Restriction Map of YDL007C-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YDL007C-A on chromosome IV from coordinates 436824 to 436567.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.27262

EMBOSS_001 FokI |TspEI Hpy178III* || Hin4II* BseGI BccI | MnlI SspI \\ \ \ \ \ \ \ ATGTTCCTTCCTATAATTTTTCACACCATCCTAACCCTCCTGAACTTTGGTAAATATTAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAGGAAGGATATTAAAAAGTGTGGTAGGATTGGGAGGACTTGAAACCATTTATAATG / // / / / / / / | |TspEI BseGI BccI | MnlI SspI Tsp4CI* | FokI Hpy178III* Hin4II* M F L P I I F H T I L T L L N F G K Y Y C S F L * F F T P S * P S * T L V N I T V P S Y N F S H H P N P P E L W * I L L ----:----|----:----|----:----|----:----|----:----|----:----| X N R G I I K * V M R V R R F K P L Y * X T G E * L K E C W G L G G S S Q Y I N H E K R Y N K V G D * G E Q V K T F I V Tsp4CI* | Hpy166II | | SetI | | | Hin4I | | | Hin4I | | | Hpy178III* | | | | BbvII* | | | | | MboII | | | | | | Hpy178III* | | | | | | | TspEI | | | | | | | | Hin4I | | | | | | | | Hin4I | | | | | | | | | ApoI | | | | | | | | | TspEI \ \ \ \ \ \ \ \ \ \ TGTTTACCTATTCAAGAAGACGATGATAAATCAGGAAAAGAAATTGAACAAATTTTAGAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAATGGATAAGTTCTTCTGCTACTATTTAGTCCTTTTCTTTAACTTGTTTAAAATCTG // / / / / / / / || Hin4I Hpy178III* BbvII* | | TspEI TspEI || Hin4I MboII | Hin4I ApoI |SetI | Hin4I Hpy166II Hpy178III* C L P I Q E D D D K S G K E I E Q I L D V Y L F K K T M I N Q E K K L N K F * T F T Y S R R R * * I R K R N * T N F R Q ----:----|----:----|----:----|----:----|----:----|----:----| Q K G I * S S S S L D P F S I S C I K S S N V * E L L R H Y I L F L F Q V F K L T * R N L F V I I F * S F F N F L N * V ApoI TaqI TaqI PleI TspEI | Hin4I | HinfI |MlyI | TaqI | Hin4I MnlI \ \ \\ \ \ \ \ \ AATAACATCGAGTCATTAGGACTACTACTAAATTCGATGTCCTTATCCTCGAACTTTACG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGTAGCTCAGTAATCCTGATGATGATTTAAGCTACAGGAATAGGAGCTTGAAATGC / / / / / / / / | HinfI PleI | TaqI | TaqI MnlI TaqI MlyI TspEI Hin4I ApoI Hin4I N N I E S L G L L L N S M S L S S N F T I T S S H * D Y Y * I R C P Y P R T L R * H R V I R T T T K F D V L I L E L Y D ----:----|----:----|----:----|----:----|----:----|----:----| L L M S D N P S S S F E I D K D E F K V C Y C R T M L V V V L N S T R I R S S * I V D L * * S * * * I R H G * G R V K R BinI* | MboI | | DpnI | | |BstKTI | | ||Hpy178III* | | ||| MaeI | | ||| | MboII | | ||| | |TfiI | | ||| | |HinfI | | ||| | || Hin4I SapI AvaI | | ||| | || Hin4I Ksp632I* MseI |BmeT110I \ \ \\\ \ \\ \ \ \ \\ ACAGGCGATCCTGAACTAGATTCGCTCTTCCAAGATGATTTAATCCCCGAGTTATATAGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCCGCTAGGACTTGATCTAAGCGAGAAGGTTCTACTAAATTAGGGGCTCAATATATCA / // / / // / / / // | || | | || HinfI | MseI |AvaI | || | | || TfiI Ksp632I* BmeT110I | || | | |Hin4I SapI | || | | |Hin4I | || | | |MaeI | || | | MboII | || | Hpy178III* | || MboI | |DpnI | BstKTI BinI* T G D P E L D S L F Q D D L I P E L Y S Q A I L N * I R S S K M I * S P S Y I V R R S * T R F A L P R * F N P R V I * C ----:----|----:----|----:----|----:----|----:----|----:----| V P S G S S S E S K W S S K I G S N Y L S L R D Q V L N A R G L H N L G R T I Y C A I R F * I R E E L I I * D G L * I T BccI CviJI \ \ GTATTAGATGGCTTCTAA 250 ----:----|----:--- CATAATCTACCGAAGATT / / BccI CviJI V L D G F * Y * M A S X I R W L L X ----:----|----:--- T N S P K * H I L H S R Y * I A E L # Enzymes that cut Frequency Isoschizomers ApoI 2 AcsI,XapI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 BinI* 1 AlwI,BspPI,AclWI BmeT110I 1 BseGI 1 BstF5I,BtsCI BstKTI 1 CviJI 1 CviKI-1 DpnI 1 MalI FokI 1 Hin4I 4 Hin4II* 1 HpyAV HinfI 2 Hpy166II 1 Hpy8I Hpy178III* 4 Hpy188III Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MlyI 1 SchI MnlI 2 MseI 1 Tru1I,Tru9I PleI 1 PpsI SapI 1 LguI,PciSI,BspQI SetI 1 SspI 1 TaqI 3 TfiI 1 PfeI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspEI 4 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BisI BlsI BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI CviRI* DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI Fnu4HI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin6I HindII HindIII HinP1I HpaI HpaII HphI Hpy188I Hpy99I HspAI KasI KpnI MaeII MaeIII MauBI McrI* MfeI MluI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SauI* ScaI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TaiI TaqII TatI TauI TseI TsoI Tsp45I TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769