Restriction Map of TUP1/YCR084C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TUP1/YCR084C on chromosome III from coordinates 262452 to 260311.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.23640

EMBOSS_001 MwoI | AluI | CviJI | | SetI | | | MwoI | | | SfaNI | | | | AluI | | | | CviJI | | | | | SetI TaqI | | | | | | Hpy178III* Cac8I AsuII | | | | | | |TaqI Hpy188I \ \ \ \ \ \ \ \ \\ \ ATGACTGCCAGCGTTTCGAATACGCAGAATAAGCTGAATGAGCTTCTCGATGCCATCAGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGACGGTCGCAAAGCTTATGCGTCTTATTCGACTTACTCGAAGAGCTACGGTAGTCT / / / / / / / // // / Cac8I AsuII | | | | | || |TaqI Hpy188I TaqI | | | | | || Hpy178III* | | | | | |SfaNI | | | | | CviJI | | | | | AluI | | | | SetI | | | MwoI | | CviJI | | AluI | SetI MwoI M T A S V S N T Q N K L N E L L D A I R * L P A F R I R R I S * M S F S M P S D D C Q R F E Y A E * A E * A S R C H Q T ----:----|----:----|----:----|----:----|----:----|----:----| X V A L T E F V C F L S F S S R S A M L X S Q W R K S Y A S Y A S H A E R H W * H S G A N R I R L I L Q I L K E I G D S MboII BbvII* MnlI | SetI BccI | BsmAI | | Tsp4CI* \ \ \ \ \ \ CAGGAGTTTCTCCAAGTCTCACAAGAGGCAAATACCTACCGTCTTCAAAACCAAAAGGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTCAAAGAGGTTCAGAGTGTTCTCCGTTTATGGATGGCAGAAGTTTTGGTTTTCCTA / / / / // BccI MnlI BsmAI | |Tsp4CI* | BbvII* MboII SetI Q E F L Q V S Q E A N T Y R L Q N Q K D R S F S K S H K R Q I P T V F K T K R I G V S P S L T R G K Y L P S S K P K G L ----:----|----:----|----:----|----:----|----:----|----:----| C S N R W T E C S A F V * R R * F W F S V P T E G L R V L P L Y R G D E F G F P L L K E L D * L L C I G V T K L V L L I BseMII |TseI |BspCNI ||BisI |||BlsI |||SfaNI ||||AluI ||||CviJI ||||PvuII ||||AlwNI ||||PflMI ||||BsiYI* ||||NspBII* ||||| SetI ||||| Cac8I ||||| | CviJI ||||| | TspDTI ||||| | |DdeI ||||| | || BbvI BbvI ||||| | || | TseI |EcoP15I ||||| | || | CviRI* || Tsp4CI* ||||| | || | |BisI || | AccI ||||| | || | ||BlsI || | |Hpy166II \\\\\ \ \\ \ \\\ \\ \ \\ TACGATTTCAAAATGAACCAGCAGCTGGCTGAGATGCAGCAGATAAGAAACACCGTCTAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTAAAGTTTTACTTGGTCGTCGACCGACTCTACGTCGTCTATTCTTTGTGGCAGATG // //// /// / //// /// // || |||| ||| | |||TseI ||| |AccI || |||| ||| | ||BisI ||| Hpy166II || |||| ||| | |BbvI ||Tsp4CI* || |||| ||| | |BlsI |BbvI || |||| ||| | CviRI* EcoP15I || |||| ||| DdeI || |||| ||CviJI || |||| |SfaNI || |||| TspDTI || |||| Cac8I || |||NspBII* || |||PvuII || |||CviJI || |||TseI || |||AluI || ||BisI || |BlsI || |SetI || BsiYI* || PflMI || AlwNI |BspCNI BseMII Y D F K M N Q Q L A E M Q Q I R N T V Y T I S K * T S S W L R C S R * E T P S T R F Q N E P A A G * D A A D K K H R L R ----:----|----:----|----:----|----:----|----:----|----:----| * S K L I F W C S A S I C C I L F V T * N R N * F S G A A P Q S A A S L F C R R V I E F H V L L Q S L H L L Y S V G D V MluI AflIII | FnuDII* | |SplI* MboI | ||Csp6I | DpnI | |||RsaI | |BstKTI | ||||Ksp632I* | ||BarI EcoP15I BarI | ||||| HgaI | |||MboII |BsrI | Hin4II* | ||||| TspDTI | |||| MboII \\ \ \ \ \\\\\ \ \ \\\\ \ GAACTGGAACTAACTCACAGGAAAATGAAGGACGCGTACGAAGAAGAGATCAAGCACTTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGACCTTGATTGAGTGTCCTTTTACTTCCTGCGCATGCTTCTTCTCTAGTTCGTGAAC / / / / / //// / // // / / | | BarI Hin4II* | |||| | || || | MboII | EcoP15I | |||| | || || MboII BsrI | |||| | || || MboI | |||| | || |DpnI | |||| | || BstKTI | |||| | |BarI | |||| | HgaI | |||| Ksp632I* | |||SplI* | ||TspDTI | ||Csp6I | |RsaI | AflIII | MluI FnuDII* E L E L T H R K M K D A Y E E E I K H L N W N * L T G K * R T R T K K R S S T * T G T N S Q E N E G R V R R R D Q A L E ----:----|----:----|----:----|----:----|----:----|----:----| S S S S V * L F I F S A Y S S S I L C K R V P V L E C S F S P R T R L L S * A S F Q F * S V P F H L V R V F F L D L V Q AciI TspEI MwoI | GsuI NspBII* CviJI | Eco57MI |BisI | BsmAI | |BccI SfaNI ||BlsI MaeI | Eco31I | || CviRI* | Tsp4CI* |||TauI \ \ \ \ \\ \ \ \ \\\\ AAACTAGGGCTGGAGCAAAGAGACCATCAAATTGCATCTTTGACCGTCCAGCAACAGCGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGATCCCGACCTCGTTTCTCTGGTAGTTTAACGTAGAAACTGGCAGGTCGTTGTCGCC / / / / // / / / //// | CviJI Eco31I | |CviRI* | SfaNI | |||MwoI MaeI BsmAI | TspEI Tsp4CI* | ||BisI | BccI | ||AciI Eco57MI | |BlsI GsuI | NspBII* | TauI MwoI K L G L E Q R D H Q I A S L T V Q Q Q R N * G W S K E T I K L H L * P S S N S G T R A G A K R P S N C I F D R P A T A A ----:----|----:----|----:----|----:----|----:----|----:----| F S P S S C L S W * I A D K V T W C C R S V L A P A F L G D F Q M K S R G A V A F * P Q L L S V M L N C R Q G D L L L P BbvI TseI MwoI |BisI ||BlsI |||TseI ||||BisI |||||BlsI ||||||NheI ||||||AluI ||||||CviJI |||||||MaeI |||||||EcoP15I AsuI* ||||||||SetI AvaII ||||||||Cac8I |BmgT120I ||||||||| BmtI ||SetI ||||||||| CviJI TseI |||BbvI ||||||||| |AciI MwoI |||| TseI ||||||||| |BisI |BisI |||| |BisI BbvI ||||||||| ||BlsI MwoI ||BlsI |||| ||BlsI |EcoP15I ||||||||| ||BbvI \ \\\ \\\\ \\\ \\ \\\\\\\\\ \\\ CAACAGCAACAGCAGCAACAGGTCCAGCAGCATTTACAACAGCAACAGCAGCAGCTAGCC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTCGTTGTCGTCGTTGTCCAGGTCGTCGTAAATGTTGTCGTTGTCGTCGTCGATCGG / /// / // /// // / ////// ///// | ||| | || ||TseI || | |||||| ||||BisI | ||| | || |BisI || | |||||| |||BlsI | ||| | || BbvI || | |||||| ||CviJI | ||| | || BlsI || | |||||| ||NheI | ||| | |AvaII || | |||||| ||TauI | ||| | |AsuI* || | |||||| |EcoP15I | ||| | BmgT120I || | |||||| |MaeI | ||| SetI || | |||||| Cac8I | ||TseI || | |||||CviJI | |BisI || | |||||TseI | BlsI || | |||||AluI MwoI || | |||||BmtI || | ||||BisI || | |||BlsI || | |||SetI || | |||BbvI || | ||TseI || | |BisI || | BlsI || MwoI |BbvI EcoP15I Q Q Q Q Q Q Q V Q Q H L Q Q Q Q Q Q L A N S N S S N R S S S I Y N S N S S S * P T A T A A T G P A A F T T A T A A A S R ----:----|----:----|----:----|----:----|----:----|----:----| C C C C C C C T W C C K C C C C C C S A A V A V A A V P G A A N V V A V A A A L L L L L L L L D L L M * L L L L L L * G TseI TauI NspBII* |BisI ||BlsI ||BbvI |||CviRI* |||| MwoI Cfr10I |||| | CviRI* |HpaII |||| | | SfaNI || CviJI |||| | | | EcoP15I || | TstI |||| | | | | BsrI || | BsaXI |||| | | | | SfaNI || | | GsuI |||| | | | | EcoP15I || | | Eco57MI |||| | | | | | Hin6I || | | | CfrI |||| | | | | | |GlaI || | | | | CviJI |||| | | | | | |MstI* || | | | | HaeIII |||| | | | | | ||HhaI || | | | | | AciI \\\\ \ \ \ \ \ \\\ \\ \ \ \ \ \ \ GCTGCATCTGCATCTGTTCCAGTTGCGCAACAACCACCGGCTACTACTTCGGCCACCGCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGTAGACGTAGACAAGGTCAACGCGTTGTTGGTGGCCGATGATGAAGCCGGTGGCGG //// / / // / / /// // / / / / / |||| | CviRI* || | | ||Hin6I || | | | | AciI |||| BbvI || | | |MstI* || | | | CfrI |||CviRI* || | | |GlaI || | | HaeIII |||BbvI || | | HhaI || | | CviJI |||MwoI || | SfaNI || | Eco57MI |||TseI || EcoP15I || | GsuI ||BisI |EcoP15I || BsaXI |BlsI SfaNI |Cfr10I NspBII* BsrI |CviJI AciI |TstI HpaII A A S A S V P V A Q Q P P A T T S A T A L H L H L F Q L R N N H R L L L R P P P C I C I C S S C A T T T G Y Y F G H R H ----:----|----:----|----:----|----:----|----:----|----:----| A A D A D T G T A C C G G A V V E A V A R Q M Q M Q E L Q A V V V P * * K P W R S C R C R N W N R L L W R S S S R G G G EcoP15I | BfiI | CviJI | HaeIII | | BccI | | | BceAI | | | | BsrI | | | | | TatI | | | | | |Csp6I | | | | | ||RsaI | | | | | |||Hin4II* | | | | | |||| NheI | | | | | |||| AluI | | | | | |||| CviJI | | | | | |||| |MaeI MwoI | | | | | |||| ||SetI | TseI BsaXI | | | | | |||| ||Cac8I | |BisI | TstI | | | | | |||| ||| BmtI | ||BlsI | | BbvI BsrI | | | | | |||| ||| CviJI \ \\\ \ \ \ \ \ \ \ \ \ \\\\ \\\ \ ACTCCAGCAGCAAACACAACTACTGGTTCGCCATCGGCCTTCCCAGTACAAGCTAGCCGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGTCGTCGTTTGTGTTGATGACCAAGCGGTAGCCGGAAGGGTCATGTTCGATCGGCA / /// / / / // // / //// / /// MwoI ||| BsaXI | BsrI || || | |||| | ||CviJI ||| TstI BbvI || || | |||| | ||NheI ||TseI || || | |||| | |MaeI |BisI || || | |||| | Cac8I BlsI || || | |||| CviJI || || | |||| AluI || || | |||| BmtI || || | |||SetI || || | ||TatI || || | |Csp6I || || | Hin4II* || || | RsaI || || BceAI || |BsrI || BccI |EcoP15I |HaeIII |CviJI BfiI T P A A N T T T G S P S A F P V Q A S R L Q Q Q T Q L L V R H R P S Q Y K L A V S S S K H N Y W F A I G L P S T S * P S ----:----|----:----|----:----|----:----|----:----|----:----| V G A A F V V V P E G D A K G T C A L R W E L L L C L * Q N A M P R G L V L * G S W C C V C S S T R W R G E W Y L S A T CviJI Tsp4CI* XcmI MnlI \ \ \ \ CCTAATCTGGTTGGCTCACAGTTGCCTACCACCACTTTGCCTGTGGTGTCCTCAAACGCC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTAGACCAACCGAGTGTCAACGGATGGTGGTGAAACGGACACCACAGGAGTTTGCGG / / / / | Tsp4CI* XcmI MnlI CviJI P N L V G S Q L P T T T L P V V S S N A L I W L A H S C L P P L C L W C P Q T P * S G W L T V A Y H H F A C G V L K R P ----:----|----:----|----:----|----:----|----:----|----:----| G L R T P E C N G V V V K G T T D E F A D * D P Q S V T A * W W K A Q P T R L R R I Q N A * L Q R G G S Q R H H G * V G AlwNI | CviRI* | | TseI | | MwoI | | |BisI SetI | | ||BlsI BbvI TspGWI \ \ \\\ \ \ CAACAACAACTACCACAACAGCAACTGCAACAGCAGCAACTTCAACAACAGCAACCACCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTTGTTGATGGTGTTGTCGTTGACGTTGTCGTCGTTGAAGTTGTTGTCGTTGGTGGA / / / /// / / / AlwNI | | ||TseI BbvI | TspGWI | | |BisI SetI | | BlsI | MwoI CviRI* Q Q Q L P Q Q Q L Q Q Q Q L Q Q Q Q P P N N N Y H N S N C N S S N F N N S N H L T T T T T T A T A T A A T S T T A T T S ----:----|----:----|----:----|----:----|----:----|----:----| W C C S G C C C S C C C C S * C C C G G G V V V V V V A V A V A A V E V V A V V L L L * W L L L Q L L L L K L L L L W R EcoP15I |BssKI |SecI* |EcoRII MboI || ScrFI BccI || BseBI XhoII || | SetI | DpnI || | MnlI | |BstKTI || | | SecI* | || BinI* || | | DsaI* | || | BsmAI || | | | HgiCI* | || | Eco31I || | | | | NlaIV MaeIII CviJI | || | |TspGWI \\ \ \ \ \ \ \ \ \ \\ \ \\ CCCCAGGTTTCCGTGGCACCATTGAGTAACACAGCCATCAACGGATCTCCTACTTCTAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGGGTCCAAAGGCACCGTGGTAACTCATTGTGTCGGTAGTTGCCTAGAGGATGAAGATTT ///// / / / / / // / / / / ||||EcoRII | | HgiCI* | CviJI || | | | Eco31I ||||BssKI | NlaIV MaeIII || | | | BsmAI ||||MnlI DsaI* || | | TspGWI |||SecI* SecI* || | BinI* ||BseBI || XhoII ||ScrFI || MboI |SetI |DpnI EcoP15I BstKTI BccI P Q V S V A P L S N T A I N G S P T S K P R F P W H H * V T Q P S T D L L L L K P G F R G T I E * H S H Q R I S Y F * R ----:----|----:----|----:----|----:----|----:----|----:----| G W T E T A G N L L V A M L P D G V E L E G P K R P V M S Y C L W * R I E * K * G L N G H C W Q T V C G D V S R R S R F MnlI HgiCI* | NlaIV | | SetI MaeII | | |TfiI | SetI BetI* | | |HinfI | TaiI |HpaII \ \ \\ \ \ \\ GAGACCACTACTTTACCCTCTGTCAAGGCACCTGAATCTACGTTGAAAGAAACTGAACCG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGGTGATGAAATGGGAGACAGTTCCGTGGACTTAGATGCAACTTTCTTTGACTTGGC / / / / / / / | | | | | MaeII HpaII | | | | TaiI | | | | SetI | | | HinfI | | | TfiI | | HgiCI* | NlaIV | SetI MnlI E T T T L P S V K A P E S T L K E T E P R P L L Y P L S R H L N L R * K K L N R D H Y F T L C Q G T * I Y V E R N * T G ----:----|----:----|----:----|----:----|----:----|----:----| S V V V K G E T L A G S D V N F S V S G L S W * K V R Q * P V Q I * T S L F Q V L G S S * G R D L C R F R R Q F F S F R TaqI SetI | Hin4I | Hin4I | | MnlI | | | EciI | | | | BinI* | | | | |MboII | | | | ||BetI* | | | | |||HpaII | | | | |||| MboI | | | | |||| BamHI | | | | |||| XhoII | | | | |||| | DpnI | | | | |||| | NlaIV | | | | |||| | |BstKTI | | | | |||| | ||AciI | | | | |||| | ||| BinI* | | | | |||| | ||| | SecI* | | | | |||| | ||| | DsaI* | | | | |||| | ||| | | BglI | | | | |||| | ||| | | MwoI | | | | |||| | ||| | | |CfrI | | | | |||| | ||| | | || CviJI | | | | |||| | ||| | | || HaeIII | | | | |||| | ||| | | || | Hin4I | | | | |||| | ||| | | || | Hin4I \ \ \ \ \\\\ \ \\\ \ \ \\ \ \ GAAAATAATAATACCTCGAAGATAAATGACACCGGATCCGCCACCACGGCCACCACTACC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTATTATTATGGAGCTTCTATTTACTGTGGCCTAGGCGGTGGTGCCGGTGGTGATGG / / / / / / // /// / / / / // / BetI* | | TaqI | | || ||| | | | | || CfrI | Hin4I | | || ||| | | | | |HaeIII | Hin4I | | || ||| | | | | |CviJI SetI | | || ||| | | | | DsaI* | | || ||| | | | | SecI* | | || ||| | | | Hin4I | | || ||| | | | Hin4I | | || ||| | | BinI* | | || ||| | | MwoI | | || ||| | | BglI | | || ||| | AciI | | || ||| XhoII | | || ||| BamHI | | || ||| MboI | | || ||NlaIV | | || ||DpnI | | || |BstKTI | | || |BetI* | | || HpaII | | |BinI* | | MboII | EciI MnlI E N N N T S K I N D T G S A T T A T T T K I I I P R R * M T P D P P P R P P L P K * * Y L E D K * H R I R H H G H H Y H ----:----|----:----|----:----|----:----|----:----|----:----| S F L L V E F I F S V P D A V V A V V V P F Y Y Y R S S L H C R I R W W P W W * F I I I G R L Y I V G S G G G R G G S G AcyI | BbvII* | | BssKI | | SecI* | | | BglI | | | MwoI | | | HgaI | | | HpaII | | | ScrFI MnlI | | | MboII | DdeI | | | CauII* CviRI* AciI | SauI* | | | | CviJI | BssKI BceAI | |SetI | | | | |MaeI | EcoRII \ \ \\ \ \ \ \ \\ \ \ ACCGCAACTGAAACTGAAATCAAACCTAAGGAGGAAGACGCCACCCCGGCTAGTTTGCAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCGTTGACTTTGACTTTAGTTTGGATTCCTCCTTCTGCGGTGGGGCCGATCAAACGTG / / / / / / /// // / BceAI SetI SauI* | | | ||| |MaeI CviRI* AciI MnlI DdeI | | | ||| HgaI | | | ||BssKI | | | ||CviJI | | | |SecI* | | | |HpaII | | | CauII* | | | ScrFI | | BbvII* | | MboII | MwoI | BglI AcyI T A T E T E I K P K E E D A T P A S L H P Q L K L K S N L R R K T P P R L V C T R N * N * N Q T * G G R R H P G * F A P ----:----|----:----|----:----|----:----|----:----|----:----| V A V S V S I L G L S S S A V G A L K C W R L Q F Q F * V * P P L R W G P * N A G C S F S F D F R L L F V G G R S T Q V BslFI ScrFI BseBI | MboI | | DpnI | | |BstKTI | | || BinI* | | || |DdeI PsiI SetI SetI \ \ \\ \\ \ \ \ CAGGATCACTACTTAGTCCCTTATAATCAAAGAGCAAACCACTCTAAACCTATCCCACCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTAGTGATGAATCAGGGAATATTAGTTTCTCGTTTGGTGAGATTTGGATAGGGTGGA / // / / / / / / | || MboI | DdeI PsiI SetI SetI | |BslFI BinI* | |DpnI | EcoRII | BstKTI | BssKI BseBI ScrFI Q D H Y L V P Y N Q R A N H S K P I P P R I T T * S L I I K E Q T T L N L S H L G S L L S P L * S K S K P L * T Y P T F ----:----|----:----|----:----|----:----|----:----|----:----| W S * * K T G * L * L A F W E L G I G G G P D S S L G K Y D F L L G S * V * G V L I V V * D R I I L S C V V R F R D W R Hin4I Hin4I | MboI | XhoII | | DpnI | | |XbaI | | |BstKTI | | ||MaeI | | ||Hpy178III* | | ||| BfiI | | ||| |TfiI | | ||| |HinfI Hpy178III* | | ||| ||BinI* | Hin4I | | ||| ||| BsrI | Hin4I | | ||| ||| | SfaNI | | Hpy188I MboII \ \ \\\ \\\ \ \ \ \ \ \ TTCCTTTTGGATCTAGATTCCCAGTCTGTTCCCGATGCTCTGAAGAAGCAAACAAATGAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGAAAACCTAGATCTAAGGGTCAGACAAGGGCTACGAGACTTCTTCGTTTGTTTACTA / // //// // / // / / / Hin4I || |||| |HinfI | |Hin4I Hpy188I MboII Eco57MI Hin4I || |||| |TfiI | |Hin4I Eco57I || |||| |BsrI | Hpy178III* || |||| BinI* SfaNI || |||XbaI || ||Hpy178III* || ||MaeI || |BfiI || XhoII || MboI |DpnI BstKTI F L L D L D S Q S V P D A L K K Q T N D S F W I * I P S L F P M L * R S K Q M I P F G S R F P V C S R C S E E A N K * L ----:----|----:----|----:----|----:----|----:----|----:----| K R K S R S E W D T G S A R F F C V F S K G K P D L N G T Q E R H E S S A F L H E K Q I * I G L R N G I S Q L L L C I I BssKI MaeII | HpaII | SetI Eco57I | ScrFI | TaiI Eco57I Eco57MI | CauII* TspEI | | MaeIII Eco57MI \ \ \ \ \ \ \ \ TATTATATTTTATACAACCCGGCACTACCAAGAGAAATTGACGTTGAGTTACACAAATCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATATAAAATATGTTGGGCCGTGATGGTTCTCTTTAACTGCAACTCAATGTGTTTAGA /// // / / / ||BssKI || MaeII | Eco57MI |HpaII |TaiI | Eco57I CauII* |SetI MaeIII ScrFI TspEI Y Y I L Y N P A L P R E I D V E L H K S I I F Y T T R H Y Q E K L T L S Y T N L L Y F I Q P G T T K R N * R * V T Q I F ----:----|----:----|----:----|----:----|----:----|----:----| * * I K Y L G A S G L S I S T S N C L D N N Y K I C G P V V L L F Q R Q T V C I I I N * V V R C * W S F N V N L * V F R MboI BbvI | DpnI | DdeI | |BstKTI BccI | | HphI | || BinI* MaeIII | | CviJI \ \\ \ \ \ \ \ TTGGATCATACTTCAGTTGTTTGTTGCGTGAAGTTCAGTAACGATGGTGAATACTTAGCC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTAGTATGAAGTCAACAAACAACGCACTTCAAGTCATTGCTACCACTTATGAATCGG // / / / / /// || MboI BinI* | MaeIII ||CviJI |DpnI BccI |HphI BstKTI |DdeI BbvI L D H T S V V C C V K F S N D G E Y L A W I I L Q L F V A * S S V T M V N T * P G S Y F S C L L R E V Q * R W * I L S H ----:----|----:----|----:----|----:----|----:----|----:----| K S * V E T T Q Q T F N L L S P S Y K A K P D Y K L Q K N R S T * Y R H H I S L Q I M S * N N T A H L E T V I T F V * G TseI CviJI Bce83I* AsuI* |BisI |CviJI ||BlsI FnuDII* |HaeIII |||CviRI* | Hpy188I |BmgT120I |||| TsoI SmlI | BccI | EcoP15I || BcgI \\\\ \ \ \ \ \ \ \\ \ ACAGGCTGCAACAAAACTACTCAAGTGTATCGCGTTTCAGATGGTTCTCTGGTGGCCCGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCCGACGTTGTTTTGATGAGTTCACATAGCGCAAAGTCTACCAAGAGACCACCGGGCA / //// / / / / / / /// | |||| TsoI SmlI | | Hpy188I | ||AsuI* | |||CviRI* | BccI | |BmgT120I | |||TseI FnuDII* | |BcgI | ||BisI | HaeIII | |BlsI | CviJI | CviJI EcoP15I Bce83I* T G C N K T T Q V Y R V S D G S L V A R Q A A T K L L K C I A F Q M V L W W P V R L Q Q N Y S S V S R F R W F S G G P S ----:----|----:----|----:----|----:----|----:----|----:----| V P Q L L V V * T Y R T E S P E R T A R W L S C C F * E L T D R K L H N E P P G C A A V F S S L H I A N * I T R Q H G T TaqI | BcgI | |ApoI | |TspEI | || BccI | || | TaqI BbvI | || | |MboI | Hpy188I TseI | || | || DpnI | | TfiI |BisI | || | || TsoI | | HinfI ||BlsI | || | || |BstKTI TspRI \ \ \ \\\ \ \\ \ \\ \\ \ CTATCTGACGATTCTGCTGCCAATAACCATCGAAATTCGATCACTGAAAATAACACCACC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GATAGACTGCTAAGACGACGGTTATTGGTAGCTTTAAGCTAGTGACTTTTATTGTGGTGG / / / /// / / ///// / / | BbvI | ||TseI | | ||||| MboI TaiI Hpy188I | |BisI | | ||||DpnI SetI | BlsI | | |||BstKTI HinfI | | |||TspRI TfiI | | |||TaqI | | ||TsoI | | |TspEI | | |ApoI | | BccI | TaqI BcgI L S D D S A A N N H R N S I T E N N T T Y L T I L L P I T I E I R S L K I T P P I * R F C C Q * P S K F D H * K * H H H ----:----|----:----|----:----|----:----|----:----|----:----| R D S S E A A L L W R F E I V S F L V V D I Q R N Q Q W Y G D F N S * Q F Y C W * R V I R S G I V M S I R D S F I V G G MaeII |BtrI || SetI || TaiI || |SecI* || |DsaI* || |Hpy166II TspGWI TspEI MslI \\ \\ \ \ \ ACGTCCACGGATAACAATACAATGACAACCACTACTACCACCACAATTACTACCACAGCG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAGGTGCCTATTGTTATGTTACTGTTGGTGATGATGGTGGTGTTAATGATGGTGTCGC // / / / / / || | DsaI* TspGWI TspEI MslI || | SecI* || Hpy166II |MaeII BtrI T S T D N N T M T T T T T T T I T T T A R P R I T I Q * Q P L L P P Q L L P Q R V H G * Q Y N D N H Y Y H H N Y Y H S D ----:----|----:----|----:----|----:----|----:----|----:----| V D V S L L V I V V V V V V V I V V V A W T W P Y C Y L S L W * * W W L * * W L R G R I V I C H C G S S G G C N S G C R TseI |BisI |CspCI SetI ||BlsI EcoP15I |||BtgZI | MboII |||| TspEI | BbvII* |||| | MwoI | | CspCI |||| | | BbvI | | | FokI \\\\ \ \ \ \ \ \ \ ATGACTTCGGCAGCAGAATTGGCAAAAGATGTGGAAAACCTGAACACTTCGTCTTCCCCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGAAGCCGTCGTCTTAACCGTTTTCTACACCTTTTGGACTTGTGAAGCAGAAGGGGT / /// // / / / // / / / | ||| || TspEI BbvI SetI || | FokI BseGI | ||| |BtgZI || BbvII* | ||| MwoI |CspCI | ||TseI EcoP15I | |BisI MboII | BlsI CspCI M T S A A E L A K D V E N L N T S S S P * L R Q Q N W Q K M W K T * T L R L P H D F G S R I G K R C G K P E H F V F P I ----:----|----:----|----:----|----:----|----:----|----:----| I V E A A S N A F S T S F R F V E D E G S S K P L L I P L L H P F G S C K T K G H S R C C F Q C F I H F V Q V S R R G W MmeI TspRI BseGI | BccI | BccI | | Hpy178III* | Hpy188I GsuI | | | ApoI | |TspGWI Eco57MI | | | TspEI \ \\ \ \ \ \ \ TCATCCGACTTGTATATCCGTTCAGTGTGTTTTTCTCCAGATGGGAAATTTTTGGCAACA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGGCTGAACATATAGGCAAGTCACACAAAAAGAGGTCTACCCTTTAAAAACCGTTGT / / / / / / / / // | BccI | TspRI MmeI | Hpy178III* TspEI |SetI Hpy188I Eco57MI BccI ApoI BstAPI TspGWI GsuI MwoI S S D L Y I R S V C F S P D G K F L A T H P T C I S V Q C V F L Q M G N F W Q Q I R L V Y P F S V F F S R W E I F G N R ----:----|----:----|----:----|----:----|----:----|----:----| D D S K Y I R E T H K E G S P F N K A V M M R S T Y G N L T N K E L H S I K P L * G V Q I D T * H T K R W I P F K Q C C BbvII* | MboII MwoI | | ApoI BstAPI | | TspEI MboII | SetI | | | Eco57I | TfiI | |AlwNI | | | Eco57MI | HinfI \ \\ \ \ \ \ \ \ GGTGCTGAAGACAGACTGATTAGAATTTGGGATATTGAAAATAGAAAGATTGTTATGATT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGACTTCTGTCTGACTAATCTTAAACCCTATAACTTTTATCTTTCTAACAATACTAA / / / / / / AlwNI | | TspEI MboII HinfI | | ApoI TfiI | Eco57MI | Eco57I BbvII* MboII G A E D R L I R I W D I E N R K I V M I V L K T D * L E F G I L K I E R L L * F C * R Q T D * N L G Y * K * K D C Y D S ----:----|----:----|----:----|----:----|----:----|----:----| P A S S L S I L I Q S I S F L F I T I I L H Q L C V S * F K P Y Q F Y F S Q * S T S F V S Q N S N P I N F I S L N N H N DdeI SauI* | MaeIII | Tsp45I | | SetI | | | MnlI | | | |TspEI | | | || DrdI CviJI | | | || BspCNI HaeIII TspDTI | | | || |BseMII \ \ \ \ \ \\ \\ CTTCAAGGCCACGAACAAGATATTTATTCATTGGACTACTTTCCCTCAGGTGACAAATTA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGTTCCGGTGCTTGTTCTATAAATAAGTAACCTGATGAAAGGGAGTCCACTGTTTAAT / / // // // // HaeIII TspDTI || || || |HphI CviJI || || || TspEI || || |BseMII || || BspCNI || || DrdI || |Tsp45I || |MaeIII || MnlI |SauI* |DdeI SetI L Q G H E Q D I Y S L D Y F P S G D K L F K A T N K I F I H W T T F P Q V T N * S R P R T R Y L F I G L L S L R * Q I S ----:----|----:----|----:----|----:----|----:----|----:----| R * P W S C S I * E N S * K G E P S L N E E L G R V L Y K N M P S S E R L H C I K L A V F L I N I * Q V V K G * T V F * MaeII |BsaAI |SnaBI ||Csp6I MaeIII |||RsaI Tsp45I |||SetI BstEII |||TaiI | Tsp4CI* |||| TspDTI HphI | |Csp6I |||| | BslFI | BetI* | ||RsaI |||| | |CviJI | |HpaII | ||| Tsp4CI* |||| | |HaeIII | ||BsmAI | ||| |HphI |||| | ||BsrI TspRI \ \\\ \ \\\ \\ \\\\ \ \\\ \ GTCTCCGGTTCTGGTGACCGTACCGTTCGTATTTGGGACTTACGTACAGGCCAGTGTTCA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGGCCAAGACCACTGGCATGGCAAGCATAAACCCTGAATGCATGTCCGGTCACAAGT // / / //// / //// // / || BsmAI | |||HphI | |||| || BslFI |BetI* | ||Tsp4CI* | |||| |HaeIII HpaII | |Csp6I | |||| |CviJI | RsaI | |||| TspRI Tsp4CI* | |||| BsrI BstEII | |||Csp6I Tsp45I | ||TspDTI MaeIII | ||RsaI | |MaeII | SnaBI | BsaAI TaiI SetI V S G S G D R T V R I W D L R T G Q C S S P V L V T V P F V F G T Y V Q A S V H L R F W * P Y R S Y L G L T Y R P V F I ----:----|----:----|----:----|----:----|----:----|----:----| T E P E P S R V T R I Q S K R V P W H E L R R N Q H G Y R E Y K P S V Y L G T N D G T R T V T G N T N P V * T C A L T * MaeIII | MboII | | Tsp4CI* | | | HphI | | | | Hpy99I | | | | | EcoP15I | | | | | | BssKI | | | | | | SexAI | | | | | | EcoRII | | | | | | |BccI | | | | | | ||ScrFI | | | | | | ||BseBI | | | | | | |||BtgZI | | | | | | ||||DraIII | | | | | | ||||| SetI | | | | | | ||||| |PflMI | | | | | | ||||| |BsiYI* BccI | | | | | | ||||| || BbvI \ \ \ \ \ \ \ \\\\\ \\ \ TTGACTTTATCCATTGAAGATGGTGTTACCACCGTCGCTGTATCACCAGGTGATGGTAAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGAAATAGGTAACTTCTACCACAATGGTGGCAGCGACATAGTGGTCCACTACCATTT / / / / / / ///// / / / BccI | | | HphI | ||||| BtgZI | HphI | | Tsp4CI* | ||||EcoRII BbvI | | Hpy99I | ||||SexAI | MaeIII | ||||BssKI MboII | |||BsiYI* | |||PflMI | ||BseBI | ||ScrFI | |SetI | |BccI | DraIII EcoP15I L T L S I E D G V T T V A V S P G D G K * L Y P L K M V L P P S L Y H Q V M V N D F I H * R W C Y H R R C I T R * W * I ----:----|----:----|----:----|----:----|----:----|----:----| N V K D M S S P T V V T A T D G P S P L M S K I W Q L H H * W R R Q I V L H H Y Q S * G N F I T N G G D S Y * W T I T F TfiI BsmAI HinfI Eco31I XbaI | TstI |MaeI | |Hpy188I |Hpy178III* | || BetI* TseI || MboI | || |HpaII |BisI || | DpnI | || || TfiI HphI ||BlsI || | |BstKTI | || || HinfI \ \\\ \\ \ \\ \ \\ \\ \ TACATCGCTGCTGGTTCTCTAGATCGTGCTGTGAGAGTTTGGGATTCCGAGACCGGATTC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTAGCGACGACCAAGAGATCTAGCACGACACTCTCAAACCCTAAGGCTCTGGCCTAAG /// /// / / // // / ||TseI ||| MboI | |Hpy188I || HinfI |BisI ||DpnI | |Eco31I || TfiI BlsI |BstKTI | |BsmAI |BetI* |XbaI | HinfI HpaII Hpy178III* | TfiI MaeI TstI Y I A A G S L D R A V R V W D S E T G F T S L L V L * I V L * E F G I P R P D S H R C W F S R S C C E S L G F R D R I L ----:----|----:----|----:----|----:----|----:----|----:----| Y M A A P E R S R A T L T Q S E S V P N I C R Q Q N E L D H Q S L K P N R S R I V D S S T R * I T S H S N P I G L G S E MaeI | TfiI | HinfI | | TstI | | | Hpy188I | | | | TfiI | | | | HinfI | | | | | BetI* CviJI | | | | | |HpaII HaeIII | | | | | || Csp6I | MlyI MboII | | | | | || |RsaI | PleI HinfI BbvII* \ \ \ \ \ \\ \\ \ \ \ \ TTGGTGGAAAGACTAGATTCGGAAAACGAATCCGGTACAGGCCACAAGGACTCTGTTTAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AACCACCTTTCTGATCTAAGCCTTTTGCTTAGGCCATGTCCGGTGTTCCTGAGACAAATA // // / //// / // / / || |Hpy188I | |||| | |PleI HinfI MboII || HinfI | |||| | MlyI || TfiI | |||| HaeIII |MaeI | |||| CviJI TstI | |||Csp6I | ||RsaI | |BetI* | HpaII HinfI TfiI L V E R L D S E N E S G T G H K D S V Y W W K D * I R K T N P V Q A T R T L F I G G K T R F G K R I R Y R P Q G L C L * ----:----|----:----|----:----|----:----|----:----|----:----| K T S L S S E S F S D P V P W L S E T * R P P F V L N P F R I R Y L G C P S Q K Q H F S * I R F V F G T C A V L V R N I MboI BglII XhoII HpaII | DpnI BccI | CviJI | |BstKTI |MaeI | | BciVI | || MseI \\ \ \ \ \ \\ \ AGCGTTGTCTTCACTAGAGATGGACAAAGCGTTGTATCCGGCTCATTAGATAGATCTGTT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCAACAGAAGTGATCTCTACCTGTTTCGCAACATAGGCCGAGTAATCTATCTAGACAA / / / // / // / BbvII* | MaeI || BciVI || XhoII BccI |CviJI || BglII HpaII || MboI |DpnI BstKTI S V V F T R D G Q S V V S G S L D R S V A L S S L E M D K A L Y P A H * I D L L R C L H * R W T K R C I R L I R * I C * ----:----|----:----|----:----|----:----|----:----|----:----| L T T K V L S P C L T T D P E N S L D T Y R Q R * * L H V F R Q I R S M L Y I Q A N D E S S I S L A N Y G A * * I S R N AluI CviJI | SetI TfiI ApoI | |Hpy178III* HinfI TspEI | || ApoI CviRI* | TaqI | BsiYI* | || TspEI CviRI* | BsmI | AsuII | |HpaII \ \\ \ \ \ \ \ \ \ \\ AAGCTCTGGAATTTGCAGAATGCAAACAACAAGAGCGATTCGAAAACTCCAAATTCCGGC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGAGACCTTAAACGTCTTACGTTTGTTGTTCTCGCTAAGCTTTTGAGGTTTAAGGCCG / / / / / / / / / / / | | | | CviRI* CviRI* | AsuII | | HpaII | | | TspEI BsmI | TaqI | TspEI | | | ApoI HinfI | ApoI | | Hpy178III* TfiI BsiYI* | CviJI | AluI MseI SetI K L W N L Q N A N N K S D S K T P N S G S S G I C R M Q T T R A I R K L Q I P A A L E F A E C K Q Q E R F E N S K F R H ----:----|----:----|----:----|----:----|----:----|----:----| L S Q F K C F A F L L L S E F V G F E P * A R S N A S H L C C S R N S F E L N R L E P I Q L I C V V L A I R F S W I G A MaeIII SecI* | MaeII DsaI* | |BsaAI | CfrI | |SnaBI | | BalI | || SetI | | CviJI | || TaiI TspGWI | | HaeIII \ \\ \ \ \ \ \ ACTTGTGAAGTTACGTATATCGGGCATAAAGACTTTGTATTGTCCGTGGCCACCACACAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TGAACACTTCAATGCATATAGCCCGTATTTCTGAAACATAACAGGCACCGGTGGTGTGTT / // / // / | |MaeII TspGWI || CfrI | MaeIII |HaeIII | SnaBI |CviJI | BsaAI |BalI TaiI DsaI* SetI SecI* T C E V T Y I G H K D F V L S V A T T Q L V K L R I S G I K T L Y C P W P P H K L * S Y V Y R A * R L C I V R G H H T K ----:----|----:----|----:----|----:----|----:----|----:----| V Q S T V Y I P C L S K T N D T A V V C C K H L * T Y R A Y L S Q I T R P W W V S T F N R I D P M F V K Y Q G H G G C L CspCI Hin4I TatI | BetI* MboI Hin4I |Csp6I | |HpaII | DpnI | BsiYI* ||RsaI | || NlaIV | |BstKTI | | CspCI TspGWI \\\ \ \\ \ \ \\ \ \ \ \ AATGATGAGTACATCTTGTCCGGTTCCAAAGATCGTGGTGTCCTGTTTTGGGATAAGAAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTACTCATGTAGAACAGGCCAAGGTTTCTAGCACCACAGGACAAAACCCTATTCTTT //// /// // / / / / / |||CspCI ||NlaIV || | Hin4I | CspCI TspGWI ||TatI |BetI* || | Hin4I BsiYI* |Csp6I HpaII || MboI RsaI |DpnI BstKTI N D E Y I L S G S K D R G V L F W D K K M M S T S C P V P K I V V S C F G I R N * * V H L V R F Q R S W C P V L G * E I ----:----|----:----|----:----|----:----|----:----|----:----| F S S Y M K D P E L S R P T R N Q S L F F H H T C R T R N W L D H H G T K P Y S I I L V D Q G T G F I T T D Q K P I L F ApoI Hin4I CviRI* TspEI HpaII Hin4I | SetI EcoRI CviJI \ \ \ \ \ \ TCCGGCAATCCGTTATTGATGTTGCAAGGTCATAGGAATTCAGTTATATCTGTGGCTGTG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCCGTTAGGCAATAACTACAACGTTCCAGTATCCTTAAGTCAATATAGACACCGACAC / / / / / / HpaII Hin4I | SetI EcoRI CviJI Hin4I CviRI* TspEI ApoI S G N P L L M L Q G H R N S V I S V A V P A I R Y * C C K V I G I Q L Y L W L W R Q S V I D V A R S * E F S Y I C G C G ----:----|----:----|----:----|----:----|----:----|----:----| D P L G N N I N C P * L F E T I D T A T I R C D T I S T A L D Y S N L * I Q P Q G A I R * Q H Q L T M P I * N Y R H S H AciI |BsmAI |Eco31I ||BseYI ||NspBII* ||| GsaI ||| AsuI* ||| AvaII ||| |NlaIV ||| |BmgT120I ||| || Hpy178III* ||| || | AclI ||| || | MaeII ||| || | | SetI BsrI ||| || | | TaiI | AciI \\\ \\ \ \ \ \ \ GCAAACGGGTCTCCGCTGGGTCCAGAATATAACGTTTTTGCTACTGGTAGCGGTGATTGT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTGCCCAGAGGCGACCCAGGTCTTATATTGCAAAAACGATGACCATCGCCACTAACA / ///// / / / / / | ||||| | | MaeII BsrI AciI | ||||| | | AclI | ||||| | TaiI | ||||| | SetI | ||||| Hpy178III* | ||||AvaII | ||||AsuI* | |||BmgT120I | ||NlaIV | |BseYI | Eco31I | BsmAI NspBII* AciI GsaI A N G S P L G P E Y N V F A T G S G D C Q T G L R W V Q N I T F L L L V A V I V K R V S A G S R I * R F C Y W * R * L * ----:----|----:----|----:----|----:----|----:----|----:----| A F P D G S P G S Y L T K A V P L P S Q P L R T E A P D L I Y R K Q * Q Y R H N C V P R R Q T W F I V N K S S T A T I T Hin6I |GlaI ||HhaI |||HaeII |||| TspEI HphI |||| | MseI \ \\\\ \ \ AAAGCAAGGATTTGGAAGTATAAAAAAATAGCGCCAAATTAA 2110 2120 2130 2140 ----:----|----:----|----:----|----:----|-- TTTCGTTCCTAAACCTTCATATTTTTTTATCGCGGTTTAATT / //// // HphI |||Hin6I |MseI ||GlaI TspEI |HhaI HaeII K A R I W K Y K K I A P N * K Q G F G S I K K * R Q I X S K D L E V * K N S A K L X ----:----|----:----|----:----|----:----|-- L A L I Q F Y L F I A G F * Y L L S K S T Y F F L A L N F C P N P L I F F Y R W I L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 7 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 6 AluBI AlwNI 3 CaiI ApoI 6 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BarI 1 BbvI 13 BseXI,BstV1I,Lsp1109I BbvII* 5 BpiI,BpuAI,BstV2I,BbsI BccI 12 Bce83I* 1 BpuEI BceAI 2 BcgI 1 BciVI 1 BfuI BetI* 6 BsaWI BfiI 2 BmrI,BmuI BglI 2 BglII 1 BinI* 6 AlwI,BspPI,AclWI BisI 15 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 15 BmgT120I 3 BmtI 2 BspOI BsaAI 2 BstBAI,Ppu21I BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 2 BseYI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 6 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 2 BsrI 7 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 10 BtgZI 2 BtrI 1 BmgBI,AjiI Cac8I 4 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 3 AcoI,EaeI Csp6I 6 CviQI,RsaNI CspCI 2 CviJI 26 CviKI-1 CviRI* 10 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 10 MalI DraIII 1 AdeI DrdI 1 AasI,DseDI DsaI* 4 BtgI,BstDSI EciI 1 Eco31I 4 Bso31I,BspTNI,BsaI Eco57I 3 AcuI Eco57MI 6 EcoP15I 11 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 2 GsaI 1 GsuI 3 BpmI HaeII 1 BstH2I HaeIII 8 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HinfI 10 HpaII 12 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 7 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 8 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 7 MboI 10 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 MluI 1 MlyI 1 SchI MmeI 1 MnlI 7 MseI 2 Tru1I,Tru9I MslI 1 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 13 HpyF10VI,BstMWI NheI 2 AsuNHI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 4 MspA1I PflMI 2 BasI,AccB7I,Van91I PleI 1 PpsI PsiI 1 AanI PvuII 1 RsaI 6 AfaI SauI* 2 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 5 BmrFI,MspR9I,Bme1390I SecI* 6 BseDI,BssECI,BsaJI SetI 26 SexAI 1 MabI SfaNI 6 LweI SmlI 1 SmoI SnaBI 2 Eco105I,BstSNI SplI* 1 Pfl23II,PspLI,BsiWI TaiI 6 TaqI 6 TatI 2 TauI 2 TfiI 9 PfeI TseI 13 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 12 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 3 TscAI TstI 2 XbaI 2 XcmI 1 XhoII 4 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AflII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BbvCI BclI BdaI BmeT110I BplI Bpu10I BsaBI BsePI BseRI BseSI BsgI BsiI* Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BsrBI BsrDI BssNAI Bst1107I BstXI BstZ17I BtsI Cfr9I ClaI CviAII DinI DraII Eam1105I Ecl136II Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FatI FauI FseI FspAI HgiAI* HgiJII* HindII HindIII HpaI KasI KpnI MauBI McrI* MfeI Mph1103I MroNI NaeI NarI NcoI NdeI NgoMIV NlaIII NmeAIII NotI NruI NsiI NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI ScaI SduI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TspMI Tth111I VspI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769