAAAATTGGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTATGATTGGTAGAGCTATATCAGGAACTAGTCCCATGACCAAAGCAGTTTTAACCA / // / / /// / // / / VspI || | TsoI ||| BclI || BsrI TspEI MseI || BccI ||| MboI |Csp6I |TaqI ||EcoNI RsaI Hpy178III* ||DpnI |BstKTI BsiYI* I N T N H L D I V L D Q G T G F V K I G L I L T I S I * S L I R V L V S S K L V * Y * P S R Y S P * S G Y W F R Q N W S ----:----|----:----|----:----|----:----|----:----|----:----| I L V L W R S I T R S * P V P K T L I P * * Y * G D R Y L G Q D P Y Q N R * F Q N I S V M E I Y D K I L T S T E D F N T Hin4II* | AccI | |Hpy166II AflIII | || MnlI | MaeII | || | SmlI ApoI | | SetI | || | Hpy178III* Cac8I TspEI | | TaiI | || | | BsiYI* \ \ \ \ \ \ \\ \ \ \ CGTGCTGGCGAGAATTTCCCAGATTACACGTTTCCTTCTATTGTTGGTAGACCCATCTTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCACGACCGCTCTTAAAGGGTCTAATGTGCAAAGGAAGATAACAACCATCTGGGTAGAAC / / / / / // / / / Cac8I TspEI | AflIII | || | | Hpy178III* ApoI | MaeII | || | BsiYI* TaiI | || MnlI SetI | |AccI | Hpy166II Hin4II* R A G E N F P D Y T F P S I V G R P I L V L A R I S Q I T R F L L L L V D P S * C W R E F P R L H V S F Y C W * T H L E ----:----|----:----|----:----|----:----|----:----|----:----| R A P S F K G S * V N G E I T P L G M K D H Q R S N G L N C T E K * Q Q Y V W R T S A L I E W I V R K R R N N T S G D Q MaeII | SetI | TaiI | | Cac8I | | Bce83I* | | |EciI BccI | | |MboII | AciI | | || MwoI MseI MnlI \ \ \ \ \\ \ \ \ AGGGCGGAAGAACGTGCCAGCGTTGCTACACCATTAAAGGACATTATGATTGGTGATGAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGCCTTCTTGCACGGTCGCAACGATGTGGTAATTTCCTGTAATACTAACCACTACTC // / / / //// / / || AciI | | |||MwoI MseI MnlI |BccI | | ||MboII SmlI | | ||Cac8I | | |EciI | | Bce83I* | MaeII TaiI SetI R A E E R A S V A T P L K D I M I G D E G R K N V P A L L H H * R T L * L V M R G G R T C Q R C Y T I K G H Y D W * * G ----:----|----:----|----:----|----:----|----:----|----:----| L A S S R A L T A V G N F S M I I P S S S P P L V H W R Q * V M L P C * S Q H H P R F F T G A N S C W * L V N H N T I L Tsp4CI* | MseI HphI CviRI* | | TspEI \ \ \ \ \ GCAAGTGAAGTTCGCTCTTATCTGCAAATATCTTATCCTATGGAAAACGGTATTATTAAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCACTTCAAGCGAGAATAGACGTTTATAGAATAGGATACCTTTTGCCATAATAATTC / / / / HphI CviRI* Tsp4CI* MseI A S E V R S Y L Q I S Y P M E N G I I K Q V K F A L I C K Y L I L W K T V L L R K * S S L L S A N I L S Y G K R Y Y * E ----:----|----:----|----:----|----:----|----:----|----:----| A L S T R E * R C I D * G I S F P I I L P L H L E S K D A F I K D * P F R Y * * C T F N A R I Q L Y R I R H F V T N N L TaqI | FokI BseGI \ \ \ AATTGGACAGATATGGAACTTCTTTGGGATTACGCCTTTTTCGAGCAAATGAAACTACCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTAACCTGTCTATACCTTGAAGAAACCCTAATGCGGAAAAAGCTCGTTTACTTTGATGGT / / / / TspEI TaqI FokI BseGI N W T D M E L L W D Y A F F E Q M K L P I G Q I W N F F G I T P F S S K * N Y H L D R Y G T S L G L R L F R A N E T T I ----:----|----:----|----:----|----:----|----:----|----:----| F Q V S I S S R Q S * A K K S C I F S G S N S L Y P V E K P N R R K R A F S V V I P C I H F K K P I V G K E L L H F * W TfiI HinfI |TspGWI ||MnlI ||| AciI ||| | BsaXI TspDTI Tsp4CI* MmeI ||| | NspBII* | BccI | MnlI NlaIV ||| | | TstI | |SetI | | BsaXI | SetI ||| | | | TspDTI \ \\ \ \ \ \ \ \\\ \ \ \ \ TCCACCTCCAACGGTAAGATTTTACTAACGGAACCTCCAATGAATCCGCTGAAAAATAGG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTGGAGGTTGCCATTCTAAAATGATTGCCTTGGAGGTTACTTAGGCGACTTTTTATCC // / / // / / / / / // / / || BccI | |BsaXI | NlaIV | | | || | PpiI |SetI | MnlI | SetI | | | || TspDTI TspDTI Tsp4CI* MmeI | | | |NspBII* | | | |AciI | | | TstI | | BsaXI | | HinfI | | TfiI | MnlI TspGWI S T S N G K I L L T E P P M N P L K N R P P P T V R F Y * R N L Q * I R * K I G H L Q R * D F T N G T S N E S A E K * G ----:----|----:----|----:----|----:----|----:----|----:----| D V E L P L I K S V S G G I F G S F F L M W R W R Y S K V L P V E L S D A S F Y G G G V T L N * * R F R W H I R Q F I P TaqI PpiI AsuII BsaXI AciI EciI | MnlI SetI |TstI |PpiI | FokI BseGI \ \ \ \\ \\ \ \ \ GAAAAAATGTGTGAGGTAATGTTCGAAAAATACGATTTTGGCGGAGTTTATGTTGCCATC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTTACACACTCCATTACAAGCTTTTTATGCTAAAACCGCCTCAAATACAACGGTAG / / / / // / / / / MnlI SetI TstI AsuII |BsaXI | FokI | MwoI TaqI PpiI AciI BseGI EciI E K M C E V M F E K Y D F G G V Y V A I K K C V R * C S K N T I L A E F M L P S K N V * G N V R K I R F W R S L C C H P ----:----|----:----|----:----|----:----|----:----|----:----| S F I H S T I N S F Y S K P P T * T A M P F F T H P L T R F I R N Q R L K H Q W F F H T L Y H E F F V I K A S N I N G D PleI Csp6I Hpy99I |RsaI |TaqI MwoI |MwoI |MlyI | AluI ||Eco57I || TfiI | BccI ||Eco57MI || HinfI | CviJI ||| MboII || Hpy99I | |BsaXI ||| BbvII* || | BetI* | ||SetI ||| | SetI || | |HpaII | ||| MaeI ||| | | Hin4I Hpy178III* || | || MaeIII | ||| MwoI ||| | | BsaXI | HinfI || | || Tsp45I \ \\\ \ \\\ \ \ \ \ \ \\ \ \\ \ CAAGCTGTTCTAGCATTGTACGCACAAGGTTTGTCTTCAGGAGTCGTCGTCGATTCCGGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGACAAGATCGTAACATGCGTGTTCCAAACAGAAGTCCTCAGCAGCAGCTAAGGCCA / // / / / /// /// // / / / / / / // | || MwoI | | ||| ||| |BbvII* | | | | | | |BsaXI | |BccI | | ||| ||| BsaXI | | | | | | |Hin4I | CviJI | | ||| ||Hin4I | | | | | | |BetI* | AluI | | ||| |SetI | | | | | | HpaII BsaXI | | ||| MboII | | | | | HinfI SetI | | ||Csp6I | | | | | TfiI | | |RsaI | | | | TaqI | | Eco57MI | | | PleI | | Eco57I | | | MlyI | MwoI | | Hpy99I MaeI | Hpy99I | HinfI Hpy178III* Q A V L A L Y A Q G L S S G V V V D S G K L F * H C T H K V C L Q E S S S I P V S C S S I V R T R F V F R S R R R F R * ----:----|----:----|----:----|----:----|----:----|----:----| W A T R A N Y A C P K D E P T T T S E P G L Q E L M T R V L N T K L L R R R N R L S N * C Q V C L T Q R * S D D D I G T BsaXI | BslFI | Hin4I | Tsp4CI* Hpy166II | | MaeIII | TfiI CviJI | | | HphI BfiI BsrI | HinfI | MseI \ \ \ \ \ \ \ \ \ \ GACGGTGTTACTCATATAGTCCCAGTTTACGAATCTGTCGTTTTGAGCCACTTAACAAGA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCCACAATGAGTATATCAGGGTCAAATGCTTAGACAGCAAAACTCGGTGAATTGTTCT / // / / / / / / / | || | BfiI BsrI | HinfI CviJI MseI | || MaeIII | TfiI | |HphI Hpy166II | BslFI Tsp4CI* Tsp45I MaeIII D G V T H I V P V Y E S V V L S H L T R T V L L I * S Q F T N L S F * A T * Q E R C Y S Y S P S L R I C R F E P L N K K ----:----|----:----|----:----|----:----|----:----|----:----| S P T V * I T G T * S D T T K L W K V L H R H * E Y L G L K R I Q R K S G S L L V T N S M Y D W N V F R D N Q A V * C S MaeII MboII |MaeIII MboI | AciI || SetI | DpnI | |Esp3I || TaiI | |BstKTI FauI | |BsmAI || | MaeI | || TsoI Hpy99I \ \ \\ \\ \ \ \ \\ \ \ AGATTAGATGTTGCGGGTAGAGACGTTACTAGGCATTTGATTGATCTGCTTTCTCGTCGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAATCTACAACGCCCATCTCTGCAATGATCCGTAAACTAACTAGACGAAAGAGCAGCA / / / / / / / / // / / / | | | | | | | MaeI || | TsoI Hpy99I | | | | | | MaeIII || MboI | | | | | MaeII |DpnI | | | | TaiI BstKTI | | | | SetI | | | BsmAI | | | Esp3I | | AciI | MboII FauI R L D V A G R D V T R H L I D L L S R R D * M L R V E T L L G I * L I C F L V V I R C C G * R R Y * A F D * S A F S S W ----:----|----:----|----:----|----:----|----:----|----:----| L N S T A P L S T V L C K I S R S E R R F I L H Q P Y L R * * A N S Q D A K E D S * I N R T S V N S P M Q N I Q K R T T SfeI* | CviRI* | | PstI CviRI* | | | HgaI | EcoT22I | | | |TaqI TspEI | | MseI | | | |AsuII Tsp4CI* Hpy188I | TspDTI \ \ \ \ \ \ \\ \ \ \ \ GGTTATGCATTTAACAGAACTGCAGATTTCGAAACTGTGCGTCAGATAAAGGAAAAATTA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCAATACGTAAATTGTCTTGACGTCTAAAGCTTTGACACGCAGTCTATTTCCTTTTTAAT / / / / / / / / / / / / | | MseI | | SfeI* | | Tsp4CI* Hpy188I | TspEI | CviRI* | CviRI* | HgaI TspDTI EcoT22I PstI AsuII TaqI G Y A F N R T A D F E T V R Q I K E K L V M H L T E L Q I S K L C V R * R K N Y L C I * Q N C R F R N C A S D K G K I M ----:----|----:----|----:----|----:----|----:----|----:----| P * A N L L V A S K S V T R * I F S F N H N H M * C F Q L N R F Q A D S L P F I T I C K V S S C I E F S H T L Y L F F * MaeI |SetI CviJI NdeI || TsoI TspEI |MaeI AciI \ \\ \ \ \\ \ TGTTATGTTTCATATGATTTAGACCTAGATACAAAATTGGCTAGAGAAACAACCGCCCTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACAATACAAAGTATACTAAATCTGGATCTATGTTTTAACCGATCTCTTTGTTGGCGGGAA / / // / / / / NdeI | |MaeI | | MaeI AciI | TsoI | CviJI SetI TspEI C Y V S Y D L D L D T K L A R E T T A L V M F H M I * T * I Q N W L E K Q P P L L C F I * F R P R Y K I G * R N N R P C ----:----|----:----|----:----|----:----|----:----|----:----| H * T E Y S K S R S V F N A L S V V A R I N H K M H N L G L Y L I P * L F L R G T I N * I I * V * I C F Q S S F C G G K MaeIII TfiI | BccI CspCI HinfI | | CspCI |BslFI \ \ \ \ \\ GTGGAATCGTATGAGTTACCAGATGGCAGGACAATCAAAGTGGGACAAGAGAGATTTGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTTAGCATACTCAATGGTCTACCGTCCTGTTAGTTTCACCCTGTTCTCTCTAAACTT / /// / / HinfI ||MaeIII CspCI BslFI TfiI |CspCI BccI V E S Y E L P D G R T I K V G Q E R F E W N R M S Y Q M A G Q S K W D K R D L K G I V * V T R W Q D N Q S G T R E I * S ----:----|----:----|----:----|----:----|----:----|----:----| T S D Y S N G S P L V I L T P C S L N S Q P I T H T V L H C S L * L P V L S I Q H F R I L * W I A P C D F H S L L S K F HindII Hpy166II | MaeII | | SetI | | TaiI | | | MmeI | | | | BssKI | | | | EcoRII | | | | | ScrFI BssKI | | | | | BseBI SexAI | | | | | |SetI EcoRII | | | | | || BsiYI* | ScrFI | | | | | || | Cac8I | BseBI | | | | | || | | AluI MslI | |SetI | | | | | || | | CviJI \ \ \\ \ \ \ \ \ \\ \ \ \ GCACCAGAATGTTTGTTCCAACCTGGTTTGGTTGACGTTGAACAACCTGGCGTGGGCGAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGGTCTTACAAACAAGGTTGGACCAAACCAACTGCAACTTGTTGGACCGCACCCGCTC / / / / // / / / /// / / MslI | | EcoRII || | | | ||EcoRII | CviJI | | SexAI || | | | ||BssKI | AluI | | BssKI || | | | |BsiYI* Cac8I | BseBI || | | | BseBI SetI | ScrFI || | | | ScrFI SetI || | | SetI || | MmeI || MaeII |TaiI |SetI Hpy166II HindII A P E C L F Q P G L V D V E Q P G V G E H Q N V C S N L V W L T L N N L A W A S T R M F V P T W F G * R * T T W R G R A ----:----|----:----|----:----|----:----|----:----|----:----| A G S H K N W G P K T S T S C G P T P S L V L I N T G V Q N P Q R Q V V Q R P R C W F T Q E L R T Q N V N F L R A H A L EcoNI | BsiYI* Tsp4CI* EcoRV | | CviJI SetI MseI | CviRI* CviJI | Hpy188I | | HaeIII \ \ \ \ \ \ \ \ \ \ CTGTTATTTAATACTGTGCAATCGGCTGATGTTGATATCAGAAGTTCCCTGTATAAGGCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GACAATAAATTATGACACGTTAGCCGACTACAACTATAGTCTTCAAGGGACATATTCCGG / / / / / / / / / | | CviRI* CviJI | Hpy188I | | HaeIII | Tsp4CI* EcoRV | | CviJI MseI | EcoNI BsiYI* L L F N T V Q S A D V D I R S S L Y K A C Y L I L C N R L M L I S E V P C I R P V I * Y C A I G * C * Y Q K F P V * G H ----:----|----:----|----:----|----:----|----:----|----:----| S N N L V T C D A S T S I L L E R Y L A A T I * Y Q A I P Q H Q Y * F N G T Y P Q * K I S H L R S I N I D S T G Q I L G BbvI | Csp6I | |RsaI | || BssKI | || SecI* | || EcoRII | || |PasI | || |SecI* | || ||ScrFI | || ||BseBI | || ||| TseI | || ||| CviJI TaqI | || ||| |BisI |Hpy178III* SetI | || ||| ||BlsI || Hin4II* TspEI \ \ \\ \\\ \\\ \\ \ \ ATTGTTCTTTCAGGTGGTTCAAGTATGTACCCAGGGCTGCCTTCGAGATTAGAGAAAGAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAAGAAAGTCCACCAAGTTCATACATGGGTCCCGACGGAAGCTCTAATCTCTTTCTT / /// /////// // / SetI ||| ||||||TseI || Hin4II* ||| |||||BisI |Hpy178III* ||| ||||BlsI TaqI ||| |||CviJI ||| ||EcoRII ||| ||BssKI ||| ||SecI* ||| |SecI* ||| |PasI ||| BseBI ||| ScrFI ||Csp6I |RsaI BbvI I V L S G G S S M Y P G L P S R L E K E L F F Q V V Q V C T Q G C L R D * R K N C S F R W F K Y V P R A A F E I R E R I ----:----|----:----|----:----|----:----|----:----|----:----| M T R E P P E L I Y G P S G E L N S F S W Q E K L H N L Y T G L A A K S I L S L N N K * T T * T H V W P Q R R S * L F F Hpy178III* | Hin4II* | | ApoI TspEI | | TspEI \ \ \ \ TTGAAACAATTATGGTTTAGTAGAGTTTTACACAATGACCCTTCAAGACTTGATAAATTC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTGTTAATACCAAATCATCTCAAAATGTGTTACTGGGAAGTTCTGAACTATTTAAG / / / / / TspEI TspEI | Hin4II* TspEI Hpy178III* ApoI L K Q L W F S R V L H N D P S R L D K F * N N Y G L V E F Y T M T L Q D L I N S E T I M V * * S F T Q * P F K T * * I Q ----:----|----:----|----:----|----:----|----:----|----:----| N F C N H N L L T K C L S G E L S S L N I S V I I T * Y L K V C H G K L V Q Y I Q F L * P K T S N * V I V R * S K I F E TspEI | BinI* | | MboI | | XhoII | | | DpnI | | | |BstKTI | | | || StyI | | | || SecI* | | | || | MboII | | | || | | MnlI | | | || | | | TspDTI HgiCI* | | | || | | | | NdeI BceAI | NlaIV \ \ \ \\ \ \ \ \ \ \ \ \ AAAGTTAGAATTGAAGATCCTCCAAGGAGAAAGCATATGGTTTTCATTGGTGGTGCCGTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAATCTTAACTTCTAGGAGGTTCCTCTTTCGTATACCAAAAGTAACCACCACGGCAA // // / / / / / / / / / / || || | | | | | NdeI BceAI | | MwoI || || | | | | TspDTI | HgiCI* || || | | | MnlI NlaIV || || | | SecI* || || | | StyI || || | MboII || || XhoII || || MboI || |DpnI || BstKTI |TspEI BinI* K V R I E D P P R R K H M V F I G G A V K L E L K I L Q G E S I W F S L V V P F S * N * R S S K E K A Y G F H W W C R F ----:----|----:----|----:----|----:----|----:----|----:----| L T L I S S G G L L F C I T K M P P A T * L * F Q L D E L S F A Y P K * Q H H R F N S N F I R W P S L M H N E N T T G N FatI MwoI AflIII | AluI FatI BspLU11I* | CviJI |CviAII |CviAII | |MaeI || NlaIII || NspI MwoI | ||SetI || |CviJI || NlaIII DdeI | FauI \ \\\ \\ \\ \\ \ \ \ \ TTAGCTAGTATCATGGCTGATAAAGACCACATGTGGTTGTCTAAGCAAGAATGGCAAGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGATCATAGTACCGACTATTTCTGGTGTACACCAACAGATTCGTTCTTACCGTTCTT / / / / /// / // / / / | | | | ||CviJI | |BspLU11I* | MwoI FauI | | | | |FatI | |AflIII DdeI | | | | CviAII | |FatI | | | NlaIII | CviAII | | MaeI NlaIII | CviJI NspI | AluI SetI L A S I M A D K D H M W L S K Q E W Q E * L V S W L I K T T C G C L S K N G K K S * Y H G * * R P H V V V * A R M A R K ----:----|----:----|----:----|----:----|----:----|----:----| K A L I M A S L S W M H N D L C S H C S K L * Y * P Q Y L G C T T T * A L I A L * S T D H S I F V V H P Q R L L F P L F AciI | AsuI* | Cac8I | |BmgT120I BsrDI AsuI* | ||CviJI CviRI* | ApoI AvaII | ||HaeIII | BccI | TspEI |BmgT120I \ \\\ \ \ \ \ \\ AGCGGGCCATCTGCAATGACTAAATTTGGTCCAAGATAG 1270 1280 1290 ----:----|----:----|----:----|----:---- TCGCCCGGTAGACGTTACTGATTTAAACCAGGTTCTATC / // / / / / // | |AsuI* | | BsrDI | |AvaII | | | BccI | |AsuI* | | CviRI* | BmgT120I | BmgT120I TspEI | HaeIII ApoI | CviJI Cac8I AciI S G P S A M T K F G P R * A G H L Q * L N L V Q D X R A I C N D * I W S K I X ----:----|----:----|----:----|----:---- L P G D A I V L N P G L Y F R A M Q L S * I Q D L I A P W R C H S F K T W S L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 6 BspACI,SsiI AflIII 2 AluI 4 AluBI ApoI 3 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 1 BpuEI BceAI 1 BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 3 BsaXI 3 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseSI 1 BaeGI,BstSLI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspLU11I* 1 PscI,PciI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstKTI 3 Cac8I 4 BstC8I Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 2 CviJI 12 CviKI-1 CviRI* 6 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 3 MalI EciI 2 Ecl136II 1 EcoICRI Eco57I 1 AcuI Eco57MI 1 EcoNI 2 BstENI,XagI EcoRII 3 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FatI 2 FauI 2 SmuI FokI 2 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 1 Hin4II* 3 HpyAV HindII 1 HincII HinfI 5 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 2 Hpy99I 3 MaeI 5 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 4 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MfeI 2 MunI MlyI 1 SchI MmeI 2 MnlI 8 MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PasI 1 PleI 1 PpsI PpiI 1 PstI 1 RsaI 3 AfaI SacI 1 Psp124BI,SstI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 16 SexAI 1 MabI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 6 TfiI 4 PfeI TseI 1 ApeKI TsoI 3 Tsp45I 1 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 12 TasI,Tsp509I,Sse9I TspGWI 1 TstI 1 VspI 1 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BcgI BciVI BdaI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BseMII BsePI BseRI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI DinI DraII DraIII DrdI DsaI* Eam1105I Eco31I Eco47III EcoP15I EcoRI EgeI EheI EspI* FalI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HhaI Hin6I HindIII HinP1I HpaI HspAI KasI KpnI Ksp632I* MauBI McrI* MluI MroNI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI OliI PacI PflMI PfoI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacII SalI SanDI SapI SauI* ScaI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TatI TauI TspMI TspRI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769