Restriction Map of RRP43/YCR035C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

RRP43/YCR035C on chromosome III from coordinates 193018 to 191834.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Csp6I |RsaI TaqII || MaeII | SetI || | SetI | | BplI CviJI || | TaiI TspEI | | BplI \ \\ \ \ \ \ \ \ ATGGCTGAAAGTACCACGTTAGAAACTATTGAGATACACCCAATTACTTTTCCACCTGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGACTTTCATGGTGCAATCTTTGATAACTCTATGTGGGTTAATGAAAAGGTGGACTT / // / / / / / / / CviJI || | MaeII TspEI | | BplI Eco57MI || TaiI | | BplI GsuI || SetI | SetI |Csp6I TaqII RsaI M A E S T T L E T I E I H P I T F P P E W L K V P R * K L L R Y T Q L L F H L K G * K Y H V R N Y * D T P N Y F S T * S ----:----|----:----|----:----|----:----|----:----|----:----| X A S L V V N S V I S I C G I V K G G S X P Q F Y W T L F * Q S V G L * K E V Q H S F T G R * F S N L Y V W N S K W R F StyI AvrII Eco57I SecI* Eco57MI |MaeI GsuI | Hpy178III* BplI || TfiI CviJI Eco57MI | | TspEI BplI || HinfI HaeIII \ \ \ \ \ \\ \ \ GTTCTTGCGAGAATATCTCCAGAATTGTCTTTACAAAGACACTTATCCCTAGGAATCAGG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGAACGCTCTTATAGAGGTCTTAACAGAAATGTTTCTGTGAATAGGGATCCTTAGTCC / / // // / / | | |BplI || | HaeIII | | |BplI || | CviJI | | TspEI || HinfI | Hpy178III* || TfiI Eco57MI |SecI* Eco57I |AvrII |StyI MaeI V L A R I S P E L S L Q R H L S L G I R F L R E Y L Q N C L Y K D T Y P * E S G S C E N I S R I V F T K T L I P R N Q A ----:----|----:----|----:----|----:----|----:----|----:----| T R A L I D G S N D K C L C K D R P I L L E Q S F I E L I T K V F V S I G L F * N K R S Y R W F Q R * L S V * G * S D P FatI |CviAII MboII || NlaIII ApoI |TspDTI SfaNI || | DdeI TspEI || SfeI* FnuDII* \\ \ \ \ \\ \ \ CCATGTCTAAGAAAATATGAAGAATTTAGAGATGTTGCTATAGAAAATAATACTTTATCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGTACAGATTCTTTTATACTTCTTAAATCTCTACAACGATATCTTTTATTATGAAATAGC / // / / / / / | |FatI DdeI | TspDTI SfeI* FnuDII* | CviAII | MboII NlaIII TspEI ApoI P C L R K Y E E F R D V A I E N N T L S H V * E N M K N L E M L L * K I I L Y R M S K K I * R I * R C C Y R K * Y F I A ----:----|----:----|----:----|----:----|----:----|----:----| G H R L F Y S S N L S T A I S F L V K D A M D L F I H L I * L H Q * L F Y Y K I W T * S F I F F K S I N S Y F I I S * R AciI BseGI FokI CviJI \ \ \ \ CGTTATGCGGATGCTGGTAATATAGACACTAAAAACAACATTTTAGGCTCAAATGTTTTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCAATACGCCTACGACCATTATATCTGTGATTTTTGTTGTAAAATCCGAGTTTACAAAAC / / / / / | | BseGI FokI CviJI | AciI SfaNI R Y A D A G N I D T K N N I L G S N V L V M R M L V I * T L K T T F * A Q M F * L C G C W * Y R H * K Q H F R L K C F E ----:----|----:----|----:----|----:----|----:----|----:----| R * A S A P L I S V L F L M K P E F T K A N H P H Q Y Y L C * F C C K L S L H K T I R I S T I Y V S F V V N * A * I N Q MaeI | Hin6I | |GlaI \ \\ AAAAGTGGGAAAACCATAGTCATAACTTCTATTACGGGTGGAATAATAGAAGAAACTAGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCACCCTTTTGGTATCAGTATTGAAGATAATGCCCACCTTATTATCTTCTTTGATCG /// ||MboII ||GlaI |HhaI HaeII MaeI K S G K T I V I T S I T G G I I E E T S K V G K P * S * L L L R V E * * K K L A K W E N H S H N F Y Y G W N N R R N * R ----:----|----:----|----:----|----:----|----:----|----:----| F L P F V M T M V E I V P P I I S S V L S F H S F W L * L K * * P H F L L L F * F T P F G Y D Y S R N R T S Y Y F F S A TspEI HhaI | HphI MboII | | TaqI |AciI | | AsuII |BisI | | | MboII |HaeII | | | | MaeIII ||BlsI | | | | Tsp45I |||TauI MnlI | | | | | MnlI |||FnuDII* BseGI | | | | | | MnlI |||| MseI |AloI FokI | | | | | | | AloI \\\\ \ \\ \ \ \ \ \ \ \ \ \ GCCGCGATTAAAGATTTGGATGATTTCGGTGAGGAAGAATTGTTCGAAGTGACCAAAGAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCGCTAATTTCTAAACCTACTAAAGCCACTCCTTCTTAACAAGCTTCACTGGTTTCTC //// / / // / / / // / // |||| MseI | |MnlI | | | || | |Tsp45I |||FnuDII* | BseGI | | | || | |MaeIII |||AciI AloI | | | || | |MnlI ||BisI | | | || | AloI |BlsI | | | || MnlI Hin6I | | | |AsuII TauI | | | |TaqI | | | MboII | | TspEI | HphI FokI A A I K D L D D F G E E E L F E V T K E P R L K I W M I S V R K N C S K * P K R R D * R F G * F R * G R I V R S D Q R G ----:----|----:----|----:----|----:----|----:----|----:----| A A I L S K S S K P S S S N N S T V L S R R S * L N P H N R H P L I T R L S W L G R N F I Q I I E T L F F Q E F H G F L TspEI | BseRI | CviRI* | | TspEI | | | MwoI BetI* | | | BstAPI |HpaII MnlI SetI \ \ \ \ \\ \ \ GAGGACATAATTGCAAATTATGCTTCTGTCTATCCGGTGGTGGAAGTTGAAAGAGGTAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTGTATTAACGTTTAATACGAAGACAGATAGGCCACCACCTTCAACTTTCTCCATCT /// / / // / / ||| | TspEI |BetI* MnlI SetI ||| BstAPI HpaII ||| MwoI ||CviRI* |TspEI BseRI E D I I A N Y A S V Y P V V E V E R G R R T * L Q I M L L S I R W W K L K E V E G H N C K L C F C L S G G G S * K R * S ----:----|----:----|----:----|----:----|----:----|----:----| S S M I A F * A E T * G T T S T S L P L P P C L Q L N H K Q R D P P P L Q F L Y L V Y N C I I S R D I R H H F N F S T S Hin6I |GlaI ||HhaI |||HaeII ||||Cac8I MboII TfiI ||||| CviRI* |TspDTI HinfI CviRI* \\\\\ \ \\ \ \ GTGGGCGCTTGCACCGATGAAGAAATGACTATATCACAAAAACTACACGATTCCATATTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CACCCGCGAACGTGGCTACTTCTTTACTGATATAGTGTTTTTGATGTGCTAAGGTATAAC //// / / / / / |||| | CviRI* TspDTI HinfI CviRI* |||| Cac8I MboII TfiI |||Hin6I ||GlaI |HhaI HaeII V G A C T D E E M T I S Q K L H D S I L W A L A P M K K * L Y H K N Y T I P Y C G R L H R * R N D Y I T K T T R F H I A ----:----|----:----|----:----|----:----|----:----|----:----| T P A Q V S S S I V I D C F S C S E M N L P R K C R H L F S * I V F V V R N W I H A S A G I F F H S Y * L F * V I G Y Q AluI Hin4II* CviJI MaeI |CviJI SetI | SetI \ \\ \ \ \ CACTCTAGGATATTGCCTAAAAAAGCCTTGAAGGTAAAAGCTGGTGTTCGTAGTGCGAAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTGAGATCCTATAACGGATTTTTTCGGAACTTCCATTTTCGACCACAAGCATCACGCTTA / / / / / / MaeI | CviJI SetI | CviJI Hin4II* | AluI SetI H S R I L P K K A L K V K A G V R S A N T L G Y C L K K P * R * K L V F V V R M L * D I A * K S L E G K S W C S * C E * ----:----|----:----|----:----|----:----|----:----|----:----| C E L I N G L F A K F T F A P T R L A F A S * S I A * F L R S P L L Q H E Y H S V R P Y Q R F F G Q L Y F S T N T T R I TspGWI |Tsp4CI* ||Csp6I ||BbvII* |||RsaI ||||MaeII ||||| SetI ||||| TaiI Hpy178III* ||||| MboII | TspEI TspDTI ||||| |TspDTI | |BciVI | MboII \\\\\ \\ \ \\ \ \ GAAGACGGTACGTTTTCCGTCTTGTATCCCGATGAATTAGAAGATGATACGCTGAATGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTGCCATGCAAAAGGCAGAACATAGGGCTACTTAATCTTCTACTATGCGACTTACTT / / // / / / / / / | | || TspDTI | | TspEI | MboII | | || BbvII* | BciVI TspDTI | | || MboII Hpy178III* | | || MaeII | | |Csp6I | | RsaI | | TaiI | | SetI | Tsp4CI* TspGWI E D G T F S V L Y P D E L E D D T L N E K T V R F P S C I P M N * K M I R * M K R R Y V F R L V S R * I R R * Y A E * N ----:----|----:----|----:----|----:----|----:----|----:----| S S P V N E T K Y G S S N S S S V S F S H L R Y T K R R T D R H I L L H Y A S H F V T R K G D Q I G I F * F I I R Q I F TspDTI | MaeII SmlI SetI | | SetI Hpy178III* | TspDTI | | TaiI TspEI | HinfI \ \ \ \ \ \ \ \ ACAAACCTGAAAATGAAAAGAAAATGGTCATACGTTTTGTATGCGAAAATTGTAGTCTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTGGACTTTTACTTTTCTTTTACCAGTATGCAAAACATACGCTTTTAACATCAGAAC / / / / / / / SetI TspDTI | | MaeII TspEI Hpy178III* | TaiI | SetI TspDTI T N L K M K R K W S Y V L Y A K I V V L Q T * K * K E N G H T F C M R K L * S * K P E N E K K M V I R F V C E N C S L E ----:----|----:----|----:----|----:----|----:----|----:----| V F R F I F L F H D Y T K Y A F I T T K F L G S F S F F I T M R K T H S F Q L R C V Q F H F S F P * V N Q I R F N Y D Q PleI |MlyI |MboII |BbvII* ||MmeI ||AsuI* ||AvaII |||BmgT120I ||||BsrI ApoI ||||TspRI Bce83I* TspEI Csp6I |||||BsrI | TaqI EcoRI |RsaI \\\\\\ \ \ \ \\ AGTCGCACTGGTCCAGTCTTCGATTTGTGTTGGAATTCTTTGATGTACGCTTTACAGAGC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGCGTGACCAGGTCAGAAGCTAAACACAACCTTAAGAAACTACATGCGAAATGTCTCG / / ////// / / / // | | |||||| | TaqI EcoRI |Csp6I | | |||||| Bce83I* TspEI RsaI | | |||||BbvII* ApoI | | |||||AvaII | | |||||AsuI* | | ||||BmgT120I | | |||BsrI | | ||BsrI | | |PleI | | |MlyI | | MboII | | MmeI | HinfI | TspRI SmlI S R T G P V F D L C W N S L M Y A L Q S V A L V Q S S I C V G I L * C T L Y R A S H W S S L R F V L E F F D V R F T E R ----:----|----:----|----:----|----:----|----:----|----:----| L R V P G T K S K H Q F E K I Y A K C L S D C Q D L R R N T N S N K S T R K V S T A S T W D E I Q T P I R Q H V S * L A MaeIII | MaeI Hin4I Hpy188I | |SetI | HgaI Cac8I | MseI Hin4I MnlI \ \\ \ \ \ \ \ \ \ GTAAAGTTACCTAGAGCATTTATAGATGAGCGTGCGTCCGATTTAAGAATGACTATAAGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CATTTCAATGGATCTCGTAAATATCTACTCGCACGCAGGCTAAATTCTTACTGATATTCT / / // / / / // / | | |Hin4I | Cac8I | |Hin4I MnlI | | MaeI HgaI | MseI | MaeIII Hpy188I SetI V K L P R A F I D E R A S D L R M T I R * S Y L E H L * M S V R P I * E * L * E K V T * S I Y R * A C V R F K N D Y K N ----:----|----:----|----:----|----:----|----:----|----:----| T F N G L A N I S S R A D S K L I V I L R L T V * L M * L H A H T R N L F S * L Y L * R S C K Y I L T R G I * S H S Y S MaeII | SetI | TaiI TspDTI MboII | | TspEI | DdeI \ \ \ \ \ \ ACAAGAGGAAGAAGTGCCACCATAAGAGAAACGTATGAAATTATTTGCGACCAAACTAAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTCCTTCTTCACGGTGGTATTCTCTTTGCATACTTTAATAAACGCTGGTTTGATTC / / / / / / MboII | MaeII TspEI TspDTI DdeI TaiI SetI T R G R S A T I R E T Y E I I C D Q T K Q E E E V P P * E K R M K L F A T K L S K R K K C H H K R N V * N Y L R P N * V ----:----|----:----|----:----|----:----|----:----|----:----| V L P L L A V M L S V Y S I I Q S W V L F L L F F H W W L L F T H F * K R G F * C S S S T G G Y S F R I F N N A V L S L Csp6I |RsaI || Tsp4CI* SspI || | MseI | CviRI* TspEI \\ \ \ \ \ \ TCAGTACCGTTAATGATAAACGCAAAGAATATTGCATTTGCTTCAAATTATGGGATAGTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCATGGCAATTACTATTTGCGTTTCTTATAACGTAAACGAAGTTTAATACCCTATCAC /// / / / / ||| MseI | CviRI* TspEI ||Tsp4CI* SspI |Csp6I RsaI S V P L M I N A K N I A F A S N Y G I V Q Y R * * * T Q R I L H L L Q I M G * W S T V N D K R K E Y C I C F K L W D S G ----:----|----:----|----:----|----:----|----:----|----:----| D T G N I I F A F F I A N A E F * P I T T L V T L S L R L S Y Q M Q K L N H S L * Y R * H Y V C L I N C K S * I I P Y H Ksp632I* MboII BsmI |MnlI | Hpy166II TspEI Hpy188I |Hpy188I | |MboII \ \ \\ \ \\ GAGTTAGACCCCGAATGCCAATTACAAAACTCTGATAACTCTGAAGAAGAGGAAGTGGAC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAATCTGGGGCTTACGGTTAATGTTTTGAGACTATTGAGACTTCTTCTCCTTCACCTG / / / / / / / / BsmI TspEI Hpy188I | Ksp632I* | | Eco57MI Hpy188I | | Eco57I MnlI | Hpy166II | MboII MboII E L D P E C Q L Q N S D N S E E E E V D S * T P N A N Y K T L I T L K K R K W T V R P R M P I T K L * * L * R R G S G H ----:----|----:----|----:----|----:----|----:----|----:----| S N S G S H W N C F E S L E S S S S T S P T L G R I G I V F S Q Y S Q L L P L P L * V G F A L * L V R I V R F F L F H V Eco57I Eco57MI Tsp4CI* MaeI | MslI TspEI | TspRI |SetI AciI \ \ \ \ \ \\ \ ATTGATATGGATAAATTGAACACTGTGCTAATAGCAGACCTAGATACTGAAGCGGAAGAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTATACCTATTTAACTTGTGACACGATTATCGTCTGGATCTATGACTTCGCCTTCTT / // / / / / MslI || Tsp4CI* SetI MaeI AciI |TspRI TspEI I D M D K L N T V L I A D L D T E A E E L I W I N * T L C * * Q T * I L K R K K * Y G * I E H C A N S R P R Y * S G R N ----:----|----:----|----:----|----:----|----:----|----:----| M S I S L N F V T S I A S R S V S A S S C Q Y P Y I S C Q A L L L G L Y Q L P L N I H I F Q V S H * Y C V * I S F R F F AccI |MboII |BssNAI |Hpy166II ||Eco57I ||Eco57MI ||| FokI ||| | Tsp4CI* ||| | |Csp6I ||| | ||RsaI ||| | ||| MboI ||| | ||| |BbvI ||| | ||| ||DpnI ||| | ||| |||BstKTI TseI ||| | ||| |||| BsaBI BccI ||| | ||| |||| |BseGI |BisI MaeIII ||| | ||| |||| |Eco57I ||BlsI | SetI TspEI ||| | ||| |||| |Eco57MI ||| MnlI | | Hin4II* | MseI \\\ \ \\\ \\\\ \\ \\\ \ \ \ \ \ \ ACAAGTATACACAGTACGATCTCCATCCTCGCTGCTCCTTCAGGTAACTATAAGCAATTA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCATATGTGTCATGCTAGAGGTAGGAGCGACGAGGAAGTCCATTGATATTCGTTAAT /// / /// // // /// / / / / // ||| | ||| || |BsaBI ||| MnlI SetI | MaeIII |MseI ||| | ||| || |BbvI ||TseI Hin4II* TspEI ||| | ||| || Eco57MI |BisI ||| | ||| || Eco57I BccI ||| | ||| || BseGI BlsI ||| | ||| || MboI ||| | ||| |DpnI ||| | ||| BstKTI ||| | ||Csp6I ||| | |RsaI ||| | FokI ||| Tsp4CI* ||AccI |Hpy166II |BssNAI Eco57MI Eco57I MboII T S I H S T I S I L A A P S G N Y K Q L Q V Y T V R S P S S L L L Q V T I S N * K Y T Q Y D L H P R C S F R * L * A I N ----:----|----:----|----:----|----:----|----:----|----:----| V L I C L V I E M R A A G E P L * L C N F L Y V C Y S R W G R Q E K L Y S Y A I C T Y V T R D G D E S S R * T V I L L * Hin6I |GlaI MboI MnlI ||HhaI | DpnI | MnlI |||HaeII BseRI | |BstKTI \ \ \\\\ \ \ \\ ACATTAGTGGGAGGAGGCGCTAAAATAACGCCAGAAATGATAAAAAGATCATTGTTGTTA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAATCACCCTCCTCCGCGATTTTATTGCGGTCTTTACTATTTTTCTAGTAACAACAAT / / //// / // / | MnlI |||| BseRI || MboI MnlI |||Hin6I |DpnI ||GlaI BstKTI |HhaI HaeII T L V G G G A K I T P E M I K R S L L L H * W E E A L K * R Q K * * K D H C C Y I S G R R R * N N A R N D K K I I V V I ----:----|----:----|----:----|----:----|----:----|----:----| V N T P P P A L I V G S I I F L D N N N L M L P L L R * F L A L F S L F I M T T C * H S S A S F Y R W F H Y F S * Q Q * Eam1105I MseI Hin4I AciI | HindII | Hin4I MaeI Hin4I BsrBI | Hpy166II | Hin4I \ \ \ \ \ \ \ TCTAGGGTTAGAGCGGACGATTTGTCAACAAGATTTAACATATAA 1150 1160 1170 1180 ----:----|----:----|----:----|----:----|----: AGATCCCAATCTCGCCTGCTAAACAGTTGTTCTAAATTGTATATT / / / / / / / / | MaeI | AciI | | | MseI Hin4I BsrBI | | Hin4I Hin4I | | Hin4I | Hpy166II | HindII Eam1105I S R V R A D D L S T R F N I * L G L E R T I C Q Q D L T Y X * G * S G R F V N K I * H I X ----:----|----:----|----:----|----:----|----: D L T L A S S K D V L N L M Y I * P * L P R N T L L I * C I R P N S R V I Q * C S K V Y L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AloI 1 AluI 1 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 1 BpuEI BciVI 1 BfuI BetI* 1 BsaWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BplI 2 BsaBI 1 Bse8I,BseJI BseGI 3 BstF5I,BtsCI BseRI 2 BsmI 1 BsaMI,Mva1269I,PctI BsrBI 1 AccBSI,MbiI BsrI 2 BseNI,Bse1I,BsrSI BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstKTI 2 Cac8I 2 BstC8I Csp6I 5 CviQI,RsaNI CviAII 1 CviJI 5 CviKI-1 CviRI* 4 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 2 MalI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57I 4 AcuI Eco57MI 5 EcoRI 1 FatI 1 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 3 GsuI 1 BpmI HaeII 3 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HhaI 3 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 2 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 3 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 MlyI 1 SchI MmeI 1 MnlI 9 MseI 5 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI PleI 1 PpsI RsaI 5 AfaI SecI* 1 BseDI,BssECI,BsaJI SetI 12 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 2 TaqII 1 TauI 1 TfiI 2 PfeI TseI 1 ApeKI Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 14 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AlwNI ApaI ApaLI AscI Asp718I AvaI BaeI BalI BamHI BarI BbvCI BceAI BcgI BclI BdaI BfiI BglI BglII BinI* BmeT110I BmtI Bpu10I BsaAI BsaXI BseBI BseMII BsePI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrDI BssKI Bst2UI BstEII BstNI BstOI BstSCI BstXI BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FseI FspAI GsaI HgiAI* HgiCI* HgiJII* HindIII HpaI Hpy99I KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI ScrFI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TatI TsoI TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769