Restriction Map of RPN4/YDL020C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RPN4/YDL020C on chromosome IV from coordinates 416708 to 415113.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.7306

EMBOSS_001 DdeI TspGWI | CviJI MseI | BbvII* CviJI | | TspGWI SetI | | Csp6I \ \ \ \ \ \ \ \ ATGGCTTCTACGGAACTTAGCCTAAAAAGAACCTTAACGGATATTTTAGAAGACGAGTTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGAAGATGCCTTGAATCGGATTTTTCTTGGAATTGCCTATAAAATCTTCTGCTCAAC / // / / / / / CviJI || TspGWI SetI MseI TspGWI BbvII* |CviJI MboII DdeI M A S T E L S L K R T L T D I L E D E L W L L R N L A * K E P * R I F * K T S C G F Y G T * P K K N L N G Y F R R R V V ----:----|----:----|----:----|----:----|----:----|----:----| X A E V S S L R F L V K V S I K S S S N X P K * P V * G L F F R L P Y K L L R T H S R R F K A * F S G * R I N * F V L Q BssKI EcoRII | ScrFI | BseBI | | MaeIII | | Tsp45I | | | SetI | | | | Tsp4CI* | | | | | Hin4I | | | | | | Hpy166II | | | | | | | HinfI | | | | | | | | FokI BseGI RsaI | | | | | | | | | PleI | MslI MboII | | | | | | | | | |MlyI | Hin4I \ \ \ \ \ \ \ \ \ \ \\ \ \ TACCATACTAATCCAGGTCACAGTCAGTTTACGAGTCATTATCAAAACTATCATCCAAAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTATGATTAGGTCCAGTGTCAGTCAAATGCTCAGTAATAGTTTTGATAGTAGGTTTA // // / / / / / / / / / |Csp6I || | | Tsp4CI* | HinfI PleI | | MslI RsaI || | | Tsp45I Hpy166II MlyI | Hin4I || | | MaeIII FokI BseGI || | Hin4I || EcoRII || BssKI |BseBI |ScrFI SetI Y H T N P G H S Q F T S H Y Q N Y H P N T I L I Q V T V S L R V I I K T I I Q M P Y * S R S Q S V Y E S L S K L S S K C ----:----|----:----|----:----|----:----|----:----|----:----| Y W V L G P * L * N V L * * * F * * G F T G Y * D L D C D T * S D N D F S D D L V M S I W T V T L K R T M I L V I M W I MaeII |BsaAI |TspDTI || SetI || TaiI || | TfiI MaeI HphI || | HinfI \ \ \\ \ \ GCTAGTATTACTCCATATAAGTTGGTGAATAAGAACAAGGAAAACAACACTTTTACGTGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGATCATAATGAGGTATATTCAACCACTTATTCTTGTTCCTTTTGTTGTGAAAATGCACC / / / // MaeI HphI | |MaeII | BsaAI TspDTI TaiI SetI A S I T P Y K L V N K N K E N N T F T W L V L L H I S W * I R T R K T T L L R G * Y Y S I * V G E * E Q G K Q H F Y V E ----:----|----:----|----:----|----:----|----:----|----:----| A L I V G Y L N T F L F L S F L V K V H H * Y * E M Y T P S Y S C P F C C K * T S T N S W I L Q H I L V L F V V S K R P TseI CviRI* |BisI ||BlsI |||AluI |||CviJI TfiI ||||TspDTI HinfI |||||SetI MslI | TaqI ||||||TaqI BbvI BsgI \ \ \ \\\\\\\ \ \ AATCATTCATTACAACACCAGAATGAATCGAGTGCAGCTTCGATACCCCCACAACAAACC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTAAGTAATGTTGTGGTCTTACTTAGCTCACGTCGAAGCTATGGGGGTGTTGTTTGG / / / / //// / // / HinfI MslI | | |||| TaqI |BsgI SetI TfiI | | |||CviJI BbvI | | |||TseI | | |||AluI | | ||TspDTI | | ||BisI | | |BlsI | | |SetI | | CviRI* | TaqI HinfI TfiI N H S L Q H Q N E S S A A S I P P Q Q T I I H Y N T R M N R V Q L R Y P H N K P S F I T T P E * I E C S F D T P T T N L ----:----|----:----|----:----|----:----|----:----|----:----| F * E N C C W F S D L A A E I G G C C V S D N M V V G S H I S H L K S V G V V F I M * * L V L I F R T C S R Y G W L L G BinI* | AciI | FnuDII* | | MboI | | BamHI | | XhoII | | | DpnI | | | NlaIV | | | |BstKTI | | | || BinI* SetI Hpy178III* | | | || | MseI SetI \ \ \ \ \ \\ \ \ \ TACCATTTCCCGATATTCAACAAATACGCGGATCCTACTTTAACTACCACCACCTCTTTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTAAAGGGCTATAAGTTGTTTATGCGCCTAGGATGAAATTGATGGTGGTGGAGAAAA / / / /// / / / / Hpy178III* | | ||| | | MseI SetI | | ||| | BinI* | | ||| XhoII | | ||| BamHI | | ||| MboI | | ||NlaIV | | ||DpnI | | |BstKTI | | AciI | FnuDII* BinI* Y H F P I F N K Y A D P T L T T T T S F T I S R Y S T N T R I L L * L P P P L L P F P D I Q Q I R G S Y F N Y H H L F Y ----:----|----:----|----:----|----:----|----:----|----:----| * W K G I N L L Y A S G V K V V V V E K R G N G S I * C I R P D * K L * W W R K V M E R Y E V F V R I R S * S G G G R K MnlI CfrI BceAI |SpeI | CviJI | MseI ||MaeI | HaeIII | VspI BccI \\\ \ \ \ \ \ ACGACTAGTGAAGCAACGGCCAACGATAGACAGATTAATAATGTCCATCTCATACCAAAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTGATCACTTCGTTGCCGGTTGCTATCTGTCTAATTATTACAGGTAGAGTATGGTTTG / // / / / / / MnlI |SpeI | CfrI | VspI BccI MaeI HaeIII | MseI CviJI BceAI T T S E A T A N D R Q I N N V H L I P N R L V K Q R P T I D R L I M S I S Y Q T D * * S N G Q R * T D * * C P S H T K R ----:----|----:----|----:----|----:----|----:----|----:----| V V L S A V A L S L C I L L T W R M G F * S * H L L P W R Y V S * Y H G D * V L R S T F C R G V I S L N I I D M E Y W V NheI BsrDI |MaeI | Hin4I Tsp4CI* ||Cac8I | Hin4I |BbvII* Hin4I MseI ||| BmtI | | CviRI* || MboII Hin4I \ \\\ \ \ \ \ \\ \ \ GAGATTAAGGGTGCTAGCGAAACCCCATTGCAGAAGACCGTCAATCTAAAGAATATAATG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAATTCCCACGATCGCTTTGGGGTAACGTCTTCTGGCAGTTAGATTTCTTATATTAC / / /// // / / / / MseI | ||NheI |BsrDI CviRI* | BbvII* Hin4I | |MaeI Hin4I | MboII Hin4I | Cac8I Hin4I Tsp4CI* BmtI E I K G A S E T P L Q K T V N L K N I M R L R V L A K P H C R R P S I * R I * * D * G C * R N P I A E D R Q S K E Y N E ----:----|----:----|----:----|----:----|----:----|----:----| S I L P A L S V G N C F V T L R F F I I R S * P H * R F G M A S S R * D L S Y L L N L T S A F G W Q L L G D I * L I Y H XmnI MaeII Hpy188I | SetI MseI | TspDTI | TaiI | AjuI | | Csp6I | | TspEI | |ApoI | | |RsaI | | | TspGWI | |TspEI \ \ \\ \ \ \ \ \ \\ AAAGTATCAGACCCGTATGTACCGACACGGAATACGTTCAATTATGATGTTAAAATTTCC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCATAGTCTGGGCATACATGGCTGTGCCTTATGCAAGTTAATACTACAATTTTAAAGG / / // // / / / / / / | TspDTI |Csp6I || | | | AjuI MseI TspEI Hpy188I RsaI || | | TspEI ApoI || | TspGWI || MaeII |XmnI TaiI SetI K V S D P Y V P T R N T F N Y D V K I S K Y Q T R M Y R H G I R S I M M L K F P S I R P V C T D T E Y V Q L * C * N F Q ----:----|----:----|----:----|----:----|----:----|----:----| F T D S G Y T G V R F V N L * S T L I E S L I L G T H V S V S Y T * N H H * F K F Y * V R I Y R C P I R E I I I N F N G MaeIII Tsp45I Tsp4CI* HphI MnlI | MmeI | FalI |MboII TaqI | |AjuI | FalI ||TspDTI \ \ \\ \ \ \\\ AACGATTTTTTCGATAACGGTGACAATCTATATGGTAATGATGAAGAAGTGCTTTTCTAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTAAAAAAGCTATTGCCACTGTTAGATATACCATTACTACTTCTTCACGAAAAGATA / // / / / // TaqI || | | HphI |TspDTI || | | FalI |MboII || | | FalI MnlI || | Tsp45I || | MaeIII || MmeI |AjuI Tsp4CI* N D F F D N G D N L Y G N D E E V L F Y T I F S I T V T I Y M V M M K K C F S M R F F R * R * Q S I W * * * R S A F L * ----:----|----:----|----:----|----:----|----:----|----:----| L S K K S L P S L R Y P L S S S T S K * W R N K R Y R H C D I H Y H H L L A K R V I K E I V T V I * I T I I F F H K E I Hpy178III* | Hin6I | |GlaI Hpy188I | ||HhaI | CviRI* | |||AciI TspEI | | MaeIII | |||BisI |FalI | | Tsp45I | |||HaeII |FalI | | | BtsI | ||||BlsI MnlI || PsiI | | | TspRI | |||||TauI SfaNI \\ \ \ \ \ \ \ \\\\\\ \ GAGGATAATTATAATCCGAAAATGCAGTGGTCACTTCAAGATAATAGCGCCGCAATAAAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTATTAATATTAGGCTTTTACGTCACCAGTGAAGTTCTATTATCGCGGCGTTATTTG / // / / / / / / /////// / FalI |PsiI | | | BtsI | | ||||||| MnlI FalI TspEI | | CviRI* | | ||||||AciI | TspRI | | |||||BisI Hpy188I | | ||||BlsI | | |||Hin6I | | |||TauI | | ||GlaI | | |HhaI | | HaeII | Hpy178III* Tsp45I MaeIII E D N Y N P K M Q W S L Q D N S A A I N R I I I I R K C S G H F K I I A P Q * T G * L * S E N A V V T S R * * R R N K Q ----:----|----:----|----:----|----:----|----:----|----:----| S S L * L G F I C H D S * S L L A A I F H P Y N Y D S F A T T V E L Y Y R R L L L I I I I R F H L P * K L I I A G C Y V BseGI | AluI | CviJI MlyI | | SetI PleI HinfI | | |FokI ApoI | Hpy188I Hpy99I | | || MseI TspEI | | TspDTI | EcoRV \ \ \\ \ \ \ \ \ \ \ AATGAGGATGCGAGAGCTATTTTTAACAATGAATTTGACTCTGATGACGACGATATCAGT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTCCTACGCTCTCGATAAAAATTGTTACTTAAACTGAGACTACTGCTGCTATAGTCA / / / / / / // / /// / / SfaNI | | CviJI | MseI || | ||| Hpy99I EcoRV | | AluI FokI || | ||TspDTI TspRI | SetI || | |Hpy188I BseGI || | HinfI || TspEI || ApoI |PleI MlyI N E D A R A I F N N E F D S D D D D I S M R M R E L F L T M N L T L M T T I S V * G C E S Y F * Q * I * L * * R R Y Q * ----:----|----:----|----:----|----:----|----:----|----:----| L S S A L A I K L L S N S E S S S S I L C H P H S L * K * C H I Q S Q H R R Y * I L I R S S N K V I F K V R I V V I D T BseGI |MboII ||TspDTI ||| FokI ||| | TspEI ||| | | TspDTI Ksp632I* ||| | | | MboII |MnlI ||| | | | | CviRI* NlaIV |TspRI ||| | | | | | MwoI MnlI |CviJI \\ \\\ \ \ \ \ \ \ \ \\ GATGATGAAGAGGATGAAATAGAAGAAAATTGTTTGCAACAAGAGCAACACCAAGAGGAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACTTCTCCTACTTTATCTTCTTTTAACAAACGTTGTTCTCGTTGTGGTTCTCCTC / / / / / / / / / / / // | Ksp632I* | TspDTI | | | | | MwoI MnlI |CviJI MnlI | MboII | | | | CviRI* NlaIV BseGI | | | MboII | | TspEI | FokI TspDTI D D E E D E I E E N C L Q Q E Q H Q E E M M K R M K * K K I V C N K S N T K R S * * R G * N R R K L F A T R A T P R G A ----:----|----:----|----:----|----:----|----:----|----:----| S S S S S S I S S F Q K C C S C C W S S H H H L P H F L L F N N A V L A V G L P I I F L I F Y F F I T Q L L L L V L L L CviJI |DdeI || MboI || Hpy188I BspCNI Tsp4CI* MaeIII || | DpnI |BseMII | BseRI | BseGI FokI || | |BstKTI || Hin4I \ \ \ \ \ \\ \ \\ \\ \ CCTTTACTGTCATTGGATGTTACACCAATCTCAATGTTTGGCTCAGATCAAAAAACGGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAATGACAGTAACCTACAATGTGGTTAGAGTTACAAACCGAGTCTAGTTTTTTGCCCA // / / / / //// / /// |BseRI | MaeIII FokI | |||| | ||Hin4I Tsp4CI* BseGI | |||| | |BseMII | |||| | BspCNI | |||| MboI | |||DpnI | ||BstKTI | |DdeI | Hpy188I CviJI P L L S L D V T P I S M F G S D Q K T G L Y C H W M L H Q S Q C L A Q I K K R V F T V I G C Y T N L N V W L R S K N G S ----:----|----:----|----:----|----:----|----:----|----:----| G K S D N S T V G I E I N P E S * F V P A K V T M P H * V L R L T Q S L D F F P R * Q * Q I N C W D * H K A * I L F R T TatI Hin4I |Csp6I ||RsaI ||| MaeIII ||| Tsp4CI* ||| | MlyI ||| | PleI ||| | |MaeII ||| | || SetI ||| | || TaiI ||| | || |HindII ||| | || |Hpy166II ||| | || || FatI ||| | || || |CviAII MaeI MseI ||| | || ||HinfI || NlaIII \ \ \\\ \ \\ \\\ \\ \ CGTGCCAAGAGTTCTAGTCATTTATTTAATGAGTACAGTTACGTTGACTCTAACATGGAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GCACGGTTCTCAAGATCAGTAAATAAATTACTCATGTCAATGCAACTGAGATTGTACCTG / // /// //// / / / // MaeI |MseI ||| |||| | | | |FatI Hin4I ||| |||| | | | CviAII ||| |||| | | NlaIII ||| |||| | HinfI ||| |||| Hpy166II ||| |||| HindII ||| |||MaeII ||| ||MaeIII ||| |PleI ||| TaiI ||| SetI ||| MlyI ||Tsp4CI* ||TatI |Csp6I RsaI R A K S S S H L F N E Y S Y V D S N M D V P R V L V I Y L M S T V T L T L T W T C Q E F * S F I * * V Q L R * L * H G Q ----:----|----:----|----:----|----:----|----:----|----:----| R A L L E L * K N L S Y L * T S E L M S D H W S N * D N I * H T C N R Q S * C P T G L T R T M * K I L V T V N V R V H V Eco57I Eco57MI Hpy188I | FatI | MboI | |CviAII | BglII | || NlaIII | XhoII | || |TspDTI | | DpnI | || || BslFI BsrI TspRI | | |BstKTI MboII | || ||MnlI |MnlI \ \ \ \ \\ \ \ \\ \\\ \\ AGCATTTCCAGTGTTGTATCTGAAGATCTGTTAGATGAACGGGGACATGAGAAGATAGAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTAAAGGTCACAACATAGACTTCTAGACAATCTACTTGCCCCTGTACTCTTCTATCTC / / // / / / / /// / / TspRI | || | MboII | | ||MnlI | BslFI BsrI | || XhoII | | |FatI MnlI | || BglII | | TspDTI | || MboI | | CviAII | |DpnI | NlaIII | BstKTI Eco57MI Hpy188I Eco57I S I S S V V S E D L L D E R G H E K I E A F P V L Y L K I C * M N G D M R R * R H F Q C C I * R S V R * T G T * E D R G ----:----|----:----|----:----|----:----|----:----|----:----| L M E L T T D S S R N S S R P C S F I S C C K W H Q I Q L D T L H V P V H S S L A N G T N Y R F I Q * I F P S M L L Y L BseGI |FokI || BsaBI || |MboI BbvII* || ||FokI |EcoRV MnlI || |||DpnI || MboII MboII || ||||BstKTI || |TspDTI | BseGI || |||||Hpy178III* || || EcoRV Hpy178III* \ \ \\ \\\\\\ \\ \\ \ \ GATGAGGATGAGGATAATGATCTTGATGAAGACGATATCTACGATATCTCTCTCTTGAAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTCCTACTCCTATTACTAGAACTACTTCTGCTATAGATGCTATAGAGAGAGAACTTC / / / / // /// / / / / | BseGI BseGI | || ||Hpy178III* | | EcoRV Hpy178III* MboII | || |FokI | TspDTI MnlI | || MboI | BbvII* | |DpnI | MboII | BstKTI EcoRV BsaBI FokI D E D E D N D L D E D D I Y D I S L L K M R M R I M I L M K T I S T I S L S * R * G * G * * S * * R R Y L R Y L S L E E ----:----|----:----|----:----|----:----|----:----|----:----| S S S S S L S R S S S S I * S I E R K F P H P H P Y H D Q H L R Y R R Y R E R S I L I L I I I K I F V I D V I D R E Q L NmeAIII |XmnI MboII MboII MnlI || BsaBI \ \ \ \\ \ AACAGAAGAAAGCAAAGTTTTGTCCTCAATAAAAACACTATTGATTTTGAAAGATTTCCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCTTCTTTCGTTTCAAAACAGGAGTTATTTTTGTGATAACTAAAACTTTCTAAAGGT / / / / / / MboII MboII MnlI | | BsaBI | XmnI NmeAIII N R R K Q S F V L N K N T I D F E R F P T E E S K V L S S I K T L L I L K D F H Q K K A K F C P Q * K H Y * F * K I S I ----:----|----:----|----:----|----:----|----:----|----:----| F L L F C L K T R L L F V I S K S L N G S C F F A F N Q G * Y F C * Q N Q F I E V S S L L T K D E I F V S N I K F S K W MaeII |MnlI ||Csp6I |||RsaI |||SetI |||TaiI AgeI SecI* |||| Tsp4CI* BetI* | SetI |||| | AccI Cfr10I BsiYI* BccI | | MnlI |||| | |Hpy166II |HpaII | FokI \ \ \ \ \\\\ \ \\ \\ \ \ TCTCCCTCAACCTCGGCAAACGTACCGTCTACTGCTACTACCGGTAAAAGGAAACCAGCA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGGAGTTGGAGCCGTTTGCATGGCAGATGACGATGATGGCCATTTTCCTTTGGTCGT / / // // //// // // / | SetI || || |||| |AccI |Cfr10I FokI BccI || || |||| Hpy166II |BsiYI* || || |||Tsp4CI* |BetI* || || ||Csp6I |AgeI || || |RsaI HpaII || || MaeII || |MnlI || TaiI || SetI |SecI* MnlI S P S T S A N V P S T A T T G K R K P A L P Q P R Q T Y R L L L L P V K G N Q Q S L N L G K R T V Y C Y Y R * K E T S K ----:----|----:----|----:----|----:----|----:----|----:----| D G E V E A F T G D V A V V P L L F G A M E R L R P L R V T * Q * * R Y F S V L R G * G R C V Y R R S S S G T F P F W C BseGI | BsrI | | MaeIII MaeIII | | | Tsp4CI* | Tsp4CI* TspDTI BceAI \ \ \ \ \ \ \ \ AAATCATCCAGTAACCGTAGTTGCGTTAGTAACAGTAATGAAAACGGCACATTAGAAAGA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTAGGTCATTGGCATCAACGCAATCATTGTCATTACTTTTGCCGTGTAATCTTTCT / / / / / | BsrI Tsp4CI* Tsp4CI* TspDTI BseGI MaeIII MaeIII K S S S N R S C V S N S N E N G T L E R N H P V T V V A L V T V M K T A H * K E I I Q * P * L R * * Q * * K R H I R K N ----:----|----:----|----:----|----:----|----:----|----:----| F D D L L R L Q T L L L L S F P V N S L L I M W Y G Y N R * Y C Y H F R C M L F F * G T V T T A N T V T I F V A C * F S AluI CviJI | SetI | TspEI AluI | | MseI CviJI | | VspI PvuII | | |TspEI NspBII* AluI | | ||FalI |SfeI* CviJI | | ||FalI CviJI ||SetI | SetI MaeI AciI | | ||| EciI \ \\\ \ \ \ \ \ \ \\\ \ ATAAAGAAGCCTACATCAGCTGTAGTAAGCTCAAATGCTAGTAGGCGGAAGCTAATTAAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTCTTCGGATGTAGTCGACATCATTCGAGTTTACGATCATCCGCCTTCGATTAATTA / / / / / / / / / / / / // BceAI CviJI | | | | CviJI MaeI | | | | |EciI | | | | AluI | | | | |VspI | | | SetI | | | | |MseI | | SfeI* | | | | TspEI | NspBII* | | | FalI | PvuII | | | FalI | CviJI | | CviJI | AluI | | AluI SetI | SetI AciI I K K P T S A V V S S N A S R R K L I N * R S L H Q L * * A Q M L V G G S * L I K E A Y I S C S K L K C * * A E A N * L ----:----|----:----|----:----|----:----|----:----|----:----| I F F G V D A T T L E F A L L R F S I L F L S A * M L Q L L S L H * Y A S A L * Y L L R C * S Y Y A * I S T P P L * N I ApoI TspEI | TaqI | AsuII | | ApoI | | TspEI | | EcoRI | | | TaqI | | | AsuII | | | | BcgI | | | | | SetI FalI | | | | | |TaqI DdeI MboII TspDTI FalI | | | | | ||HphI \ \ \ \ \ \ \ \ \ \\\ TATACTAAGAAGCACTTATCTTCACATTCATCTACAAATTCGAATTCGAAACCTTCGACT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGATTCTTCGTGAATAGAAGTGTAAGTAGATGTTTAAGCTTAAGCTTTGGAAGCTGA / / / / / / / / / / / / TspEI | | TspDTI FalI | | | | SetI | TaqI | MboII FalI | | | AsuII HphI DdeI | | | TaqI | | | BcgI | | EcoRI | | TspEI | | ApoI | AsuII | TaqI TspEI ApoI Y T K K H L S S H S S T N S N S K P S T I L R S T Y L H I H L Q I R I R N L R L Y * E A L I F T F I Y K F E F E T F D C ----:----|----:----|----:----|----:----|----:----|----:----| * V L F C K D E C E D V F E F E F G E V N Y * S A S I K V N M * L N S N S V K S I S L L V * R * M * R C I R I R F R R S SfaNI | AsuI* | |CviJI SspI | |HaeIII | Hin4I | |BmgT120I | Hin4I | || BccI | |MaeII | || | MboII | |AflIII | || | | MaeII | ||BsaAI | || | | | SetI | ||| SetI CviRI* | || | | | TaiI Hpy188I | ||| TaiI |Hin4II* | || | | | | BcgI | Tsp4CI* | ||| | Hpy188I \\ \ \\ \ \ \ \ \ \ \ \ \\\ \ \ GCATCACCATCGGCCCATACGTCATCTTCTGACGGTAATAACGAAATATTTACGTGTCAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGTGGTAGCCGGGTATGCAGTAGAAGACTGCCATTATTGCTTTATAAATGCACAGTC / //// / // / / // / // / / Hin4II* |||| | |BcgI | Tsp4CI* || | || | Hpy188I CviRI* |||| | MaeII Hpy188I || | || AflIII |||| TaiI || | |MaeII |||| SetI || | BsaAI |||MboII || TaiI |||BccI || SetI ||AsuI* |SspI |BmgT120I Hin4I |SfaNI Hin4I HaeIII CviJI A S P S A H T S S S D G N N E I F T C Q H H H R P I R H L L T V I T K Y L R V R I T I G P Y V I F * R * * R N I Y V S D ----:----|----:----|----:----|----:----|----:----|----:----| A D G D A W V D D E S P L L S I N V H * Q M V M P G Y T M K Q R Y Y R F I * T D C * W R G M R * R R V T I V F Y K R T L TspDTI | Hin4I | Hin4I | | Tsp4CI* | | | HgiCI* AsuI* | | | | NlaIV AvaII | | | | | TspDTI DraII | | | | | |SduI PpuMI TfiI | | | | | |BseSI |BmgT120I BsmAI HinfI | | | | | ||TspEI ||SetI |MseI \ \ \ \ \ \ \\\ \\\ \\ ATAATGAATCTCATTACAAATGAACCGTGTGGTGCCCAATTTTCAAGGTCCTATGATTTA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TATTACTTAGAGTAATGTTTACTTGGCACACCACGGGTTAAAAGTTCCAGGATACTAAAT / // / // / / / // / / HinfI |Hin4I | || | | | |PpuMI | MseI TfiI |Hin4I | || | | | |DraII AjuI TspDTI | || | | | |AvaII | || | | | |AsuI* | || | | | BmgT120I | || | | SetI | || | TspEI | || HgiCI* | |TspDTI | |NlaIV | BseSI | SduI Tsp4CI* I M N L I T N E P C G A Q F S R S Y D L * * I S L Q M N R V V P N F Q G P M I * N E S H Y K * T V W C P I F K V L * F N ----:----|----:----|----:----|----:----|----:----|----:----| I I F R M V F S G H P A W N E L D * S K S L S D * * L H V T H H G I K L T R H N Y H I E N C I F R T T G L K * P G I I * MboII BsiYI* BbvII* | Hpy188I FalI |AjuI | | FalI AjuI FalI |TspGWI MboII | | FalI \ \ \\ \ \ \ \ ACGAGACACCAAAATACCATTCACGCTAAAAGGAAGATTGTCTTCCGTTGCTCGGAGTGT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTCTGTGGTTTTATGGTAAGTGCGATTTTCCTTCTAACAGAAGGCAACGAGCCTCACA / / / / / / / // BsmAI FalI | | BbvII* | | |Hpy188I FalI | TspGWI | | FalI | MboII | | FalI AjuI | BsiYI* MboII T R H Q N T I H A K R K I V F R C S E C R D T K I P F T L K G R L S S V A R S V E T P K Y H S R * K E D C L P L L G V Y ----:----|----:----|----:----|----:----|----:----|----:----| V L C W F V M * A L L F I T K R Q E S H L S V G F Y W E R * F S S Q R G N S P T R S V L I G N V S F P L N D E T A R L T ApoI TspEI Hpy188I | BdaI | MaeII | BdaI | | BsmAI | |BseMII | | |SetI | ||BspCNI | | |TaiI | ||| MnlI | | |BbvII* | ||| |MboI | | || SfaNI | ||| |XhoII | | || |TaqI | ||| || DpnI | | || ||BdaI | ||| || |BstKTI | | || ||BdaI | ||| || ||DdeI | | || ||Hpy178III* | ||| || |||Hpy188I | | || ||| BsrI | ||| || |||| BinI* | | || ||| | BseGI | ||| || |||| | CviJI | | || |||MboII | |MseI \ \\\ \\ \\\\ \ \ \ \ \\ \\\\ \ \\ ATAAAAATTCTTGGATCTGAGGGCTATCAGAAGACGTTTTCGAGACTGGATGCTTTAACA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTTTAAGAACCTAGACTCCCGATAGTCTTCTGCAAAAGCTCTGACCTACGAAATTGT /// / / // / / // / / / ///// / / / ||| | | || | | || | | | ||||| | | MseI ||| | | || | | || | | | ||||| | BseGI ||| | | || | | || | | | ||||| BsrI ||| | | || | | || | | | ||||Hpy178III* ||| | | || | | || | | | ||||SfaNI ||| | | || | | || | | | |||TaqI ||| | | || | | || | | | ||BbvII* ||| | | || | | || | | | ||MboII ||| | | || | | || | | | |BsmAI ||| | | || | | || | | | BdaI ||| | | || | | || | | | BdaI ||| | | || | | || | | MaeII ||| | | || | | || | TaiI ||| | | || | | || | SetI ||| | | || | | || Hpy188I ||| | | || | | |CviJI ||| | | || | | BinI* ||| | | || | DdeI ||| | | || Hpy188I ||| | | || XhoII ||| | | || MboI ||| | | |DpnI ||| | | BstKTI ||| | MnlI ||| TspEI ||| ApoI ||BspCNI |BseMII BdaI BdaI I K I L G S E G Y Q K T F S R L D A L T * K F L D L R A I R R R F R D W M L * Q K N S W I * G L S E D V F E T G C F N K ----:----|----:----|----:----|----:----|----:----|----:----| I F I R P D S P * * F V N E L S S A K V Y L F E Q I Q P S D S S T K S V P H K L Y F N K S R L A I L L R K R S Q I S * C MaeII | SetI FatI | TaiI |CviAII MboII | |Hpy178III* ApoI FokI TaqI || NlaIII |TspDTI | || MaeIII TspEI \ \ \\ \ \\ \ \\ \ \ AGGCATATAAAATCGAAGCATGAAGATTTGTCGTTAGAACAACGTCAAGAAGTTACAAAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGTATATTTTAGCTTCGTACTTCTAAACAGCAATCTTGTTGCAGTTCTTCAATGTTTT / / / // / / / / / FokI | | |FatI TspDTI | | | MaeIII | | CviAII MboII | | Hpy178III* | NlaIII | MaeII TaqI TaiI SetI R H I K S K H E D L S L E Q R Q E V T K G I * N R S M K I C R * N N V K K L Q N A Y K I E A * R F V V R T T S R S Y K I ----:----|----:----|----:----|----:----|----:----|----:----| L C I F D F C S S K D N S C R * S T V F L A Y L I S A H L N T T L V V D L L * L P M Y F R L M F I Q R * F L T L F N C F CviRI* FatI | TsoI |CviAII | | CviJI || NlaIII | | | SspI || | MseI \ \ \ \ \\ \ \ TTTGCAAAGGCTAATATTGGTTATGTCATGGGTTAA 1570 1580 1590 ----:----|----:----|----:----|----:- AAACGTTTCCGATTATAACCAATACAGTACCCAATT / / / / / / // / | | | | SspI | |FatI MseI | | | CviJI | CviAII | | TsoI NlaIII | CviRI* TspEI ApoI F A K A N I G Y V M G * L Q R L I L V M S W V X C K G * Y W L C H G L X ----:----|----:----|----:----|----:- N A F A L I P * T M P * I Q L P * Y Q N H * P N K C L S I N T I D H T L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AjuI 2 AluI 5 AluBI ApoI 6 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 5 BpiI,BpuAI,BstV2I,BbsI BccI 3 BceAI 2 BcgI 1 BdaI 2 BetI* 1 BsaWI BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 BmtI 1 BspOI BsaAI 2 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 8 BstF5I,BtsCI BseMII 2 BseRI 1 BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspCNI 2 BsrDI 1 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 5 BtsI 1 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 4 CviQI,RsaNI CviAII 4 CviJI 14 CviKI-1 CviRI* 6 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 5 MalI DraII 1 EcoO109I EciI 1 Eco57I 1 AcuI Eco57MI 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 3 Eco32I FalI 6 FatI 4 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 8 GlaI 1 HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 6 HpaII 1 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 10 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 8 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 16 MlyI 3 SchI MmeI 1 MnlI 12 MseI 11 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 1 MspA1I PleI 3 PpsI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PvuII 1 RsaI 4 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 20 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI SspI 2 TaiI 8 TaqI 8 TatI 1 TauI 1 TfiI 3 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 12 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 3 TscAI VspI 2 PshBI,AseI XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AhaIII* AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BarI BbvCI Bce83I* BciVI BclI BfiI BglI BmeT110I BplI Bpu10I BsaXI BsePI BseYI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI CauII* Cfr9I ClaI CspCI DinI DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GsaI GsuI HgaI HgiAI* HgiJII* HindIII HpaI KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TspMI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769