Restriction Map of SED4/YCR067C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SED4/YCR067C on chromosome III from coordinates 236322 to 233125.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.31650

EMBOSS_001 AcyI MaeII |ZraI || SetI || TaiI || AatII || | Hpy99I ApoI || | Hpy188I TspEI || | | EcoRV | BarI || | | | Hpy188I | | PsiI MmeI CviRI* || | | | | BsiYI* | | Hin4II* \ \ \\ \ \ \ \ \ \ \ \ ATGAGTGGCAACTCTGCAAACTATGACGTCGGATATCCGATATATGGTGCTAAATTTATA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCACCGTTGAGACGTTTGATACTGCAGCCTATAGGCTATATACCACGATTTAAATAT / / //// / / / / / /// MmeI CviRI* |||| | | | BsiYI* BarI ||PsiI |||| | | Hpy188I |Hin4II* |||| | EcoRV TspEI |||| Hpy188I ApoI |||MaeII |||AcyI ||ZraI |Hpy99I AatII TaiI SetI M S G N S A N Y D V G Y P I Y G A K F I * V A T L Q T M T S D I R Y M V L N L * E W Q L C K L * R R I S D I W C * I Y K ----:----|----:----|----:----|----:----|----:----|----:----| X L P L E A F * S T P Y G I Y P A L N I X S H C S Q L S H R R I D S I H H * I * H T A V R C V I V D S I R Y I T S F K Y TspDTI | BsrI | | CviJI CviJI | | | MnlI HaeIII | | | | BarI |BsrI TspEI MnlI \ \ \ \ \ \\ \ \ AATGAAGGCACTCTACTGGTGGCTGGTGGTGGAGGCCAGTTCAATTCCTCGTTTCCAAAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTCCGTGAGATGACCACCGACCACCACCTCCGGTCAAGTTAAGGAGCAAAGGTTTG / / /// // / / | | ||MnlI |HaeIII TspEI MnlI | | |BarI |CviJI | | CviJI BsrI | BsrI TspDTI N E G T L L V A G G G G Q F N S S F P N M K A L Y W W L V V E A S S I P R F Q T * R H S T G G W W W R P V Q F L V S K Q ----:----|----:----|----:----|----:----|----:----|----:----| F S P V R S T A P P P P W N L E E N G F L H L C E V P P Q H H L G T * N R T E L I F A S * Q H S T T S A L E I G R K W V TspEI | FalI | FalI | | AluI | | CviJI | | | SetI | | | |MseI | | | ||AhaIII* | | | ||| SetI | | | ||| |Hpy166II FalI SetI | | | ||| || Hpy178III* FalI | Hpy178III* | | | ||| || | HphI | Hin4II* | | MboI \ \ \ \\\ \\ \ \ \ \ \ \ \ AAAATTACAGCTTTAAAGGTGAACTTCCAGAAAAAGAAACACATTAGAAGGTTTCGTGAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAATGTCGAAATTTCCACTTGAAGGTCTTTTTCTTTGTGTAATCTTCCAAAGCACTC / / / / /// / / / / / / / | | | | ||SetI | | FalI Hin4II* SetI | BstKTI | | | | |MseI | | FalI Hpy178III* | | | | | | Hpy178III* | | | | | | HphI | | | | | Hpy166II | | | | AhaIII* | | | CviJI | | | AluI | | SetI | TspEI FalI FalI K I T A L K V N F Q K K K H I R R F R E K L Q L * R * T S R K R N T L E G F V R N Y S F K G E L P E K E T H * K V S * D ----:----|----:----|----:----|----:----|----:----|----:----| L I V A K F T F K W F F F C M L L N R S C F * L K L P S S G S F S V C * F T E H F N C S * L H V E L F L F V N S P K T L TfiI TspDTI HinfI | Hin6I SetI DpnI | SfaNI | |GlaI |TfiI |BstKTI | |TaqI | ||HhaI BstXI |HinfI \\ \ \\ \ \\\ \ \\ ATCACATTAGATTCGATTGACGATGCGCCCACTTCATTGGATTGTAATAATAACCTGATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGTAATCTAAGCTAACTGCTACGCGGGTGAAGTAACCTAACATTATTATTGGACTAA / / / // / /// / / / | MboI | || | ||| BstXI SetI HinfI DpnI | || | ||Hin6I TfiI | || | |GlaI | || | HhaI | || TspDTI | |SfaNI | TaqI HinfI TfiI I T L D S I D D A P T S L D C N N N L I S H * I R L T M R P L H W I V I I T * F H I R F D * R C A H F I G L * * * P D S ----:----|----:----|----:----|----:----|----:----|----:----| I V N S E I S S A G V E N S Q L L L R I S * M L N S Q R H A W K M P N Y Y Y G S D C * I R N V I R G S * Q I T I I V Q N TfiI HinfI |TspDTI || FatI || NcoI || StyI || SecI* || DsaI* || |CviAII || || NlaIII || || | MnlI || || | | AclI || || | | MaeII || || | | | MseI || || | | | SetI || || | | | TaiI || || | | | |HpaI || || | | | |HindII BsrDI || || | | | |Hpy166II | Tsp4CI* || || | | | || MnlI MaeI CviRI* | | MseI || || | | | || | SmlI \ \ \ \ \ \\ \\ \ \ \ \\ \ \ CTAGTTGGTTGCAATGAACTGTTTAATGATTCCTCCATGGAGAACGTTAACCACCACTTG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GATCAACCAACGTTACTTGACAAATTACTAAGGAGGTACCTCTTGCAATTGGTGGTGAAC / / / / / / / / // / / / // / MaeI | | | | | | | || | | | || MnlI | | | | | | | || | | | |MseI | | | | | | | || | | | Hpy166II | | | | | | | || | | | HindII | | | | | | | || | | | HpaI | | | | | | | || | | MaeII | | | | | | | || | | AclI | | | | | | | || | TaiI | | | | | | | || | SetI | | | | | | | || MnlI | | | | | | | |DsaI* | | | | | | | |SecI* | | | | | | | |StyI | | | | | | | |NcoI | | | | | | | |FatI | | | | | | | CviAII | | | | | | NlaIII | | | | | HinfI | | | | | TfiI | | | | TspDTI | | | MseI | | Tsp4CI* | BsrDI CviRI* L V G C N E L F N D S S M E N V N H H L * L V A M N C L M I P P W R T L T T T * S W L Q * T V * * F L H G E R * P P L E ----:----|----:----|----:----|----:----|----:----|----:----| R T P Q L S S N L S E E M S F T L W W K E L Q N C H V T * H N R W P S R * G G S * N T A I F Q K I I G G H L V N V V V Q CfrI | BalI | CviJI ApoI | HaeIII TsoI Bce83I* TspEI | |BsrI FokI \ \ \ \ \\ \ AGGAAGTTTGTGTTTGAACAAGAACATCTAAAATTCGTGGCCAGTATTGATTTCAACAGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTCAAACACAAACTTGTTCTTGTAGATTTTAAGCACCGGTCATAACTAAAGTTGTCT // / / // / |TsoI Bce83I* | || CfrI SmlI | |HaeIII | |CviJI | |BalI | BsrI TspEI ApoI R K F V F E Q E H L K F V A S I D F N R G S L C L N K N I * N S W P V L I S T E E V C V * T R T S K I R G Q Y * F Q Q N ----:----|----:----|----:----|----:----|----:----|----:----| L F N T N S C S C R F N T A L I S K L L S S T Q T Q V L V D L I R P W Y Q N * C P L K H K F L F M * F E H G T N I E V S BbvI | AsuI* | |BmgT120I | ||CviJI | ||HaeIII | ||| Tsp4CI* | ||| |MwoI | ||| ||HgaI | ||| ||| TseI | ||| ||| AluI | ||| ||| CviJI | ||| ||| AlwNI Hpy166II | ||| ||| |BisI SfeI* | MseI | ||| ||| ||BlsI |TspGWI BseGI BccI DdeI | VspI | ||| ||| ||SetI \\ \ \ \ \ \ \ \\\ \\\ \\\ ACTACAGACCCATCCGTTTTCACTAAGTTTGTTTACATTAATCAAAGGGCCACAGTAGCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGATGTCTGGGTAGGCAAAAGTGATTCAAACAAATGTAATTAGTTTCCCGGTGTCATCGA / / / / / / / // // // /// | | BseGI BccI DdeI | VspI || || || ||BisI | SfeI* | MseI || || || |BlsI TspGWI Hpy166II || || || CviJI FokI || || || AluI || || |SetI || || AlwNI || |Tsp4CI* || MwoI |AsuI* BmgT120I HaeIII CviJI BbvI T T D P S V F T K F V Y I N Q R A T V A L Q T H P F S L S L F T L I K G P Q * L Y R P I R F H * V C L H * S K G H S S C ----:----|----:----|----:----|----:----|----:----|----:----| V V S G D T K V L N T * M L * L A V T A F * L G M R K * * T Q K C * D F P W L L S C V W G N E S L K N V N I L P G C Y S Hpy188I | BdaI | BdaI | | MnlI | | | SduI | | | BseSI | | | | Tsp4CI* | | | | | TspRI AciI | | | | | | BsaBI | FnuDII* CviRI* | | | | | | |TfiI | | TspEI |MfeI | | | | | | |HinfI | | |BdaI |TspEI | | | | | | |Eco57I | | |BdaI || MwoI | | | | | | |Eco57MI | | ||FauI \\ \ \ \ \ \ \ \ \\ \ \ \\\ GCAATTGCGTCCTCTGAAGTGCCCACTGTGATAAGAATCATTGACCCGCGTAATTTGACG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTAACGCAGGAGACTTCACGGGTGACACTATTCTTAGTAACTGGGCGCATTAAACTGC / / / / /// / // / / / / | TspEI | | ||| | || HinfI | BdaI TspEI | MfeI | | ||| | || TfiI | BdaI FauI CviRI* | | ||| | |BsaBI FnuDII* MwoI | | ||| | Eco57MI AciI TseI | | ||| | Eco57I HgaI | | ||| Tsp4CI* | | ||TspRI | | |MnlI | | BseSI | | SduI | BdaI | BdaI Hpy188I A I A S S E V P T V I R I I D P R N L T Q L R P L K C P L * * E S L T R V I * R N C V L * S A H C D K N H * P A * F D G ----:----|----:----|----:----|----:----|----:----|----:----| A I A D E S T G V T I L I M S G R L K V Q L Q T R Q L A W Q S L F * Q G A Y N S C N R G R F H G S H Y S D N V R T I Q R TspEI TspEI | TspGWI MseI CviRI* Tsp4CI* \ \ \ \ \ \ GAAAATTACGAAATTGAAACGGGTAGGGAAGTTAATGATTTGCACTTCGCCCCTAACGGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTAATGCTTTAACTTTGCCCATCCCTTCAATTACTAAACGTGAAGCGGGGATTGCCA / / / / / / | | TspEI MseI CviRI* Tsp4CI* | TspGWI TspEI E N Y E I E T G R E V N D L H F A P N G K I T K L K R V G K L M I C T S P L T V K L R N * N G * G S * * F A L R P * R Y ----:----|----:----|----:----|----:----|----:----|----:----| S F * S I S V P L S T L S K C K A G L P P F N R F Q F P Y P L * H N A S R G * R F I V F N F R T P F N I I Q V E G R V T TspEI ApoI | HgaI TspEI \ \ \ ATTCTTTTGTCATATATCACTTCTAATTCTTTGGAAGTAGCGTCTGTTAGGGACGGAAAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGAAAACAGTATATAGTGAAGATTAAGAAACCTTCATCGCAGACAATCCCTGCCTTTA / / TspEI HgaI I L L S Y I T S N S L E V A S V R D G N F F C H I S L L I L W K * R L L G T E I S F V I Y H F * F F G S S V C * G R K F ----:----|----:----|----:----|----:----|----:----|----:----| I R K D Y I V E L E K S T A D T L S P F Y E K T M Y * K * N K P L L T Q * P R F N K Q * I D S R I R Q F Y R R N P V S I BslFI BsaBI | TspGWI | TspGWI SetI \ \ \ \ \ TTTGTAGCAAGGAAAACGGATTTTGATAAAAATCTTGTTCTTTCTAATATCAGGTTTCTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAACATCGTTCCTTTTGCCTAAAACTATTTTTAGAACAAGAAAGATTATAGTCCAAAGAG / / / / / | | BslFI TspGWI SetI | TspGWI BsaBI TspEI ApoI F V A R K T D F D K N L V L S N I R F L L * Q G K R I L I K I L F F L I S G F S C S K E N G F * * K S C S F * Y Q V S Q ----:----|----:----|----:----|----:----|----:----|----:----| K T A L F V S K S L F R T R E L I L N R N Q L L S F P N Q Y F D Q E K * Y * T E K Y C P F R I K I F I K N K R I D P K E TaqI TseI BbvI |BisI SfaNI Hpy188I BcgI ||BlsI | BccI | BcgI MseI \ \\\ \ \ \ \ \ AATGACAATACGCTATTAGTGGCAGCATCATTATCGAACTCTGATGGAGTTTCCTTGTTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTGTTATGCGATAATCACCGTCGTAGTAATAGCTTGAGACTACCTCAAAGGAACAAT / /// / / / / / BcgI ||TseI | | | BcgI MseI |BisI | | Hpy188I BlsI | SfaNI | BbvI | BccI TaqI N D N T L L V A A S L S N S D G V S L L M T I R Y * W Q H H Y R T L M E F P C * * Q Y A I S G S I I I E L * W S F L V K ----:----|----:----|----:----|----:----|----:----|----:----| L S L V S N T A A D N D F E S P T E K N * H C Y A I L P L M M I S S Q H L K R T I V I R * * H C C * * R V R I S N G Q * SetI | MseI | | ApoI | | TspEI FatI | | |FokI |CviAII | | || MseI ||SfaNI | | || |AhaIII* ||| NlaIII | | || || TspDTI ||| | TaqI MaeI SetI | | || || | BseGI ||| | |Hin4II* \ \ \ \ \\ \\ \ \ \\\ \ \\ AAACTAGGTGTGAGTTCCAAAGGTGTTAAAATTTTAAAAACAGCATCCTTCATGTTCGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGATCCACACTCAAGGTTTCCACAATTTTAAAATTTTTGTCGTAGGAAGTACAAGCTA // / / ///// / / // / / |MaeI SetI MseI ||||| BseGI | || | TaqI SetI ||||TspDTI | || Hin4II* |||MseI | || SfaNI ||AhaIII* | |FatI |FokI | CviAII TspEI NlaIII ApoI K L G V S S K G V K I L K T A S F M F D N * V * V P K V L K F * K Q H P S C S I T R C E F Q R C * N F K N S I L H V R F ----:----|----:----|----:----|----:----|----:----|----:----| F S P T L E L P T L I K F V A D K M N S L V L H S N W L H * F K L F L M R * T R F * T H T G F T N F N * F C C G E H E I BccI BseGI | TaqI | BsmAI | ClaI | | FokI CviRI* \ \ \ \ \ \ TTGAATGGAATAACATCGATGGATGTCTCCCCAAATAAGAAGTTCGTTGCATTATCATCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTACCTTATTGTAGCTACCTACAGAGGGGTTTATTCTTCAAGCAACGTAATAGTAGA / / / / / / BccI ClaI BseGI | FokI CviRI* TaqI BsmAI L N G I T S M D V S P N K K F V A L S S * M E * H R W M S P Q I R S S L H Y H L E W N N I D G C L P K * E V R C I I I * ----:----|----:----|----:----|----:----|----:----|----:----| K F P I V D I S T E G F L F N T A N D D N S H F L M S P H R G L Y S T R Q M I M Q I S Y C R H I D G W I L L E N C * * R AluI CviJI | SetI | | HindIII | | | AluI | | | CviJI BccI | | | | SetI NlaIV \ \ \ \ \ \ \ AACGATAACTTGGTTGCCATCGTCAGCGTTGAAAAGCTAAAGCTTGTTCAGTTGGTTCCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTATTGAACCAACGGTAGCAGTCGCAACTTTTCGATTTCGAACAAGTCAACCAAGGT / / / / / / / BccI | | | | HindIII NlaIV | | | CviJI | | | AluI | | SetI | CviJI | AluI SetI N D N L V A I V S V E K L K L V Q L V P T I T W L P S S A L K S * S L F S W F Q R * L G C H R Q R * K A K A C S V G S K ----:----|----:----|----:----|----:----|----:----|----:----| L S L K T A M T L T S F S F S T * N T G * R Y S P Q W R * R Q F A L A Q E T P E V I V Q N G D D A N F L * L K N L Q N W TatI |Csp6I Hpy178III* ||RsaI | TfiI |||FatI BsaXI | HinfI ||||CviAII | GsuI | | XbaI ||||| TfiI | TspDTI | | |MaeI ||||| HinfI | Eco57MI | | |Hpy178III* ||||| NlaIII | | MaeIII | | || BsaXI Cac8I \\\\\ \ \ \ \ \ \ \\ \ \ AGAGTACATGAATCTACTATAACAAAAGTTACTTTTTCTCCAGATTCTAGATATTTGGCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCATGTACTTAGATGATATTGTTTTCAATGAAAAAGAGGTCTAAGATCTATAAACCGT /// // / / / / / / /// / ||| || | | Eco57MI MaeIII | | ||XbaI Cac8I ||| || | | TspDTI | | |Hpy178III* ||| || | | GsuI | | |MaeI ||| || | BsaXI | | BsaXI ||| || HinfI | HinfI ||| || TfiI | TfiI ||| |FatI Hpy178III* ||| CviAII ||TatI |NlaIII |Csp6I RsaI R V H E S T I T K V T F S P D S R Y L A E Y M N L L * Q K L L F L Q I L D I W Q S T * I Y Y N K S Y F F S R F * I F G K ----:----|----:----|----:----|----:----|----:----|----:----| L T C S D V I V F T V K E G S E L Y K A L L V H I * * L L L * K K E L N * I N P S Y M F R S Y C F N S K R W I R S I Q C MboI | DpnI | |BstKTI | || AclI | || MaeII | || | SetI | || | TaiI | || | | Hpy188I | || | | | HindIII | || | | | | AluI | || | | | | CviJI | || | | | | | SetI | || | | | | | | BetI* | || | | | | | | |HpaII Eco57I | || | | | | | | || Csp6I Eco57MI MslI | || | | | | | | || |RsaI | TspEI \ \ \\ \ \ \ \ \ \ \\ \\ \ \ AGCACTTCTATGGGGAACACGATCAACGTTCTGAAGCTTTCCGGTACATCGTCATCAATT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTGAAGATACCCCTTGTGCTAGTTGCAAGACTTCGAAAGGCCATGTAGCAGTAGTTAA / // // / / / / / //// / / MslI || || | | | | | |||| Eco57MI TspEI || || | | | | | |||| Eco57I || || | | | | | |||Csp6I || || | | | | | ||RsaI || || | | | | | |BetI* || || | | | | | HpaII || || | | | | HindIII || || | | | CviJI || || | | | AluI || || | | SetI || || | Hpy188I || || MaeII || || AclI || |TaiI || |SetI || MboI |DpnI BstKTI S T S M G N T I N V L K L S G T S S S I A L L W G T R S T F * S F P V H R H Q F H F Y G E H D Q R S E A F R Y I V I N F ----:----|----:----|----:----|----:----|----:----|----:----| L V E I P F V I L T R F S E P V D D D I L C K * P S C S * R E S A K R Y M T M L A S R H P V R D V N Q L K G T C R * * N CviJI | Cac8I | | Hin6I ApoI Hpy178III* | | |GlaI TspEI | ApoI | | ||HhaI SspI | XmnI | TspEI | | |||HaeII \ \ \ \ \ \ \ \\\\ TTACGAAATATTTGGAAATTTTTCTTGAATTTTGTTTTGTTAGTGGTTTTGGCTGGCGCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AATGCTTTATAAACCTTTAAAAAGAACTTAAAACAAAACAATCACCAAAACCGACCGCGA / // / / / ///// SspI |TspEI | TspEI | ||||Hin6I |ApoI | ApoI | |||GlaI XmnI Hpy178III* | ||HhaI | |HaeII | Cac8I CviJI L R N I W K F F L N F V L L V V L A G A Y E I F G N F S * I L F C * W F W L A L T K Y L E I F L E F C F V S G F G W R Y ----:----|----:----|----:----|----:----|----:----|----:----| K R F I Q F N K K F K T K N T T K A P A K V F Y K S I K R S N Q K T L P K P Q R * S I N P F K E Q I K N Q * H N Q S A S FatI BceAI |CviAII || NspI ApaLI || NlaIII | CviRI* || |MslI | Hpy166II || ||FatI | | SduI || ||BspHI | | BseSI || |||CviAII MaeI | | HgiAI* || |||Hpy178III* | CviJI | | | CviJI || |||| NlaIII \ \ \ \ \ \ \\ \\\\ \ ATTCAACTAGGCTACAAACATAATGTGCACGGCTTTATTTACAAACATGCTCATGATATA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTGATCCGATGTTTGTATTACACGTGCCGAAATAAATGTTTGTACGAGTACTATAT / / / / / / / ///// // | CviJI | | | CviJI | ||||| |BspHI MaeI | | ApaLI | ||||| |FatI | Hpy166II | ||||| Hpy178III* | CviRI* | ||||| CviAII HgiAI* | ||||NlaIII BseSI | |||MslI SduI | ||FatI | |CviAII | BceAI NlaIII NspI I Q L G Y K H N V H G F I Y K H A H D I F N * A T N I M C T A L F T N M L M I Y S T R L Q T * C A R L Y L Q T C S * Y I ----:----|----:----|----:----|----:----|----:----|----:----| I * S P * L C L T C P K I * L C A * S I * E V L S C V Y H A R S * K C V H E H Y N L * A V F M I H V A K N V F M S M I Y MboII |StyI |SecI* || MboII || | MboI || | XhoII TaqI || | | DpnI | ApoI Hin4I || | | |BstKTI Hin4I | TspEI Hin4I || | | || BinI* Hin4I \ \ \ \\ \ \ \\ \ \ TATAAGTCGAAATTCAAGGAAAACACTACCATAGACCAAGGATCTTCTTCTTATTTCACT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTCAGCTTTAAGTTCCTTTTGTGATGGTATCTGGTTCCTAGAAGAAGAATAAAGTGA / / / / / /// / / / TaqI TspEI Hin4I | | ||| | | Hin4I ApoI Hin4I | | ||| | | Hin4I | | ||| | BinI* | | ||| XhoII | | ||| MboI | | ||DpnI | | |BstKTI | | SecI* | | StyI | MboII MboII Y K S K F K E N T T I D Q G S S S Y F T I S R N S R K T L P * T K D L L L I S L * V E I Q G K H Y H R P R I F F L F H Y ----:----|----:----|----:----|----:----|----:----|----:----| Y L D F N L S F V V M S W P D E E * K V I Y T S I * P F C * W L G L I K K K N * I L R F E L F V S G Y V L S R R R I E S Hin6I |GlaI |Eco47III ||HhaI |||SfeI* MseI CviRI* |||HaeII VspI MnlI | EcoRV |||| BsgI \ \ \ \ \\\\ \ ATTAATGACGATTACAGAGGCATTACTGAAAGTGCAGATATCATCAGCGCTACAGATGTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTACTGCTAATGTCTCCGTAATGACTTTCACGTCTATAGTAGTCGCGATGTCTACAA / / / / //// / / VspI MnlI | EcoRV |||| | SfeI* MseI CviRI* |||| BsgI |||Hin6I ||Eco47III ||GlaI |HhaI HaeII I N D D Y R G I T E S A D I I S A T D V L M T I T E A L L K V Q I S S A L Q M L * * R L Q R H Y * K C R Y H Q R Y R C C ----:----|----:----|----:----|----:----|----:----|----:----| I L S S * L P M V S L A S I M L A V S T * * H R N C L C * Q F H L Y * * R * L H N I V I V S A N S F T C I D D A S C I N NheI |MaeI ||Cac8I ||| BmtI ApoI MnlI ||| | BsmAI TspEI | MaeI \\\ \ \ \ \ \ GCTAGCGATATAGAGACTGAATTTTCCTCATTTGACACTAGCACTATGAGAACCACCACA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGATCGCTATATCTCTGACTTAAAAGGAGTAAACTGTGATCGTGATACTCTTGGTGGTGT / /// / / / / | ||NheI BsmAI TspEI MnlI MaeI | |MaeI ApoI | Cac8I BmtI A S D I E T E F S S F D T S T M R T T T L A I * R L N F P H L T L A L * E P P Q * R Y R D * I F L I * H * H Y E N H H R ----:----|----:----|----:----|----:----|----:----|----:----| A L S I S V S N E E N S V L V I L V V V Q * R Y L S Q I K R M Q C * C * S F W W S A I Y L S F K G * K V S A S H S G G C AluI CviJI PvuII NspBII* SfeI* ApoI | SetI | CviRI* TspEI | |TfiI | | AjuI MboII EcoRV | |HinfI TspEI | | PstI \ \ \ \\ \ \ \ \ GAAGATGAGCAAAAATTTGTTTGGATATCGTCATCAGCTGATTCACAATTCACTTCTGCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTACTCGTTTTTAAACAAACCTATAGCAGTAGTCGACTAAGTGTTAAGTGAAGACGT / / / / / / / // / / | TspEI EcoRV | | HinfI | || | SfeI* | ApoI | | TfiI | || CviRI* MboII | NspBII* | |PstI | PvuII | AjuI | CviJI TspEI | AluI SetI E D E Q K F V W I S S S A D S Q F T S A K M S K N L F G Y R H Q L I H N S L L Q R * A K I C L D I V I S * F T I H F C R ----:----|----:----|----:----|----:----|----:----|----:----| S S S C F N T Q I D D D A S E C N V E A L L H A F I Q K S I T M L Q N V I * K Q F I L L F K N P Y R * * S I * L E S R C MboII | MboII | | AluI | | CviJI | | |MboII | | ||SetI | | ||| MboII | | ||| | MboII | | ||| | | MboII | | ||| | | | MboII | | ||| | | | | AjuI | | ||| | | | | MboII EcoRV | | ||| | | | | | MboII Ksp632I* \ \ \ \\\ \ \ \ \ \ \ \ GATATCCCAACATCAGCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTTCTATGAAGAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAGGGTTGTAGTCGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAGATACTTCTC / / // / / / / // / / / EcoRV | || | | | | || | MboII Ksp632I* | || | | | | || MboII | || | | | | |MboII | || | | | | AjuI | || | | | MboII | || | | MboII | || | MboII | || CviJI | || MboII | || AluI | |SetI | MboII MboII D I P T S A S S S S S S S S S S F Y E E I S Q H Q L L L L L L L L L L L S M K R Y P N I S F F F F F F F F F F F L * R E ----:----|----:----|----:----|----:----|----:----|----:----| S I G V D A E E E E E E E E E E K * S S L Y G L M L K K K K K K K K K K K R H L I D W C * S R R R R R R R R R R E I F L CviJI |AciI |BisI ||BlsI SetI |||NheI MaeIII MfeI | SetI |||TauI Tsp45I MboII | | Hpy188I ||||MaeI | MboII TspEI | | | AjuI |||||Cac8I | |TspDTI BbvII* | | | TspEI |||||| BmtI | ||AjuI | HphI TspDTI | | | | MnlI |||||| CviJI \ \\\ \ \ \ \ \ \ \ \ \\\\\\ \ AGTGTCACTAATGAACCAATTGTGTCTTCACCTACCTCTGAAATTACGAAGCCGCTAGCC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TCACAGTGATTACTTGGTTAACACAGAAGTGGATGGAGACTTTAATGCTTCGGCGATCGG / / / / / / / / / / / // //// /// | | Tsp45I | | | | | | | | |TspEI |||| ||CviJI | | MaeIII | | | | | | | | MnlI |||| ||NheI | TspDTI | | | | | | | Hpy188I |||| |MaeI | MboII | | | | | | AjuI |||| Cac8I AjuI | | | | | SetI |||AciI | | | | SetI |||BmtI | | | TspDTI ||BisI | | BbvII* |BlsI | | TspEI CviJI | | MfeI TauI | HphI MboII S V T N E P I V S S P T S E I T K P L A V S L M N Q L C L H L P L K L R S R * P C H * * T N C V F T Y L * N Y E A A S L ----:----|----:----|----:----|----:----|----:----|----:----| L T V L S G I T D E G V E S I V F G S A S H * * H V L Q T K V * R Q F * S A A L T D S I F W N H R * R G R F N R L R * G ApoI TspEI EcoRI | TspRI | | Hpy188I | | |Hin4I | | |Hin4I SfeI* BtgZI | | |HinfI | MnlI |SspI TaqI BccI | | || TaqI PleI \ \ \\ \ \ \ \ \\ \ \ TCTCCTACAGAACCGAATATTGTCGAAAAACCATCGCTTCCACTGAATTCAGAGTCGATA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGATGTCTTGGCTTATAACAGCTTTTTGGTAGCGAAGGTGACTTAAGTCTCAGCTAT // / / / / / / // / / |SfeI* | | TaqI | BccI | || | TaqI MnlI | BtgZI TspRI | || HinfI SspI | |Hpy188I | EcoRI | TspEI | ApoI Hin4I Hin4I S P T E P N I V E K P S L P L N S E S I L L Q N R I L S K N H R F H * I Q S R * S Y R T E Y C R K T I A S T E F R V D R ----:----|----:----|----:----|----:----|----:----|----:----| E G V S G F I T S F G D S G S F E S D I R E * L V S Y Q R F V M A E V S N L T S R R C F R I N D F F W R K W Q I * L R Y Hpy178III* |DdeI |Bpu10I ||MlyI ||PleI ||| CviJI TstI ||| | HinfI ApoI ||| | | Hpy178III* MnlI ||| | | |TstI TspEI ||| | | ||MnlI | Hin4I BseMII ||| | | |||Hin4I MlyI MboII | Hin4I |BspCNI ||| | | |||BsaXI \ \ \ \ \\ \\\ \ \ \\\\ GATTTGTTATCCTCATCTTCAAATTCTATCACAGAATATCCTGAGCCGACTCCTGACTTG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAACAATAGGAGTAGAAGTTTAAGATAGTGTCTTATAGGACTCGGCTGAGGACTGAAC / / / // / // //// / ///// PleI MboII | |MnlI | |BspCNI |||| | ||||Hpy178III* MlyI | Hin4I | BseMII |||| | |||MnlI | Hin4I TspEI |||| | ||BsaXI TstI ApoI |||| | |HinfI |||| | Hin4I |||| TstI |||CviJI ||Bpu10I ||DdeI |PleI Hpy178III* MlyI D L L S S S S N S I T E Y P E P T P D L I C Y P H L Q I L S Q N I L S R L L T W F V I L I F K F Y H R I S * A D S * L G ----:----|----:----|----:----|----:----|----:----|----:----| S K N D E D E F E I V S Y G S G V G S K L N T I R M K L N * * L I D Q A S E Q S I Q * G * R * I R D C F I R L R S R V Q MnlI BseRI |BsaXI TspEI | MseI || Hin4I Hpy188I \ \ \ \\ \ \ GAGGAGAAATTGTCCTCGTTAATAGTAGAACAATCAGAAAGCGAAATAACAACAGATAGA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCTTTAACAGGAGCAATTATCATCTTGTTAGTCTTTCGCTTTATTGTTGTCTATCT / / /// / | BseRI ||MnlI Hpy188I TspEI |BsaXI |Hin4I MseI E E K L S S L I V E Q S E S E I T T D R R R N C P R * * * N N Q K A K * Q Q I E G E I V L V N S R T I R K R N N N R * R ----:----|----:----|----:----|----:----|----:----|----:----| S S F N D E N I T S C D S L S I V V S L P P S I T R T L L L V I L F R F L L L Y L L F Q G R * Y Y F L * F A F Y C C I S Hin4II* | FatI SmlI | MboII AflII | TspDTI |MseI | BbvII* || TatI | |CviAII || |HphI | || NspI || |Csp6I | || NlaIII || ||RsaI | || | MboII || ||ScaI | || | TspDTI || ||| TfiI SetI | || | | MboII || ||| HinfI BceAI | || | | TspDTI \\ \\\ \ \ \ \\ \ \ \ GAAAGCGTTTCAAAACTCTTAAGTACTGAATCACCTTCGCTATCACACATGCCGTCTTCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCGCAAAGTTTTGAGAATTCATGACTTAGTGGAAGCGATAGTGTGTACGGCAGAAGT // /// // / / /// /// // || ||TatI |SetI | | ||| ||| |MboII || |Csp6I HinfI | | ||| ||| TspDTI || ScaI TfiI | | ||| ||MboII || RsaI | | ||| |BbvII* |AflII | | ||| |TspDTI |SmlI | | ||| |FatI |HphI | | ||| CviAII MseI | | ||NlaIII | | ||NspI | | |MboII | | TspDTI | Hin4II* BceAI E S V S K L L S T E S P S L S H M P S S K A F Q N S * V L N H L R Y H T C R L H K R F K T L K Y * I T F A I T H A V F I ----:----|----:----|----:----|----:----|----:----|----:----| S L T E F S K L V S D G E S D C M G D E L F R K L V R L Y Q I V K A I V C A T K F A N * F E * T S F * R R * * V H R R * MseI |HpaI |HindII |Hpy166II || MaeI ||MnlI | CviJI SfeI* \\\ \ \ \ TCTTCATCTTCATTATCTCTTTCCTCATCGTTAACAACTAGCCCTACTACAGCATTATCC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTAGAAGTAATAGAGAAAGGAGTAGCAATTGTTGATCGGGATGATGTCGTAATAGG // // / |MseI |CviJI SfeI* | MaeI Hpy166II HindII MnlI HpaI S S S S L S L S S S L T T S P T T A L S L H L H Y L F P H R * Q L A L L Q H Y P F I F I I S F L I V N N * P Y Y S I I H ----:----|----:----|----:----|----:----|----:----|----:----| D E D E N D R E E D N V V L G V V A N D M K M K M I E K R M T L L * G * * L M I R * R * * R K G * R * C S A R S C C * G Csp6I |RsaI || AciI TseI || | FnuDII* CviRI* || | | AciI |BisI || | | | MaeIII ||BlsI || | | | BstEII SfaNI |||CviJI \\ \ \ \ \ \ \\\\ ACAAGTACCGCGACTGCGGTTACCACCACACAAACAAACCCCACCAATGATGCAGCCAAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCATGGCGCTGACGCCAATGGTGGTGTGTTTGTTTGGGGTGGTTACTACGTCGGTTG // / / / / //// || FnuDII* AciI BstEII SfaNI |||CviJI || AciI MaeIII |||TseI |Csp6I ||BisI RsaI |BlsI CviRI* T S T A T A V T T T Q T N P T N D A A N Q V P R L R L P P H K Q T P P M M Q P T K Y R D C G Y H H T N K P H Q * C S Q H ----:----|----:----|----:----|----:----|----:----|----:----| V L V A V A T V V V C V F G V L S A A L W L Y R S Q P * W W V F L G W W H H L W C T G R S R N G G C L C V G G I I C G V Cfr10I XbaI |HpaII |MaeI || BseGI |Hpy178III* || | BsiI* BbvI || FokI || | | SfaNI PsiI \ \\ \ \\ \ \ \ \ ACATCTTTTCTAGACAACTCAAAACCGGCATCCACGAGAGAGATTTATAAGACAAAAATA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGAAAAGATCTGTTGAGTTTTGGCCGTAGGTGCTCTCTCTAAATATTCTGTTTTTAT / // / /// / / / / | |XbaI FokI ||Cfr10I | SfaNI PsiI TspRI | Hpy178III* |HpaII BsiI* | MaeI BseGI BbvI T S F L D N S K P A S T R E I Y K T K I H L F * T T Q N R H P R E R F I R Q K * I F S R Q L K T G I H E R D L * D K N N ----:----|----:----|----:----|----:----|----:----|----:----| V D K R S L E F G A D V L S I * L V F I C M K E L C S L V P M W S L S K Y S L F C R K * V V * F R C G R S L N I L C F Y SetI |CviRI* || BspMI || Hpy188I || |TfiI Eco57I || |HinfI TspRI TspEI Eco57MI || || SfaNI CviRI* \ \ \ \\ \\ \ \ ATCACTGAAGTCATTACAAAAATTGAGTATAGGAATATACCTGCATCAGATTCCAATGCA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGACTTCAGTAATGTTTTTAACTCATATCCTTATATGGACGTAGTCTAAGGTTACGT / / / / / / / Eco57MI SetI | | | | CviRI* Eco57I | | | SfaNI TspEI | | BspMI | | HinfI | | TfiI | Hpy188I CviRI* I T E V I T K I E Y R N I P A S D S N A S L K S L Q K L S I G I Y L H Q I P M Q H * S H Y K N * V * E Y T C I R F Q C R ----:----|----:----|----:----|----:----|----:----|----:----| I V S T M V F I S Y L F I G A D S E L A L * Q L * * L F Q T Y S Y V Q M L N W H D S F D N C F N L I P I Y R C * I G I C MaeIII HindII HgaI | MboII Hpy166II | XcmI CviJI | | MboII NmeAIII | AcyI | | MboII \ \ \ \ \ \ \ \ \ \ GAAGCCGAGCAGTATGTTACAACATCTTCTTCAATGTTGTTGACGCCCACAGACACTATG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGGCTCGTCATACAATGTTGTAGAAGAAGTTACAACAACTGCGGGTGTCTGTGATAC / / // / / / / // CviJI | |MaeIII NmeAIII | AcyI | |HgaI | MboII Hpy166II | MboII MboII HindII XcmI E A E Q Y V T T S S S M L L T P T D T M K P S S M L Q H L L Q C C * R P Q T L W S R A V C Y N I F F N V V D A H R H Y G ----:----|----:----|----:----|----:----|----:----|----:----| S A S C Y T V V D E E I N N V G V S V I L L R A T H * L M K K L T T S A W L C * F G L L I N C C R R * H Q Q R G C V S H BsmAI Esp3I Hpy188I |BinI* ||TspEI ||| MboI Hpy188I ||| | DpnI |TspEI ||| | |BstKTI || SfaNI \\\ \ \\ \\ \ GTTTCTTCGCCCGTCTCCGAAATTGATCCCATAGCATCAGAATTAGAGCGTATGGTTGAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGAAGCGGGCAGAGGCTTTAACTAGGGTATCGTAGTCTTAATCTCGCATACCAACTT / / / /// / / / / | | | ||| MboI | | SfaNI | | | ||DpnI | TspEI | | | |BstKTI Hpy188I | | | TspEI | | Esp3I | | BsmAI | BinI* Hpy188I V S S P V S E I D P I A S E L E R M V E F L R P S P K L I P * H Q N * S V W L K F F A R L R N * S H S I R I R A Y G * N ----:----|----:----|----:----|----:----|----:----|----:----| T E E G T E S I S G M A D S N S R I T S P K K A R R R F Q D W L M L I L A Y P Q N R R G D G F N I G Y C * F * L T H N F SfeI* | BseGI | | Hpy188I | | |MlyI | | |PleI BinI* | | |ApoI TspEI | | |TspEI |BspCNI | | || SfaNI ||BseMII SetI | | || |HgaI ||| MboI | BsmI | | || || HinfI ||| | DpnI | | FokI | | || || | DdeI ||| | |BstKTI \ \ \ \ \ \\ \\ \ \ \\\ \ \\ ACACCTACGCATTCTATTTCTATAGCATCCGAATTTGACTCAGTTGCGTCTAATTTGATC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGATGCGTAAGATAAAGATATCGTAGGCTTAAACTGAGTCAACGCAGATTAAACTAG / / / // / // / / / / /// / // / SetI BsmI FokI || | || | | | DdeI ||| | || MboI || | || | | HinfI ||| | |DpnI || | || | | HgaI ||| | BstKTI || | || | SfaNI ||| TspEI || | || TspEI ||BinI* || | || ApoI |BseMII || | |PleI BspCNI || | MlyI || Hpy188I |SfeI* BseGI T P T H S I S I A S E F D S V A S N L I H L R I L F L * H P N L T Q L R L I * S T Y A F Y F Y S I R I * L S C V * F D P ----:----|----:----|----:----|----:----|----:----|----:----| V G V C E I E I A D S N S E T A D L K I F V * A N * K * L M R I Q S L Q T * N S C R R M R N R Y C G F K V * N R R I Q D ApoI TspEI | FokI | | MboII | | |HindII | | |TspDTI | | |Hpy166II | | || BseGI | | || | MlyI | | || | PleI | | || | |BssKI | | || | |SecI* BseGI | | || | |EcoRII | Hpy188I | | || | || ScrFI | |MnlI | | || | || BseBI | ||TatI | | || | || | HinfI | |||Csp6I | | || | || | SfaNI | ||||RsaI | | || | || | |FokI | ||||SfaNI \ \ \\ \ \\ \ \\ \ \\\\\ CCAAATGAAGAAATTTTGTCAACATCAGCATCCCAGGACTCTATTTCCTCGCATCCGAGT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTACTTCTTTAAAACAGTTGTAGTCGTAGGGTCCTGAGATAAAGGAGCGTAGGCTCA / /// / // /// /// / // / | ||| | || ||| ||FokI BseGI || TspDTI | ||| | || ||| |SfaNI || RsaI | ||| | || ||| HinfI |MnlI | ||| | || ||EcoRII Hpy188I | ||| | || ||BssKI | ||| | || |SecI* | ||| | || BseBI | ||| | || ScrFI | ||| | |PleI | ||| | MlyI | ||| BseGI | ||Hpy166II | ||HindII | |FokI | TspDTI | MboII TspEI ApoI P N E E I L S T S A S Q D S I S S H P S Q M K K F C Q H Q H P R T L F P R I R V K * R N F V N I S I P G L Y F L A S E Y ----:----|----:----|----:----|----:----|----:----|----:----| G F S S I K D V D A D W S E I E E C G L G L H L F K T L M L M G P S * K R A D S W I F F N Q * C * C G L V R N G R M R T SetI TaqI Hpy188I | CviJI | MboII |TfiI | | BsrI | |MaeIII TspDTI |HinfI | | MnlI | |Tsp4CI* \ \\ \ \ \ \ \\ ACATTTTCTGATTCATCTATAACCTCTGGCTTCCAGTCAATAGAAGTATCGACTGTAACT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAAAAGACTAAGTAGATATTGGAGACCGAAGGTCAGTTATCTTCATAGCTGACATTGA // / / / / / // /// / || | | HinfI SetI | |MnlI ||| MaeIII || | | TfiI | BsrI ||Tsp4CI* || | Hpy188I CviJI |MboII || SfaNI TaqI |TatI Csp6I T F S D S S I T S G F Q S I E V S T V T H F L I H L * P L A S S Q * K Y R L * L I F * F I Y N L W L P V N R S I D C N F ----:----|----:----|----:----|----:----|----:----|----:----| V N E S E D I V E P K W D I S T D V T V Y M K Q N M * L R Q S G T L L L I S Q L C K R I * R Y G R A E L * Y F Y R S Y S DdeI TspDTI | Hin4II* BspCNI Hpy188I | |Hpy188I |BseMII |TfiI | ||TfiI || ApoI |HinfI | ||HinfI || TspEI \\ \ \\\ \\ \ TCTTCTGTTCTTGCTTCTGAATCAATCCCTTCAATCTCAGATTCCACTTTTTCTAAATTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGACAAGAACGAAGACTTAGTTAGGGAAGTTAGAGTCTAAGGTGAAAAAGATTTAAA / / /// / // / | HinfI ||| | |BseMII TspEI | TfiI ||| | BspCNI ApoI Hpy188I ||| | TspDTI ||| HinfI ||| TfiI ||DdeI |Hpy188I Hin4II* S S V L A S E S I P S I S D S T F S K F L L F L L L N Q S L Q S Q I P L F L N F F C S C F * I N P F N L R F H F F * I S ----:----|----:----|----:----|----:----|----:----|----:----| E E T R A E S D I G E I E S E V K E L N K K Q E Q K Q I L G K L R L N W K K * I R R N K S R F * D R * D * I G S K R F K AluI MaeI CviJI | AluI TspDTI | SetI | CviJI |Hpy188I | |Esp3I | | SetI ||BccI SetI | |BsmAI | | | BceAI \\\ \ \ \\ \ \ \ \ CATTCCATCTCTGAACCTGTTTCATCAGCTATTGTGGAGACGGCAACTAGCTCATTCTCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAGGTAGAGACTTGGACAAAGTAGTCGATAACACCTCTGCCGTTGATCGAGTAAGAGT / / / / / / /// / | | BccI | CviJI BsmAI ||CviJI BceAI | | SetI | AluI Esp3I ||AluI | Hpy188I SetI |MaeI TspDTI SetI H S I S E P V S S A I V E T A T S S F S I P S L N L F H Q L L W R R Q L A H S Q F H L * T C F I S Y C G D G N * L I L K ----:----|----:----|----:----|----:----|----:----|----:----| * E M E S G T E D A I T S V A V L E N E E N W R Q V Q K M L * Q P S P L * S M R M G D R F R N * * S N H L R C S A * E * SecI* TaqI |GsuI BbvII* |Eco57MI |Hpy178III* || TfiI || MboII || HinfI || | TspEI MnlI || | Hpy188I BsrI \\ \ \ \ \\ \ \ \ AAAACAGAAACGAAGACTTCGAGAGTAATTGCTTTCTCTACCGAGGATTCAGAACGCTCC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGTCTTTGCTTCTGAAGCTCTCATTAACGAAAGAGATGGCTCCTAAGTCTTGCGAGG /// / / / / // / ||BbvII* | MnlI | | || TspRI ||MboII TspEI | | || BsrI |Hpy178III* | | |Hpy188I TaqI | | HinfI | | TfiI | SecI* Eco57MI GsuI K T E T K T S R V I A F S T E D S E R S K Q K R R L R E * L L S L P R I Q N A P N R N E D F E S N C F L Y R G F R T L Q ----:----|----:----|----:----|----:----|----:----|----:----| F V S V F V E L T I A K E V S S E S R E L F L F S S K S L L Q K R * R P N L V S F C F R L S R S Y N S E R G L I * F A G TspRI BsrI BstXI NlaIV | OliI | CviJI | SpeI TspRI TspEI Hpy188I | MslI | | TspEI | |MaeI \ \ \ \ \ \ \ \ \ \\ AGTGCCTTGATTGATAATTCGGAATACACCAGTGTGTTGGCTGACAATTTGGAACCCACT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TCACGGAACTAACTATTAAGCCTTATGTGGTCACACAACCGACTGTTAAACCTTGGGTGA // / // / / / || | |BstXI CviJI | NlaIV || | MslI TspEI || | OliI || TspRI || BsrI |Hpy188I TspEI S A L I D N S E Y T S V L A D N L E P T V P * L I I R N T P V C W L T I W N P L C L D * * F G I H Q C V G * Q F G T H * ----:----|----:----|----:----|----:----|----:----|----:----| L A K I S L E S Y V L T N A S L K S G V W H R S Q Y N P I C W H T P Q C N P V W T G Q N I I R F V G T H Q S V I Q F G S Hpy188I Tsp4CI* | NlaIV | Hpy188I | | SpeI | | NlaIV CviJI | | |MaeI | | | SpeI XcmI | TspEI | | || XcmI CviJI | | | |MaeI \ \ \ \ \ \\ \ \ \ \ \ \\ AGTGTTTTGGCTGACAATTCGGAACCCACTAGTGTTTTGGCTGACAGTTCGGAACCCACT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TCACAAAACCGACTGTTAAGCCTTGGGTGATCACAAAACCGACTGTCAAGCCTTGGGTGA // / // / // / / / / |XcmI CviJI || NlaIV |XcmI | | | NlaIV |SpeI |Hpy188I |SpeI | | Hpy188I MaeI TspEI MaeI | Tsp4CI* CviJI S V L A D N S E P T S V L A D S S E P T V F W L T I R N P L V F W L T V R N P L C F G * Q F G T H * C F G * Q F G T H * ----:----|----:----|----:----|----:----|----:----|----:----| L T K A S L E S G V L T K A S L E S G V * H K P Q C N P V W * H K P Q C N P V W T N Q S V I R F G S T N Q S V T R F G S TspRI | HphI | |TatI | |Bsp1407I Hin4I CspCI | ||Csp6I | DdeI | Hin4I SfaNI | |||RsaI | |SetI MboII | |Hpy188I \ \ \\\\ \ \\ \ \ \\ AGTGTTTTCACTGATGCTGTACAATCACCTAAGACGAGTGTTGGTCAATCTTCCCTATCA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TCACAAAAGTGACTACGACATGTTAGTGGATTCTGCTCACAACCAGTTAGAAGGGATAGT // // / /// / / / / / / || |SfaNI | ||| SetI DdeI MboII | | Hpy188I || TspRI | ||Bsp1407I | Hin4I |SpeI | ||Hin4I CspCI MaeI | ||TatI | |Csp6I | RsaI HphI S V F T D A V Q S P K T S V G Q S S L S V F S L M L Y N H L R R V L V N L P Y Q C F H * C C T I T * D E C W S I F P I R ----:----|----:----|----:----|----:----|----:----|----:----| L T K V S A T C D G L V L T P * D E R D * H K * Q H Q V I V * S S H Q D I K G I T N E S I S Y L * R L R T N T L R G * * CspCI | BslFI | | MboI | | | DpnI | | | SfaNI TfiI Hin4II* | | | |BstKTI HinfI | SspI | | | ||BarI \ \ \ \ \ \ \\\ GAATCCACAAATATTGAAGGGACTTCTATGGCATCTATGATCTTTAGTAGTAGTGGTGCT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGGTGTTTATAACTTCCCTGAAGATACCGTAGATACTAGAAATCATCATCACCACGA / / / / / // / / | | SspI CspCI | || | SfaNI | Hin4II* | || MboI HinfI | |DpnI TfiI | BstKTI BslFI BarI E S T N I E G T S M A S M I F S S S G A N P Q I L K G L L W H L * S L V V V V L I H K Y * R D F Y G I Y D L * * * W C F ----:----|----:----|----:----|----:----|----:----|----:----| S D V F I S P V E I A D I I K L L L P A L I W L Y Q L S K * P M * S R * Y Y H H F G C I N F P S R H C R H D K T T T T S Hin6I |GlaI Hin4I Hin6I ||HhaI BsaXI |GlaI |||HaeII | HgaI ||HhaI MfeI |||| BarI | SecI* ||FnuDII* TspEI |||| | Hpy188I TspGWI | DsaI* ||| MwoI \ \\\\ \ \ \ \ \ \\\ \ TCAATTGGCGCTCTGTCTGATATAGGCAAGGGAACTTTATCCGTGGAGAGCGCGTCAAGC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTAACCGCGAGACAGACTATATCCGTTCCCTTGAAATAGGCACCTCTCGCGCAGTTCG ///// / / / / // //// ||||Hin6I Hpy188I | | BsaXI || |||MwoI |||BarI | Hin4I || ||FnuDII* |||GlaI TspGWI || ||Hin6I ||HhaI || |GlaI |HaeII || HhaI TspEI |HgaI MfeI DsaI* SecI* S I G A L S D I G K G T L S V E S A S S Q L A L C L I * A R E L Y P W R A R Q A N W R S V * Y R Q G N F I R G E R V K H ----:----|----:----|----:----|----:----|----:----|----:----| E I P A R D S I P L P V K D T S L A D L K L Q R E T Q Y L C P F K I R P S R T L * N A S Q R I Y A L S S * G H L A R * A Tsp4CI* | SfaNI BssKI | | AluI EcoRII | | CviJI |BsiYI* | | BsaXI ||ScrFI | | |DdeI ||BseBI | | |EspI* |||BspCNI | | ||SetI ||||BseMII | | ||Hin4I ||||| SetI | | ||| CviJI ||||| MaeIII TsoI BccI CviJI \ \ \\\ \ \\\\\ \ \ \ \ ACAGTAGCTCAGCCGATGCCAGGTGTAACCACAACAGCACCATCTTTTGTAAGTAGCCCT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCATCGAGTCGGCTACGGTCCACATTGGTGTTGTCGTGGTAGAAAACATTCATCGGGA / // / / // / /// / / / / / | || | | || | ||| | MaeIII TsoI BccI CviJI | || | | || | ||| EcoRII | || | | || | ||| BssKI | || | | || | ||BseBI | || | | || | ||ScrFI | || | | || | |BseMII | || | | || | |SetI | || | | || | BspCNI | || | | || BsiYI* | || | | |CviJI | || | | EspI* | || | | DdeI | || | SfaNI | || CviJI | || AluI | |SetI | BsaXI | Hin4I Tsp4CI* T V A Q P M P G V T T T A P S F V S S P Q * L S R C Q V * P Q Q H H L L * V A L S S S A D A R C N H N S T I F C K * P S ----:----|----:----|----:----|----:----|----:----|----:----| V T A * G I G P T V V V A G D K T L L G C L L E A S A L H L W L L V M K Q L Y G C Y S L R H W T Y G C C C W R K Y T A R CviRI* | EcoT22I | | Hpy178III* | | | SfaNI MaeI | | | | TatI |SfaNI | | | | Bsp1407I || MfeI | | | | |Csp6I MnlI || TspEI | | | | ||RsaI \ \\ \ \ \ \ \ \\\ CACAAAATATCTGCTAGTTCAATTGATGCATCAGGATTTGTACAGAAAGAAATAATGATA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTTTTATAGACGATCAAGTTAACTACGTAGTCCTAAACATGTCTTTCTTTATTACTAT / / / / / / / /// MnlI | | | | | | ||Bsp1407I | | | | | | ||TatI | | | | | | |Csp6I | | | | | | SfaNI | | | | | | RsaI | | | | | Hpy178III* | | | | CviRI* | | | EcoT22I | | TspEI | | MfeI | SfaNI MaeI H K I S A S S I D A S G F V Q K E I M I T K Y L L V Q L M H Q D L Y R K K * * * Q N I C * F N * C I R I C T E R N N D R ----:----|----:----|----:----|----:----|----:----|----:----| * L I D A L E I S A D P N T C F S I I I E C F I Q * N L Q H M L I Q V S L F L S V F Y R S T * N I C * S K Y L F F Y H Y TatI |Csp6I ||RsaI ||| Tsp4CI* TfiI Csp6I Eco57I ||| | TspDTI HinfI Hpy188I |RsaI Eco57MI \\\ \ \ \ \ \\ \ GAAGTACAGTCATCAAAAGATTCATCTGAAGCGTTTGGGGTACGCCACAAAATCAGCGAA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCATGTCAGTAGTTTTCTAAGTAGACTTCGCAAACCCCATGCGGTGTTTTAGTCGCTT /// / / / // / ||| TspDTI | Hpy188I || Eco57MI ||Tsp4CI* HinfI || Eco57I ||TatI TfiI |Csp6I |Csp6I RsaI RsaI E V Q S S K D S S E A F G V R H K I S E K Y S H Q K I H L K R L G Y A T K S A K S T V I K R F I * S V W G T P Q N Q R K ----:----|----:----|----:----|----:----|----:----|----:----| S T C D D F S E D S A N P T R W L I L S L L V T M L L N M Q L T Q P V G C F * R F Y L * * F I * R F R K P Y A V F D A F Hpy99I | CviRI* | | Cac8I | | | TspGWI | | | | Csp6I | | | | |RsaI | | | | ||BcgI Hpy178III* | | | | ||SfaNI |BcgI BsmI | | | | ||| Tsp4CI* \\ \ \ \ \ \ \\\ \ AATGTAAATACTCCTGTTTCCCGAATGCTTACGACGGAAATGCAGGCATCTGGTACGGTA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TTACATTTATGAGGACAAAGGGCTTACGAATGCTGCCTTTACGTCCGTAGACCATGCCAT / / / / / / / //// / | | | Hpy99I | | | |||| SfaNI | | BsmI | | | |||Tsp4CI* | Hpy178III* | | | ||Csp6I BcgI | | | |RsaI | | | BcgI | | TspGWI | Cac8I CviRI* N V N T P V S R M L T T E M Q A S G T V M * I L L F P E C L R R K C R H L V R * C K Y S C F P N A Y D G N A G I W Y G R ----:----|----:----|----:----|----:----|----:----|----:----| F T F V G T E R I S V V S I C A D P V T F H L Y E Q K G F A * S P F A P M Q Y P I Y I S R N G S H K R R F H L C R T R Y AcyI MaeII |ZraI || SetI || TaiI MseI || AatII | MaeII || BbvII* | | SetI || | BsmAI | | TaiI || | Esp3I | | | MboI || | |MboII | | | | DpnI MaeIII || | || MaeI | | | | |BstKTI \ \\ \ \\ \ \ \ \ \ \\ GATGTTACCGAAGACGTCTCTCTATCTAGTGAAGTTATTTCAGCACTTAACGTGGAGATC 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAATGGCTTCTGCAGAGAGATAGATCACTTCAATAAAGTCGTGAATTGCACCTCTAG / / // / / / / / // / | | || | | MaeI | | || MboI | | || | Esp3I | | |DpnI | | || | BsmAI | | BstKTI | | || BbvII* | MaeII | | || MboII MseI | | |MaeII TaiI | | |AcyI SetI | | ZraI | AatII | TaiI | SetI MaeIII D V T E D V S L S S E V I S A L N V E I M L P K T S L Y L V K L F Q H L T W R S C Y R R R L S I * * S Y F S T * R G D H ----:----|----:----|----:----|----:----|----:----|----:----| S T V S S T E R D L S T I E A S L T S I L H * R L R R E I * H L * K L V * R P S I N G F V D R * R T F N N * C K V H L D BsrI | AlfI | AlfI | | AsuI* MfeI | | |CviJI MnlI | | |HaeIII TspEI SetI | | |BmgT120I | TseI | BbvI | | ||NlaIV | CviRI* | |AlfI | | ||TspRI | |BisI | |AlfI | | ||| AciI | ||BlsI | || TspEI \ \ \\\ \ \ \\\ \ \\ \ ACTTCTTTGCCTAATCCAGTGGCCCCTCCGCAAACAATTGCAGCACCTTTGAATAATAAT 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGAAACGGATTAGGTCACCGGGGAGGCGTTTGTTAACGTCGTGGAAACTTATTATTA / / /// / / ////// / / | AlfI ||AsuI* | MnlI |||||SetI AlfI BbvI | AlfI || AciI ||||TseI AlfI TspRI |BmgT120I |||BisI BsrI |NlaIV ||BlsI HaeIII |CviRI* CviJI TspEI MfeI T S L P N P V A P P Q T I A A P L N N N L L C L I Q W P L R K Q L Q H L * I I I F F A * S S G P S A N N C S T F E * * F ----:----|----:----|----:----|----:----|----:----|----:----| V E K G L G T A G G C V I A A G K F L L * K K A * D L P G E A F L Q L V K S Y Y S R Q R I W H G R R L C N C C R Q I I I NlaIV | BcgI | |Tsp4CI* | || Hpy166II | || | TspDTI | || | | Cac8I TaqI HindII | || | | | CviJI AsuII BcgI Hpy166II CviRI* | || | | | HaeIII \ \ \ \ \ \\ \ \ \ \ TCGAATACAAACATTGTCAACGATGATAATGCAGTAGCAGGAACCGTAAACTACGCTGGC 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTATGTTTGTAACAGTTGCTACTATTACGTCATCGTCCTTGGCATTTGATGCGACCG / / / / / / / / / / / | | BcgI Hpy166II CviRI* | | | TspDTI | HaeIII | AsuII HindII | | Hpy166II | CviJI | TaqI | Tsp4CI* Cac8I TspEI NlaIV BcgI S N T N I V N D D N A V A G T V N Y A G R I Q T L S T M I M Q * Q E P * T T L A E Y K H C Q R * * C S S R N R K L R W P ----:----|----:----|----:----|----:----|----:----|----:----| E F V F M T L S S L A T A P V T F * A P N S Y L C Q * R H Y H L L L F R L S R Q R I C V N D V I I I C Y C S G Y V V S A FatI BspHI |CviAII |Hpy178III* || NlaIII || | TspEI || | Hin4II* \\ \ \ CTTCATGACGAATTGTGA 3190 ----:----|----:--- GAAGTACTGCTTAACACT / // / / | || | TspEI | || Hin4II* | |BspHI | |FatI | Hpy178III* | CviAII NlaIII L H D E L * F M T N C X S * R I V X ----:----|----:--- R * S S N H G E H R I T K M V F Q S # Enzymes that cut Frequency Isoschizomers AatII 2 AciI 5 BspACI,SsiI AclI 2 Psp1406I AcyI 3 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 2 DraI AjuI 2 AlfI 2 AluI 10 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 14 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 1 MlsI,MluNI,MscI,Msp20I BarI 2 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 4 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 1 BpuEI BceAI 3 BcgI 3 BdaI 2 BetI* 1 BsaWI BinI* 3 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 2 BmtI 2 BspOI Bpu10I 1 BsaBI 2 Bse8I,BseJI BsaXI 3 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 7 BstF5I,BtsCI BseMII 4 BseRI 1 BseSI 2 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 2 BsrGI,BstAUI BspCNI 4 BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 7 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 7 BstXI 2 BtgZI 1 Cac8I 6 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 10 CviQI,RsaNI CspCI 1 CviAII 7 CviJI 31 CviKI-1 CviRI* 15 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 7 MalI DsaI* 2 BtgI,BstDSI Eco47III 1 Aor51HI,AfeI Eco57I 4 AcuI Eco57MI 6 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 4 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 3 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 7 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 7 GlaI 5 GsuI 2 BpmI HaeII 3 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 5 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 5 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 7 HpyAV Hin6I 5 HinP1I,HspAI HindII 5 HincII HindIII 2 HinfI 19 HpaI 2 KspAI HpaII 2 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 24 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 15 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 7 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 26 MfeI 5 MunI MlyI 4 SchI MmeI 1 MnlI 18 MseI 13 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NheI 2 AsuNHI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 1 MspA1I NspI 2 BstNSI,XceI OliI 1 AleI PleI 4 PpsI PsiI 2 AanI PstI 1 PvuII 1 RsaI 10 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 31 SfaNI 16 LweI SfeI* 6 BstSFI,SfcI,BfmI SmlI 2 SmoI SpeI 3 BcuI,AhlI SspI 3 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 10 TatI 6 TauI 1 TfiI 15 PfeI TseI 4 ApeKI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 16 TspEI 39 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 7 TscAI TstI 1 VspI 2 PshBI,AseI XbaI 2 XcmI 3 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AccI AflIII AgeI AloI ApaI AscI Asp718I AvaI AvaII AvrII BaeI BamHI BbvCI BciVI BclI BfiI BglI BglII BmeT110I BplI BsaAI BsePI BseYI Bsp120I BspLU11I* BspMII* BsrBI BssNAI Bst1107I BstAPI BstZ17I BtrI BtsI CauII* Cfr9I DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I EcoICRI EcoNI EcoP15I EgeI EheI FseI FspAI GsaI HgiCI* HgiJII* KasI KpnI MauBI McrI* MluI MroNI MstI* NaeI NarI NdeI NgoMIV NotI NruI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TspMI Tth111I XhoI XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769