Restriction Map of YCP4/YCR004C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YCP4/YCR004C on chromosome III from coordinates 120318 to 119575.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.13751

EMBOSS_001 MaeII SduI | SetI TspEI SetI BseSI | TaiI CviJI \ \ \ \ \ \ ATGGTAAAGATTGCGATAATTACTTACTCTACCTACGGGCACATAGACGTTTTAGCCCAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATTTCTAACGCTATTAATGAATGAGATGGATGCCCGTGTATCTGCAAAATCGGGTT / / / / / / / TspEI SetI BseSI | MaeII | SetI SduI TaiI CviJI SetI M V K I A I I T Y S T Y G H I D V L A Q W * R L R * L L T L P T G T * T F * P K G K D C D N Y L L Y L R A H R R F S P S ----:----|----:----|----:----|----:----|----:----|----:----| X T F I A I I V * E V * P C M S T K A W X P L S Q S L * K S * R R A C L R K L G H Y L N R Y N S V R G V P V Y V N * G L TseI |BisI ||BlsI |||AluI AluI |||CviJI BbvI CviJI |||PvuII | AluI | SetI MnlI |||NspBII* | CviJI | | MseI | SetI |||| SetI | | SetI MnlI TaqI \ \ \ \ \ \\\\ \ \ \ \ \ \ GCTGTTAAGAAAGGTGTGGAGGCAGCTGGTGGTAAAGCTGATATATACAGGGTCGAGGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGACAATTCTTTCCACACCTCCGTCGACCACCATTTCGACTATATATGTCCCAGCTCCTT / / / /// / // / / CviJI | SetI ||NspBII* | |BbvI MnlI TaqI AluI | MnlI ||PvuII | CviJI MseI ||CviJI | AluI ||TseI SetI ||AluI |BisI BlsI SetI A V K K G V E A A G G K A D I Y R V E E L L R K V W R Q L V V K L I Y T G S R K C * E R C G G S W W * S * Y I Q G R G N ----:----|----:----|----:----|----:----|----:----|----:----| A T L F P T S A A P P L A S I Y L T S S L Q * S L H P P L Q H Y L Q Y I C P R P S N L F T H L C S T T F S I Y V P D L F DdeI | Hpy188I | | TspDTI | | | MnlI | | | |SetI MslI | | | || Hin4I |BseRI | | | || |BspCNI SetI |TspDTI | | | || ||BseMII BseMII | HphI Hin4I || MnlI | | | || |||XmnI |BspCNI \ \ \ \\ \ \ \ \ \\ \\\\ \\ ACTTTACCTGATGAAGTCCTCACCAAGATGAACGCTCCTCAGAAACCTGAAGATATTCCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAATGGACTACTTCAGGAGTGGTTCTACTTGCGAGGAGTCTTTGGACTTCTATAAGGA / / / // / // /// // / // / SetI | Hin4I || MnlI || ||| || | || MboII HphI |MslI || ||| || | |BspCNI TspDTI || ||| || | BseMII BseRI || ||| || XmnI || ||| |BseMII || ||| BspCNI || ||MnlI || |Hin4I || SetI |TspDTI |DdeI Hpy188I T L P D E V L T K M N A P Q K P E D I P L Y L M K S S P R * T L L R N L K I F L F T * * S P H Q D E R S S E T * R Y S C ----:----|----:----|----:----|----:----|----:----|----:----| V K G S S T R V L I F A G * F G S S I G F K V Q H L G * W S S R E E S V Q L Y E S * R I F D E G L H V S R L F R F I N R DdeI Eco57I Eco57MI | TspRI | | AclI | | MaeII | | | SetI | | | TaiI MboII | | | | TaqI AcyI HgaI MaeI \ \ \ \ \ \ \ \ \ GTTGCCACTGAGAAAACGTTGCTCGAATATGACGCCTTTTTGTTCGGTGTTCCAACTAGG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGGTGACTCTTTTGCAACGAGCTTATACTGCGGAAAAACAAGCCACAAGGTTGATCC / / / / / / / / // | | | | MaeII TaqI AcyI HgaI |MaeI | | | | AclI SetI | | | TaiI | | | SetI | | DdeI | Eco57MI | Eco57I TspRI V A T E K T L L E Y D A F L F G V P T R L P L R K R C S N M T P F C S V F Q L G C H * E N V A R I * R L F V R C S N * V ----:----|----:----|----:----|----:----|----:----|----:----| T A V S F V N S S Y S A K K N P T G V L Q Q W Q S F T A R I H R R K T R H E L * N G S L F R Q E F I V G K Q E T N W S P MroNI Cfr10I |HpaII AsuI* ||NaeI |BmgT120I ||Cac8I AsuI* AgeI ||CviJI |||EciI AvaII BetI* ||HaeIII ||||MmeI |BmgT120I Cfr10I |||StyI SetI TspEI ||||CviJI || AciI BsiYI* |HpaII |||SecI* \ \ \\\\\ \\ \ \ \\ \\\\ TTTGGTAATTTGCCGGCTCAATGGTCCGCCTTTTGGGATAAAACCGGTGGATTATGGGCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCATTAAACGGCCGAGTTACCAGGCGGAAAACCCTATTTTGGCCACCTAATACCCGG / //// // // // // | |||Cfr10I || |BsiYI* |Cfr10I |AsuI* | |||MroNI || AciI |BetI* BmgT120I | |||CviJI |AvaII |AgeI HaeIII | ||HpaII |AsuI* HpaII CviJI | |Cac8I BmgT120I | |MmeI | |NaeI | EciI TspEI F G N L P A Q W S A F W D K T G G L W A L V I C R L N G P P F G I K P V D Y G P W * F A G S M V R L L G * N R W I M G Q ----:----|----:----|----:----|----:----|----:----|----:----| N P L K G A * H D A K Q S L V P P N H A T Q Y N A P E I T R R K P Y F R H I I P K T I Q R S L P G G K P I F G T S * P G FauI | TseI | AluI | CviJI CviJI | |BisI TatI | SduI | ||BlsI |Csp6I BsrI | HgiJII* | ||SetI ||RsaI | MnlI | | BbvI | |||AciI BceAI ||ScaI | MaeIII SetI \ \ \ \ \\\\ \ \\\ \ \ \ AAGGGCTCTTTGAACGGCAAAGCTGCGGGGATATTCGTTAGTACTTCCAGTTACGGAGGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCCGAGAAACTTGCCGTTTCGACGCCCCTATAAGCAATCATGAAGGTCAATGCCTCCA / / / / //// / / //// / / / | CviJI BbvI | |||| AciI BceAI |||| MnlI | SetI HgiJII* | |||TseI |||BsrI MaeIII SecI* | ||BisI ||TatI StyI | |BlsI |Csp6I SduI | CviJI ScaI | AluI RsaI SetI FauI K G S L N G K A A G I F V S T S S Y G G R A L * T A K L R G Y S L V L P V T E V G L F E R Q S C G D I R * Y F Q L R R W ----:----|----:----|----:----|----:----|----:----|----:----| L P E K F P L A A P I N T L V E L * P P W P S K S R C L Q P S I R * Y K W N R L L A R Q V A F S R P Y E N T S G T V S T Hpy178III* | TspGWI | | Csp6I | | |RsaI AluI | | || Tsp4CI* CviJI | | || | MseI CviJI | SetI TspEI \ \ \\ \ \ \ \ \ \ GGTCAAGAAAGTACCGTTAAAGCCTGTTTGTCTTATTTAGCTCATCACGGAATTATCTTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGTTCTTTCATGGCAATTTCGGACAAACAGAATAAATCGAGTAGTGCCTTAATAGAAA / /// / / / / / / | ||| | CviJI | CviJI TspEI TspGWI | ||| MseI | AluI | ||Tsp4CI* SetI | |Csp6I | RsaI Hpy178III* TspGWI G Q E S T V K A C L S Y L A H H G I I F V K K V P L K P V C L I * L I T E L S F S R K Y R * S L F V L F S S S R N Y L F ----:----|----:----|----:----|----:----|----:----|----:----| P * S L V T L A Q K D * K A * * P I I K H D L F Y R * L R N T K N L E D R F * R T L F T G N F G T Q R I * S M V S N D K BsrI TspRI TspDTI | PsiI TsoI | | BfiI |Csp6I | | | ApoI MwoI ||RsaI | | | TspEI | CviJI ||SetI | | | EcoRI | |BsrI |||Hpy166II | | | | BseMII | || Ksp632I* |||| MboII TspGWI | | | | |BspCNI DdeI | || |MnlI |||| Tsp4CI* \ \ \ \ \ \\ \ \ \\ \\ \\\\ \ TTACCACTGGGTTATAAGAATTCATTTGCTGAGTTAGCCAGTATAGAAGAGGTACACGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATGGTGACCCAATATTCTTAAGTAAACGACTCAATCGGTCATATCTTCTCCATGTGCCA / / // // / // // / / / // / TspRI | || || EcoRI || || | | | || Tsp4CI* | || || TspEI || || | | | || MboII | || || ApoI || || | | | |Hpy166II | || |BspCNI || || | | | |Csp6I | || BseMII || || | | | RsaI | |BfiI || || | | TsoI | PsiI || || | | SetI TspDTI || || | Ksp632I* BsrI || || MnlI || |CviJI || BsrI |DdeI MwoI L P L G Y K N S F A E L A S I E E V H G Y H W V I R I H L L S * P V * K R Y T V T T G L * E F I C * V S Q Y R R G T R W ----:----|----:----|----:----|----:----|----:----|----:----| K G S P * L F E N A S N A L I S S T C P K V V P N Y S N M Q Q T L W Y L L P V R * W Q T I L I * K S L * G T Y F L Y V T Acc65I HgiCI* |Csp6I ||RsaI ||NlaIV ||| KpnI ||| | Bce83I* ||| | |CviRI* ||| | || AsuI* ||| | || AvaII ||| | || DraII ||| | || PpuMI ||| | || |BmgT120I ||| | || || AlwNI ||| | || || | SetI ||| | || || | | AloI ||| | || || | | PpiI CviJI ||| | || || | | BsaXI | FatI ||| | || || | | | HgaI | NcoI ||| | || || | | | CviJI | StyI ||| | || || | | | |SmlI | SecI* ||| | || || | | | || Hpy178III* | DsaI* ||| | || || | | | || | BceAI | |CviAII ||| | || || | | | || | | BsmAI | || NlaIII ||| | || || | | | || | CspCI | Esp3I \ \\ \ \\\ \ \\ \\ \ \ \ \\ \ \ \ \ GGCTCTCCATGGGGTGCTGGTACCCTTGCAGGACCTGACGGCTCAAGAACTGCGTCTCCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAGAGGTACCCCACGACCATGGGAACGTCCTGGACTGCCGAGTTCTTGACGCAGAGGT / / // / /// / / //// / / // / | | |DsaI* | ||| | | |||| | | || BceAI | | |SecI* | ||| | | |||| | | |Hpy178III* | | |StyI | ||| | | |||| | | |SmlI | | |NcoI | ||| | | |||| | | |HgaI | | |FatI | ||| | | |||| | | CspCI | | CviAII | ||| | | |||| | CviJI | NlaIII | ||| | | |||| BsaXI CviJI | ||| | | |||PpuMI | ||| | | |||DraII | ||| | | |||AvaII | ||| | | |||AsuI* | ||| | | |||PpiI | ||| | | |||AloI | ||| | | ||BmgT120I | ||| | | |SetI | ||| | | AlwNI | ||| | CviRI* | ||| Bce83I* | ||HgiCI* | ||Acc65I | |Csp6I | NlaIV | RsaI KpnI G S P W G A G T L A G P D G S R T A S P A L H G V L V P L Q D L T A Q E L R L H L S M G C W Y P C R T * R L K N C V S T ----:----|----:----|----:----|----:----|----:----|----:----| P E G H P A P V R A P G S P E L V A D G H S E M P H Q Y G Q L V Q R S L F Q T E A R W P T S T G K C S R V A * S S R R W TspEI | BsaXI | | AloI ApoI | | PpiI TspEI AjuI | | TspEI | CspCI SetI | AciI \ \ \ \ \ \ \ \ CTTGAATTGAGAATTGCTGAAATTCAAGGTAAAACATTCTACGAAACCGCCAAAAAACTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTAACTCTTAACGACTTTAAGTTCCATTTTGTAAGATGCTTTGGCGGTTTTTTGAA / / / / / / / / / | | TspEI | | | SetI AjuI AciI | BsaXI | | TspEI | PpiI | | ApoI | AloI | CspCI Esp3I TspEI BsmAI L E L R I A E I Q G K T F Y E T A K K L L N * E L L K F K V K H S T K P P K N F * I E N C * N S R * N I L R N R Q K T F ----:----|----:----|----:----|----:----|----:----|----:----| S S N L I A S I * P L V N * S V A L F S V Q I S F Q Q F E L Y F M R R F R W F V K F Q S N S F N L T F C E V F G G F F K SfaNI |BbvII* || MboII || | Hpy188I || | | AciI || | | |BisI CviRI* || | | ||BlsI | MwoI || | | ||BsmAI | | AjuI || | | |||TauI | | |CviJI MnlI || | | |||CviJI | | || CviJI TspRI || | | ||||DdeI \ \ \\ \ \ \\ \ \ \\\\\ TTCCCTGCAAAAGAAGCCAAGCCCTCCACTGAAAAGAAGACCACTACTTCTGATGCGGCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGACGTTTTCTTCGGTTCGGGAGGTGACTTTTCTTCTGGTGATGAAGACTACGCCGA / / / / / / // / //// | AjuI | | TspRI MnlI || | |||CviJI | MwoI | CviJI || | ||BisI CviRI* CviJI || | ||AciI || | |BlsI || | TauI || Hpy188I |BbvII* |MboII SfaNI F P A K E A K P S T E K K T T T S D A A S L Q K K P S P P L K R R P L L L M R L P C K R S Q A L H * K E D H Y F * C G * ----:----|----:----|----:----|----:----|----:----|----:----| K G A F S A L G E V S F F V V V E S A A K G Q L L L W A R W Q F S S W * K Q H P E R C F F G L G G S F L L G S S R I R S SfeI* |SetI ||TseI ||CviRI* |||BisI ||||BlsI ||||PstI |||||TseI ||||||BisI |||||||BlsI |||||||BspMI ||||||||AluI ||||||||CviJI ||||||||| SetI ||||||||| | MwoI ||||||||| | BbvI ||||||||| | |SfeI* ||||||||| | || BbvI ||||||||| | || CviRI* ||||||||| | || | PstI ||||||||| | || | Hin4II* ||||||||| | || | | EcoP15I ||||||||| | || | | |MnlI EcoP15I BsaBI \\\\\\\\\ \ \\ \ \ \\ \ \ AAGAGACAAACTAAACCTGCAGCAGCTACAACTGCAGAAAAGAAGGAGGACAAAGGATTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCTGTTTGATTTGGACGTCGTCGATGTTGACGTCTTTTCTTCCTCCTGTTTCCTAAT // / / /////// / / /// / / / / |DdeI | | ||||||| | | ||| | EcoP15I EcoP15I BsaBI BsmAI | | ||||||| | | ||| BbvI | | ||||||| | | ||| MnlI | | ||||||| | | ||SfeI* | | ||||||| | | |Hin4II* | | ||||||| | | |BbvI | | ||||||| | | CviRI* | | ||||||| | PstI | | ||||||| BspMI | | ||||||| MwoI | | ||||||CviJI | | ||||||TseI | | ||||||AluI | | |||||BisI | | ||||BlsI | | ||||SetI | | |||TseI | | ||SfeI* | | ||BisI | | |BlsI | | CviRI* | PstI SetI K R Q T K P A A A T T A E K K E D K G L R D K L N L Q Q L Q L Q K R R R T K D Y E T N * T C S S Y N C R K E G G Q R I I ----:----|----:----|----:----|----:----|----:----|----:----| L L C V L G A A A V V A S F F S S L P N * S V F * V Q L L * L Q L F S P P C L I L S L S F R C C S C S C F L L L V F S * TatI |Csp6I ||RsaI ||| Tsp4CI* ||| | FatI ||| | |CviAII ||| | || NlaIII \\\ \ \\ \ TTATCCTGCTGTACTGTCATGTAA 730 740 ----:----|----:----|---- AATAGGACGACATGACAGTACATT /// / // ||| | |FatI ||| | CviAII ||| NlaIII ||Tsp4CI* ||TatI |Csp6I RsaI L S C C T V M * Y P A V L S C X I L L Y C H V X ----:----|----:----|---- N D Q Q V T M Y I I R S Y Q * T * G A T S D H L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 4 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AjuI 1 AloI 1 AluI 6 AluBI AlwNI 1 CaiI ApoI 2 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI Bce83I* 1 BpuEI BceAI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 3 BsaBI 1 Bse8I,BseJI BsaXI 1 BseMII 3 BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BspCNI 3 BspMI 1 BfuAI,Acc36I,BveI BsrI 3 BseNI,Bse1I,BsrSI Cac8I 1 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I Csp6I 5 CviQI,RsaNI CspCI 1 CviAII 2 CviJI 17 CviKI-1 CviRI* 4 HpyCH4V DdeI 4 BstDEI,HpyF3I DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EciI 1 Eco57I 1 AcuI Eco57MI 1 EcoP15I 2 EcoRI 1 Esp3I 1 BsmBI FatI 2 FauI 1 SmuI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 1 Hin4II* 1 HpyAV HpaII 2 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 2 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 1 MboII 3 MmeI 1 MnlI 8 MroNI 1 NgoMIV MseI 2 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NaeI 1 PdiI NcoI 1 Bsp19I NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PpiI 1 PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PstI 2 PvuII 1 RsaI 5 AfaI ScaI 1 BmcAI,AssI,ZrmI SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 18 SfaNI 1 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 2 TatI 2 TauI 1 TseI 4 ApeKI TsoI 1 Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 7 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AflII AflIII AhaIII* AlfI ApaI ApaLI AscI AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BccI BcgI BciVI BclI BdaI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BseBI BseGI BsePI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI CauII* Cfr9I CfrI ClaI DinI DpnI DraIII DrdI Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRII EcoRV EcoT22I EgeI EheI EspI* FalI FaqI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HgiAI* HhaI Hin6I HindII HindIII HinfI HinP1I HpaI Hpy99I HspAI KasI MauBI MboI McrI* MfeI MluI MlyI Mph1103I MstI* MvaI NarI NdeI NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PshAI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* SchI ScrFI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I SwaI TaqII TfiI Tsp45I TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769