Restriction Map of TSC13/YDL015C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TSC13/YDL015C on chromosome IV from coordinates 426934 to 426002.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.14726

EMBOSS_001 CviJI |AciI |BisI ||BlsI TspEI |||TauI |TspRI |||BsrBI MseI || BslFI \\\\ \ \\ \ ATGCCTATCACCATAAAAAGCCGCTCTAAAGGGTTAAGGGACACTGAAATTGACTTATCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGATAGTGGTATTTTTCGGCGAGATTTCCCAATTCCCTGTGACTTTAACTGAATAGG //// / / / / |||BsrBI | TspRI | BslFI |||AciI MseI TspEI ||BisI |BlsI CviJI TauI M P I T I K S R S K G L R D T E I D L S C L S P * K A A L K G * G T L K L T Y P A Y H H K K P L * R V K G H * N * L I Q ----:----|----:----|----:----|----:----|----:----|----:----| X G I V M F L R E L P N L S V S I S K D X A * * W L F G S * L T L P C Q F Q S I H R D G Y F A A R F P * P V S F N V * G CviJI \ AAAAAGCCTACTTTAGATGATGTTTTGAAAAAAATCTCTGCTAATAACCACAATATCAGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCGGATGAAATCTACTACAAAACTTTTTTTAGAGACGATTATTGGTGTTATAGTCG / / CviJI TsoI K K P T L D D V L K K I S A N N H N I S K S L L * M M F * K K S L L I T T I S A K A Y F R * C F E K N L C * * P Q Y Q Q ----:----|----:----|----:----|----:----|----:----|----:----| L F G V K S S T K F F I E A L L W L I L W F A * K L H H K S F F R Q * Y G C Y * F L R S * I I N Q F F D R S I V V I D A TsoI |TatI Hpy188I ||Csp6I TfiI BetI* |TfiI |||RsaI MseI SetI HinfI |HpaII |HinfI \\\\ \ \ \ \\ \\ AAGTACAGGATAAGATTAACCTACAAAAAGGAATCTAAACAAGTTCCGGTTATTTCAGAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATGTCCTATTCTAATTGGATGTTTTTCCTTAGATTTGTTCAAGGCCAATAAAGTCTT /// / / // / ||TatI MseI HinfI |BetI* Hpy188I |Csp6I SetI TfiI HpaII RsaI K Y R I R L T Y K K E S K Q V P V I S E S T G * D * P T K R N L N K F R L F Q N V Q D K I N L Q K G I * T S S G Y F R I ----:----|----:----|----:----|----:----|----:----|----:----| L Y L I L N V * L F S D L C T G T I E S C T C S L I L R C F P I * V L E P * K L L V P Y S * G V F L F R F L N R N N * F AsuI* AvaII HinfI DraII Ksp632I* MboII PpuMI |MnlI | MboII SanDI ||Hpy178III* | TspDTI |NlaIV ||| MlyI | | ApoI |TspDTI ||| PleI | | TspEI |BmgT120I ||| CviJI | | EcoRI BslFI ||NlaIV \\\ \ \ \ \ \ \\\ TCGTTTTTTCAAGAAGAGGCTGATGACTCAATGGAATTCTTCATCAAAGATTTGGGTCCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAAAAAAGTTCTTCTCCGACTACTGAGTTACCTTAAGAAGTAGTTTCTAAACCCAGGG / / // // / // / / / /// HinfI | || || | |MboII EcoRI BslFI | ||SanDI TfiI | || || | TspDTI TspEI | ||PpuMI | || || | HinfI ApoI | ||DraII | || || MboII | ||AvaII | || |PleI | ||AsuI* | || CviJI | |BmgT120I | || MlyI | |NlaIV | |Hpy178III* | NlaIV | Ksp632I* TspDTI MnlI S F F Q E E A D D S M E F F I K D L G P R F F K K R L M T Q W N S S S K I W V P V F S R R G * * L N G I L H Q R F G S P ----:----|----:----|----:----|----:----|----:----|----:----| D N K * S S A S S E I S N K M L S K P G I T K E L L P Q H S L P I R * * L N P D R K K L F L S I V * H F E E D F I Q T G ApoI TspEI | FatI AsuI* | |CviAII AvaII | || NlaIII |NlaIV | || |MboII |BmgT120I | || |BbvII* || BsrI Hpy166II \ \\ \\ \\ \ \ CAAATTTCATGGAGATTAGTCTTCTTTTGTGAGTATTTGGGTCCAGTCTTGGTTCACTCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAAAGTACCTCTAATCAGAAGAAAACACTCATAAACCCAGGTCAGAACCAAGTGAGG // // / /// / || || BbvII* ||AvaII Hpy166II || |MboII ||AsuI* || |FatI |BmgT120I || CviAII NlaIV |NlaIII BsrI TspEI ApoI Q I S W R L V F F C E Y L G P V L V H S K F H G D * S S F V S I W V Q S W F T P N F M E I S L L L * V F G S S L G S L P ----:----|----:----|----:----|----:----|----:----|----:----| W I E H L N T K K Q S Y K P G T K T * E G F K M S I L R R K H T N P D L R P E S L N * P S * D E K T L I Q T W D Q N V G Tsp4CI* |CspCI || NheI || |MaeI || ||Cac8I || ||TspRI || ||| AluI || ||| BmtI || ||| CviJI Tsp4CI* || ||| | SetI CspCI | BccI || ||| | | Hpy188I \ \ \ \\ \\\ \ \ \ CTTTTTTATTATCTATCTACCATTCCCACAGTTGTTGATAGATGGCACAGTGCTAGCTCC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAAAATAATAGATAGATGGTAAGGGTGTCAACAACTATCTACCGTGTCACGATCGAGG / / / / / / /// / CspCI | BccI | | | ||| Hpy188I Tsp4CI* | | | ||CviJI | | | ||NheI | | | ||AluI | | | |MaeI | | | Cac8I | | | SetI | | BmtI | Tsp4CI* | CspCI TspRI L F Y Y L S T I P T V V D R W H S A S S F F I I Y L P F P Q L L I D G T V L A P F L L S I Y H S H S C * * M A Q C * L R ----:----|----:----|----:----|----:----|----:----|----:----| R K * * R D V M G V T T S L H C L A L E G K K N D I * W E W L Q Q Y I A C H * S K K I I * R G N G C N N I S P V T S A G MseI |AhaIII* MseI || MmeI CviRI* |TspEI \\ \ \ \\ GACTATAATCCATTTTTAAACAGGGTTGCATATTTTTTAATTTTAGGACATTATGGAAAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGATATTAGGTAAAAATTTGTCCCAACGTATAAAAAATTAAAATCCTGTAATACCTTTC // / / / / || MmeI CviRI* | TspEI |MseI MseI AhaIII* D Y N P F L N R V A Y F L I L G H Y G K T I I H F * T G L H I F * F * D I M E R L * S I F K Q G C I F F N F R T L W K E ----:----|----:----|----:----|----:----|----:----|----:----| S * L G N K F L T A Y K K I K P C * P F R S Y D M K L C P Q M N K L K L V N H F V I I W K * V P N C I K * N * S M I S L AluI HphI Hpy166II CviJI SetI | TspEI | SetI TspEI \ \ \ \ \ \ AGATTATTTGAAACCTTATTTGTTCACCAATTCTCTTTAGCTACTATGCCAATTTTCAAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAATAAACTTTGGAATAAACAAGTGGTTAAGAGAAATCGATGATACGGTTAAAAGTTG / / / / / / / / | HphI | TspEI | CviJI | SetI SetI Hpy166II | AluI TspEI SetI R L F E T L F V H Q F S L A T M P I F N D Y L K P Y L F T N S L * L L C Q F S T I I * N L I C S P I L F S Y Y A N F Q P ----:----|----:----|----:----|----:----|----:----|----:----| L N N S V K N T * W N E K A V I G I K L S I I Q F R I Q E G I R K L * * A L K * S * K F G * K N V L E R * S S H W N E V BsiYI* | BsrI | | DdeI | | | BfiI | | | | AciI BsmAI TsoI SetI TspEI | | | | TspDTI Eco31I | MaeIII \ \ \ \ \ \ \ \ \ \ CTGTTCAAAAATTGTTTCCATTACTGGGTTCTAAGCGGTCTCATTTCATTCGGTTACTTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GACAAGTTTTTAACAAAGGTAATGACCCAAGATTCGCCAGAGTAAAGTAAGCCAATGAAA / / / /// / // / TspEI | BsrI ||| AciI |TsoI MaeIII BsiYI* ||DdeI Eco31I |TspDTI BsmAI BfiI L F K N C F H Y W V L S G L I S F G Y F C S K I V S I T G F * A V S F H S V T L V Q K L F P L L G S K R S H F I R L L W ----:----|----:----|----:----|----:----|----:----|----:----| R N L F Q K W * Q T R L P R M E N P * K G T * F N N G N S P E L R D * K M R N S Q E F I T E M V P N * A T E N * E T V K BceAI | DdeI CviJI CviJI | |BsmI TspDTI TspEI \ \ \ \\ \ \ GGCTACGGCTTCCCCTTTGGGAATGCTAAGTTATTCAAATACTATTCATATTTGAAATTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCGATGCCGAAGGGGAAACCCTTACGATTCAATAAGTTTATGATAAGTATAAACTTTAAC / / / / / / / CviJI CviJI | | | TspDTI TspEI | | DdeI | BsmI BceAI G Y G F P F G N A K L F K Y Y S Y L K L A T A S P L G M L S Y S N T I H I * N W L R L P L W E C * V I Q I L F I F E I G ----:----|----:----|----:----|----:----|----:----|----:----| P * P K G K P F A L N N L Y * E Y K F N Q S R S G R Q S H * T I * I S N M N S I A V A E G K P I S L * E F V I * I Q F Q SmlI BseGI | TatI | |Csp6I | ||RsaI | |||FokI | |||| MseI | |||| VspI | |||| |TspEI Bce83I* Hpy188I \ \\\\ \\ \ \ GATGACTTGAGTACATTAATTGGTCTTTTCGTGCTTTCAGAACTATGGAACTTTTATTGC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGAACTCATGTAATTAACCAGAAAAGCACGAAAGTCTTGATACCTTGAAAATAACG / / /// // / / / BseGI | ||| || | Bce83I* Hpy188I | ||| || TspEI | ||| |VspI | ||| |MseI | ||| FokI | ||TatI | |Csp6I | RsaI SmlI D D L S T L I G L F V L S E L W N F Y C M T * V H * L V F S C F Q N Y G T F I A * L E Y I N W S F R A F R T M E L L L P ----:----|----:----|----:----|----:----|----:----|----:----| S S K L V N I P R K T S E S S H F K * Q P H S S Y M L Q D K R A K L V I S S K N I V Q T C * N T K E H K * F * P V K I A FatI |CviAII || MaeIII || NlaIII || | BslFI || | TspGWI || | | BinI* MseI || | | | DdeI | TspEI || | | | | MboI | | Hin6I || | | | | XhoII | | |GlaI MaeIII || | | | | | DpnI | | ||HhaI Tsp45I HphI || | | | | | |BstKTI \ \ \\\ \ \ \\ \ \ \ \ \ \\ CACATTAAATTGCGCCTATGGGGTGACTATCAAAAGAAGCATGGTAACGCTAAGATCCGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTAATTTAACGCGGATACCCCACTGATAGTTTTCTTCGTACCATTGCGATTCTAGGCA / //// / / / /// /// /// / | |||Hin6I | HphI | ||| ||| ||| XhoII | ||GlaI Tsp45I | ||| ||| ||| MboI | |HhaI MaeIII | ||| ||| ||DpnI | TspEI | ||| ||| |BstKTI MseI | ||| ||| DdeI | ||| ||BslFI | ||| |BinI* | ||| MaeIII | ||TspGWI | |FatI | CviAII NlaIII H I K L R L W G D Y Q K K H G N A K I R T L N C A Y G V T I K R S M V T L R S V H * I A P M G * L S K E A W * R * D P C ----:----|----:----|----:----|----:----|----:----|----:----| W M L N R R H P S * * F F C P L A L I R G C * I A G I P H S D F S A H Y R * S G V N F Q A * P T V I L L L M T V S L D T TfiI HinfI SetI \ \ GTCCCATTGAATCAAGGTATTTTCAATCTTTTTGTTGCTCCCAACTATACTTTTGAAGTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAGGGTAACTTAGTTCCATAAAAGTTAGAAAAACAACGAGGGTTGATATGAAAACTTCAA / / | SetI HinfI TfiI V P L N Q G I F N L F V A P N Y T F E V S H * I K V F S I F L L L P T I L L K F P I E S R Y F Q S F C C S Q L Y F * S L ----:----|----:----|----:----|----:----|----:----|----:----| T G N F * P I K L R K T A G L * V K S T H G M S D L Y K * D K Q Q E W S Y K Q L D W Q I L T N E I K K N S G V I S K F N BceAI Hpy166II | TspEI \ \ \ TGGTCTTGGATTTGGTTTACTTTTGTGTTCAAGTTCAATTTATTTGCCGTTTTATTTTTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGAACCTAAACCAAATGAAAACACAAGTTCAAGTTAAATAAACGGCAAAATAAAAAC / / / Hpy166II BceAI TspEI W S W I W F T F V F K F N L F A V L F L G L G F G L L L C S S S I Y L P F Y F * V L D L V Y F C V Q V Q F I C R F I F D ----:----|----:----|----:----|----:----|----:----|----:----| Q D Q I Q N V K T N L N L K N A T K N K K T K S K T * K Q T * T * N I Q R K I K P R P N P K S K H E L E I * K G N * K Q Csp6I |RsaI || FatI || |CviAII || || NlaIII AluI || || | CviJI CviJI || || | | SduI SapI Tsp4CI* | SetI || || | | HgiJII* Ksp632I* \ \ \ \\ \\ \ \ \ \ ACTGTTTCAACAGCTCAAATGTACGCATGGGCTCAAAAGAAAAACAAAAAGTATCATACC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGACAAAGTTGTCGAGTTTACATGCGTACCCGAGTTTTCTTTTTGTTTTTCATAGTATGG / / / // / // / / Tsp4CI* | CviJI || | || CviJI Ksp632I* | AluI || | |HgiJII* SapI SetI || | |FatI || | |SduI || | CviAII || NlaIII |Csp6I RsaI T V S T A Q M Y A W A Q K K N K K Y H T L F Q Q L K C T H G L K R K T K S I I P C F N S S N V R M G S K E K Q K V S Y Q ----:----|----:----|----:----|----:----|----:----|----:----| V T E V A * I Y A H A * F F F L F Y * V S Q K L L E F T R M P E F S F C F T D Y S N * C S L H V C P S L L F V F L I M G Hpy178III* | MboII | |TfiI BsmI | |HinfI \ \ \\ AGAAGAGCATTCTTGATTCCATTTGTATTTTGA 910 920 930 ----:----|----:----|----:----|--- TCTTCTCGTAAGAACTAAGGTAAACATAAAACT / // / BsmI || HinfI || TfiI |Hpy178III* MboII R R A F L I P F V F * E E H S * F H L Y F X K S I L D S I C I L X ----:----|----:----|----:----|--- L L A N K I G N T N Q W F L M R S E M Q I K S S C E Q N W K Y K S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AhaIII* 1 DraI AluI 3 AluBI ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 1 BpuEI BceAI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BmtI 1 BspOI BseGI 1 BstF5I,BtsCI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BsrBI 1 AccBSI,MbiI BsrI 2 BseNI,Bse1I,BsrSI BstKTI 1 Cac8I 1 BstC8I Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 3 CviJI 9 CviKI-1 CviRI* 1 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 1 MalI DraII 1 EcoO109I Eco31I 1 Bso31I,BspTNI,BsaI EcoRI 1 FatI 3 FokI 1 GlaI 1 HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin6I 1 HinP1I,HspAI HinfI 5 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 3 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeIII 3 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MlyI 1 SchI MmeI 1 MnlI 1 MseI 6 Tru1I,Tru9I NheI 1 AsuNHI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I PleI 1 PpsI PpuMI 1 Psp5II,PspPPI RsaI 3 AfaI SanDI 1 SapI 1 LguI,PciSI,BspQI SduI 1 MhlI,Bsp1286I SetI 7 SmlI 1 SmoI TatI 2 TauI 1 TfiI 4 PfeI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI VspI 1 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BcgI BciVI BclI BdaI BglI BglII BmeT110I BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI DinI DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* Hin4I Hin4II* HindII HindIII HpaI Hpy99I KasI KpnI MaeII MauBI McrI* MfeI MluI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SauI* ScaI ScrFI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqI TaqII TseI TspMI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769