Restriction Map of YCLWTy5-1

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

YCLWTy5-1 on chromosome III from coordinates 1179 to 4322.


FatI MaeIII |CviAII BstEII || NlaIII Hpy188I \ \\ \ \ TGTTGAATGTGGTAACCCAATAGCATGATATGAGTAATGCTTTAGTATTGTTTCAGAGTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| ACAACTTACACCATTGGGTTATCGTACTATACTCATTACGAAATCATAACAAAGTCTCAA / / // / BstEII | |FatI Hpy188I MaeIII | CviAII NlaIII C * M W * P N S M I * V M L * Y C F R V V E C G N P I A * Y E * C F S I V S E L L N V V T Q * H D M S N A L V L F Q S C ----:----|----:----|----:----|----:----|----:----|----:----| X Q I H Y G L L M I H T I S * Y Q K L T X N F T T V W Y C S I L L A K T N N * L T S H P L G I A H Y S Y H K L I T E S N BetI* |HpaII || MnlI || | TatI || | |Csp6I || | ||RsaI || | ||ScaI || | ||| SmlI SetI || | ||| AflII \ \\ \ \\\ \ GTTTCAGTAATGTTTTAGACAAGGAGAACATATAGTAGCAAACCTCTAATCCGGTAGTAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGTCATTACAAAATCTGTTCCTCTTGTATATCATCGTTTGGAGATTAGGCCATCATG / /// /// SetI ||| ||TatI ||| |Csp6I ||| ScaI ||| RsaI ||BetI* |HpaII MnlI V S V M F * T R R T Y S S K P L I R * Y F Q * C F R Q G E H I V A N L * S G S T F S N V L D K E N I * * Q T S N P V V L ----:----|----:----|----:----|----:----|----:----|----:----| T E T I N * V L L V Y L L L G R I R Y Y Q K L L T K S L S F M Y Y C V E L G T T N * Y H K L C P S C I T A F R * D P L V MslI |FatI SfeI* Csp6I ||CviAII MseI | Tsp4CI* |RsaI MaeIII TspEI ||| NlaIII \ \ \ \\ \ \ \\\ \ TTAAGAAACTACAGTTTCTATGTACGAAAGCAGTAACTATGTAATTATTACATTTACATG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCTTTGATGTCAAAGATACATGCTTTCGTCATTGATACATTAATAATGTAAATGTAC // // // / / // // |AflII |SfeI* |Csp6I MaeIII TspEI || |FatI |SmlI Tsp4CI* RsaI || CviAII MseI |NlaIII MslI L R N Y S F Y V R K Q * L C N Y Y I Y M * E T T V S M Y E S S N Y V I I T F T * K K L Q F L C T K A V T M * L L H L H D ----:----|----:----|----:----|----:----|----:----|----:----| K L F * L K * T R F C Y S H L * * M * M S L F S C N R H V F A T V I Y N N C K C * S V V T E I Y S L L L * T I I V N V H AluI CviJI |MaeI ||SetI ||TspDTI AsuI* |||MboI AvaII |||| DpnI |BmgT120I |||| |BstKTI Hin4II* ||SetI SetI |||| || TspEI \ \\\ \ \\\\ \\ \ ACATATAGGAAGGTCCAATAAACTTACTACATTATGACCTATAAGCTAGATCGTAATTCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATATCCTTCCAGGTTATTTGAATGATGTAATACTGGATATTCGATCTAGCATTAAGT / / // / / / /// / / Hin4II* | |AvaII SetI | | ||| MboI TspEI | |AsuI* | | ||DpnI | BmgT120I | | |BstKTI SetI | | MaeI | TspDTI | CviJI | AluI SetI T Y R K V Q * T Y Y I M T Y K L D R N S H I G R S N K L T T L * P I S * I V I H I * E G P I N L L H Y D L * A R S * F I ----:----|----:----|----:----|----:----|----:----|----:----| V Y L F T W Y V * * M I V * L S S R L E S M Y S P G I F K S C * S R Y A L D Y N C I P L D L L S V V N H G I L * I T I * CviJI | SduI | HgiJII* | |DdeI | || MwoI | || Hpy188I | || | BseMII | || | |BspCNI MaeII | || | || MnlI | SetI | || | || | BsrDI | TaiI | || | || | BspCNI | |HindII | || | || | |BseMII | |Hpy166II | || | || | ||DdeI | || SetI | || | || | |||Hpy188I MaeI \ \\ \ \ \\ \ \\ \ \\\\ \ TTACGTCAACAGGTTATGAGCCCTCAGAGCAATGCTTCTGAGAACATAATCAATCTATCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AATGCAGTTGTCCAATACTCGGGAGTCTCGTTACGAAGACTCTTGTATTAGTTAGATAGA / / / / / / / //// / // / / | | | SetI | | | |||| | || | DdeI | | Hpy166II | | | |||| | || Hpy188I | | HindII | | | |||| | |BseMII | MaeII | | | |||| | BspCNI TaiI | | | |||| | BsrDI SetI | | | |||| MnlI | | | |||BspCNI | | | ||BseMII | | | |DdeI | | | Hpy188I | | MwoI | CviJI HgiJII* SduI L R Q Q V M S P Q S N A S E N I I N L S Y V N R L * A L R A M L L R T * S I Y L T S T G Y E P S E Q C F * E H N Q S I * ----:----|----:----|----:----|----:----|----:----|----:----| N R * C T I L G * L L A E S F M I L R D M V D V P * S G E S C H K Q S C L * D I * T L L N H A R L A I S R L V Y D I * R TspEI | PsiI | | EcoP15I | | | Tsp4CI* | | | | CviJI | | | | AlwNI | | | | |BcgI | | | | |TspRI | | | | || Csp6I | | | | || |RsaI | | | | || || BbvI | | | | || || |BsmAI | | | | || || |Eco31I | | | | || || |Tsp4CI* | | | | || || || TaqI | | | | || || || |Hpy178III* | | | | || || || || AciI | | | | || || || || | TseI | | | | || || || || | NspBII* | | | | || || || || | |BisI CviJI | | | | || || || || | ||BlsI MwoI BcgI \ \ \ \ \ \\ \\ \\ \\ \ \\\ \ \ AGCCCCAACAATTATAAACAGTGGCTGTACGGTATCGAGACCGCTGCTGAATATGCTAAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGGGTTGTTAATATTTGTCACCGACATGCCATAGCTCTGGCGACGACTTATACGATTG // // / // / // /// // // //// / / |CviJI || | || | || ||| || || |||| MwoI BcgI MaeI || | || | || ||| || || |||TseI || | || | || ||| || || ||BisI || | || | || ||| || || |BlsI || | || | || ||| || || NspBII* || | || | || ||| || || AciI || | || | || ||| || |Hpy178III* || | || | || ||| || TaqI || | || | || ||| |Eco31I || | || | || ||| |BsmAI || | || | || ||| BbvI || | || | || ||Tsp4CI* || | || | || |Csp6I || | || | || RsaI || | || | |CviJI || | || | BcgI || | || AlwNI || | |Tsp4CI* || | EcoP15I || TspRI |PsiI TspEI S P N N Y K Q W L Y G I E T A A E Y A N A P T I I N S G C T V S R P L L N M L T P Q Q L * T V A V R Y R D R C * I C * R ----:----|----:----|----:----|----:----|----:----|----:----| L G L L * L C H S Y P I S V A A S Y A L * G W C N Y V T A T R Y R S R Q Q I H * A G V I I F L P Q V T D L G S S F I S V TspDTI | ApoI Hin4I | XmnI Hin4I Hin4I | TspEI TspDTI Hin4I | EcoRI | BetI* | BsaBI | | XmnI | |HpaII EcoRV | | TspDTI \ \ \ \ \\ \ \ \ \ GAATATATGAACGAATTCGTTCATACCGGAGATATCCAATCAATGAAAAGGGATTACAAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATATACTTGCTTAAGCAAGTATGGCCTCTATAGGTTAGTTACTTTTCCCTAATGTTA / / / / // / / / | | | TspDTI || EcoRV Hin4I TspDTI | | EcoRI |BetI* Hin4I BsaBI | | TspEI HpaII | | Hin4I | | Hin4I | | XmnI | | ApoI | XmnI TspDTI E Y M N E F V H T G D I Q S M K R D Y N N I * T N S F I P E I S N Q * K G I T I I Y E R I R S Y R R Y P I N E K G L Q S ----:----|----:----|----:----|----:----|----:----|----:----| S Y I F S N T * V P S I W D I F L S * L R I Y S R I R E Y R L Y G I L S F P N C F I H V F E N M G S I D L * H F P I V I DdeI | Hin6I | |GlaI | ||HhaI | ||FnuDII* | ||| BspCNI | ||| |BseMII Tsp4CI* | ||| || HindIII | BssKI | ||| || | AluI TspDTI | EcoRII AluI | ||| || | CviJI | Tsp4CI* | | ScrFI CviJI | ||| || | | SetI | | MseI | | BseBI | SetI \ \\\ \\ \ \ \ \ \ \ \ \ \ \ \ CTCAGCGCGAATGATGAAAGCTTTGTCAAAACCGTATTTAACAGTTTCCTGGTAAAGCTC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTCGCGCTTACTACTTTCGAAACAGTTTTGGCATAAATTGTCAAAGGACCATTTCGAG //// // / / / / / / / / / / / |||| || | | | | Tsp4CI* | Tsp4CI* | | | CviJI |||| || | | | TspDTI MseI | | | AluI |||| || | | HindIII | | SetI |||| || | CviJI | EcoRII |||| || | AluI | BssKI |||| || SetI BseBI |||| |BseMII ScrFI |||| BspCNI |||FnuDII* |||Hin6I ||GlaI |HhaI DdeI L S A N D E S F V K T V F N S F L V K L S A R M M K A L S K P Y L T V S W * S S Q R E * * K L C Q N R I * Q F P G K A L ----:----|----:----|----:----|----:----|----:----|----:----| R L A F S S L K T L V T N L L K R T F S D * R S H H F S Q * F R I * C N G P L A E A R I I F A K D F G Y K V T E Q Y L E TseI AluI CviJI |BisI ||BlsI ||SetI |||FatI |||CviRI* ||||CviAII TspDTI ||||| HphI | TfiI TaqII ||||| |NspI | HinfI | BbvI ||||| |NlaIII BsrI | | Hin4II* \ \ \\\\\ \\ \ \ \ \ TACAAGAAAACTATCGTGGGTGAAGCTGCATGTGAAATGAACTGGATATGTGATGATTCG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTCTTTTGATAGCACCCACTTCGACGTACACTTTACTTGACCTATACACTACTAAGC / / / //// /// / / / TaqII BbvI | |||| ||FatI BsrI TspDTI Hin4II* | |||| |CviAII HinfI | |||| HphI TfiI | |||CviRI* | |||NlaIII | |||TseI | |||NspI | ||BisI | |BlsI | CviJI | AluI SetI Y K K T I V G E A A C E M N W I C D D S T R K L S W V K L H V K * T G Y V M I R Q E N Y R G * S C M * N E L D M * * F A ----:----|----:----|----:----|----:----|----:----|----:----| * L F V I T P S A A H S I F Q I H S S E R C S F * R P H L Q M H F S S S I H H N V L F S D H T F S C T F H V P Y T I I R Hin4I MboII | BsmAI TaqI Hin4I | MaeIII | Eco31I AsuII | AjuI | Tsp45I \ \ \ \ \ \ \ CTTGGAAGGGTCTCTGCTTATGATATTTTCTCGCACTTCGAAGAAAACTATAATGAAGTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GAACCTTCCCAGAGACGAATACTATAAAAGAGCGTGAAGCTTCTTTTGATATTACTTCAG / / / / / Hin4I Eco31I | AjuI MboII BsmAI Hin4I AsuII TaqI L G R V S A Y D I F S H F E E N Y N E V L E G S L L M I F S R T S K K T I M K S W K G L C L * Y F L A L R R K L * * S H ----:----|----:----|----:----|----:----|----:----|----:----| S P L T E A * S I K E C K S S F * L S T A Q F P R Q K H Y K R A S R L F S Y H L K S P D R S I I N E R V E F F V I I F D BinI* | MboI | BamHI | XhoII | |TspDTI | ||DpnI | ||NlaIV | |||BssKI | |||EcoRII | |||BstKTI | |||| ScrFI AsuI* | |||| BseBI AvaII | |||| | CviJI DraII | |||| | BinI* PpuMI CviJI | |||| | | AjuI |BmgT120I | SfeI* | |||| | | | MnlI || SetI | |MnlI \ \\\\ \ \ \ \ \\ \ \ \\ ACTATTGGATCCAGGCTTACTCTTATAGAGGACCTACCAAATATATCCTCCAAGCCTGTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAACCTAGGTCCGAATGAGAATATCTCCTGGATGGTTTATATAGGAGGTTCGGACAT // / // / //// / /// / / / || | || | |||| MnlI ||PpuMI | | SfeI* || | || | |||BinI* ||DraII | MnlI || | || | ||EcoRII ||AvaII CviJI || | || | ||BssKI ||AsuI* || | || | ||CviJI |BmgT120I || | || | |AjuI SetI || | || | BseBI || | || | ScrFI || | || XhoII || | || BamHI || | || MboI || | |NlaIV || | |DpnI || | BstKTI || TspDTI |BinI* Tsp45I MaeIII T I G S R L T L I E D L P N I S S K P V L L D P G L L L * R T Y Q I Y P P S L * Y W I Q A Y S Y R G P T K Y I L Q A C R ----:----|----:----|----:----|----:----|----:----|----:----| V I P D L S V R I S S R G F I D E L G T * * Q I W A * E * L P G V L Y I R W A Q S N S G P K S K Y L V * W I Y G G L R Y BbvII* TspEI TspDTI SfaNI Hpy178III* | MboII \ \ \ \ \ \ GATGAAATTGCTTCCTTTTTGAAAACTCTATTCACGATGCTTGAAGACAATAGCGAAGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTTAACGAAGGAAAAACTTTTGAGATAAGTGCTACGAACTTCTGTTATCGCTTCTT / / / / / TspEI TspDTI | Hpy178III* BbvII* SfaNI MboII D E I A S F L K T L F T M L E D N S E E M K L L P F * K L Y S R C L K T I A K N * N C F L F E N S I H D A * R Q * R R T ----:----|----:----|----:----|----:----|----:----|----:----| S S I A E K K F V R N V I S S S L L S S L H F Q K R K S F E I * S A Q L C Y R L I F N S G K Q F S * E R H K F V I A F F AvaI FnuDII* MseI |BmeT110I MboII | HgaI FnuDII* VspI SetI ||Hin4II* \ \ \ \ \ \ \\\ CAGGACAAAAAAAAAAGACGCGACACCAATATCGCGTTGTTATTAATGACCTTCTTACCC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTGTTTTTTTTTTCTGCGCTGTGGTTATAGCGCAACAATAATTACTGGAAGAATGGG / / / / / / / MboII FnuDII* | FnuDII* | SetI Hin4II* HgaI VspI MseI Q D K K K R R D T N I A L L L M T F L P R T K K K D A T P I S R C Y * * P S Y P G Q K K K T R H Q Y R V V I N D L L T R ----:----|----:----|----:----|----:----|----:----|----:----| C S L F F L R S V L I A N N N I V K K G V P C F F F V R C W Y R T T I L S R R V L V F F F S A V G I D R Q * * H G E * G ApoI TspEI | MlyI | PleI | | Eco57I | | MaeIII | | Tsp45I SapI | | Eco57MI Ksp632I* | | | HinfI |AluI TfiI | | | | MboII HphI |CviJI MseI HinfI BsiI* | | | | |DdeI CviJI || SetI \ \ \ \ \ \ \ \\ \ \\ \ GAGTTAAAAGAATCATTCCACGAGAAATTCGGTGACTCTAAGGCTCTTCAGCTATCACAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAATTTTCTTAGTAAGGTGCTCTTTAAGCCACTGAGATTCCGAGAAGTCGATAGTGTT // / / / // // /// / / / || MseI HinfI | || || ||CviJI | | Ksp632I* |AvaI TfiI | || || |HphI | | SapI BmeT110I | || || DdeI | CviJI | || |HinfI | AluI | || Tsp45I SetI | || MaeIII | || MboII | |Eco57MI | |Eco57I | |TspEI | |ApoI | |PleI | MlyI BsiI* E L K E S F H E K F G D S K A L Q L S Q S * K N H S T R N S V T L R L F S Y H K V K R I I P R E I R * L * G S S A I T S ----:----|----:----|----:----|----:----|----:----|----:----| S N F S D N W S F N P S E L A R * S D C R T L L I M G R S I R H S * P E E A I V L * F F * E V L F E T V R L S K L * * L TspDTI | TaqI DdeI | | ApoI | BsmAI | | TspEI | Eco31I HgaI | | EcoRI | Hpy188I TfiI | TspEI | | | MboII | | CviRI* HinfI | | MseI | | | |TaqII SfaNI | | | EcoT22I \ \ \ \ \ \ \ \\ \ \ \ \ \ GTCATTAGATTCTGTAAATTAAATGCGTCATCGAATTCATCATCTTCGGTCTCAGATGCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTAATCTAAGACATTTAATTTACGCAGTAGCTTAAGTAGTAGAAGCCAGAGTCTACGT / /// / // / / // / / HinfI ||| TspDTI || EcoRI | || | Eco31I TfiI ||MseI || TspEI | || | CviRI* |TspEI || ApoI | || | BsmAI HgaI |MboII | || EcoT22I |TaqII | |DdeI TaqI | Hpy188I SfaNI V I R F C K L N A S S N S S S S V S D A S L D S V N * M R H R I H H L R S Q M H H * I L * I K C V I E F I I F G L R C I ----:----|----:----|----:----|----:----|----:----|----:----| T M L N Q L N F A D D F E D D E T E S A L * * I R Y I L H T M S N M M K P R L H D N S E T F * I R * R I * * R R D * I C MwoI BstAPI BseGI BspCNI | TspEI |BseMII | | BtgZI || CviRI* MboII | | | FokI \\ \ \ \ \ \ \ TTGGTTGCACAAGACAGAAGAAACTATCAAAAGAAAGGAAATAAGGGATGTATATAATTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AACCAACGTGTTCTGTCTTCTTTGATAGTTTTCTTTCCTTTATTCCCTACATATATTAAA /// / / / / ||| CviRI* MboII BseGI TspEI ||BseMII |BspCNI BstAPI MwoI L V A Q D R R N Y Q K K G N K G C I * F W L H K T E E T I K R K E I R D V Y N L G C T R Q K K L S K E R K * G M Y I I Y ----:----|----:----|----:----|----:----|----:----|----:----| N T A C S L L F * * F F P F L P H I Y N M P Q V L C F F S D F S L F Y P I Y I I Q N C L V S S V I L L F S I L S T Y L K AluI CviJI | MboI | BclI | SetI | | DpnI | | |BstKTI | | || TspGWI Tsp4CI* MseI MboII \ \ \\ \ \ \ \ ACGGAGCTGATCATCGCATAAGCAACTGTTCTCTGCTTAAACGAAGAATACCAGAAGCAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCTCGACTAGTAGCGTATTCGTTGACAAGAGACGAATTTGCTTCTTATGGTCTTCGTG / // / // / / / / / | || | || | TspGWI Tsp4CI* MseI MboII | || | || BclI | || | || MboI | || | |DpnI | || | BstKTI | || CviJI | || AluI | |SetI | FokI BtgZI T E L I I A * A T V L C L N E E Y Q K H R S * S S H K Q L F S A * T K N T R S T G A D H R I S N C S L L K R R I P E A R ----:----|----:----|----:----|----:----|----:----|----:----| V S S I M A Y A V T R Q K F S S Y W F C * P A S * R M L L Q E R S L R L I G S A R L Q D D C L C S N E A * V F F V L L V MboII TspDTI | MboI MwoI | BglII | Hpy178III* | XhoII | |NruI MseI | | DpnI | |FnuDII* TfiI |AhaIII* | | |BstKTI | || TfiI HinfI ||TspEI | | || BsaBI MaeI | || HinfI \ \\\ \ \ \\ \ \ \ \\ \ GAATCTTTAAATTATATCCTAATGACAAAACGAGTAGATCTTCATCTGCTAGTGTCGCGA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGAAATTTAATATAGGATTACTGTTTTGCTCATCTAGAAGTAGACGATCACAGCGCT / // / // // // / // | || TspEI |MboII || |BsaBI MwoI |Hpy178III* | |MseI TspDTI || XhoII MaeI FnuDII* | AhaIII* || BglII NruI HinfI || MboI TfiI |DpnI BstKTI E S L N Y I L M T K R V D L H L L V S R N L * I I S * * Q N E * I F I C * C R D I F K L Y P N D K T S R S S S A S V A I ----:----|----:----|----:----|----:----|----:----|----:----| S D K F * I R I V F R T S R * R S T D R R I K L N Y G L S L V L L D E D A L T A F R * I I D * H C F S Y I K M Q * H R S BssKI EcoRII | BarI | ScrFI CviJI | BseBI HaeIII | | CviJI Hpy178III* | TspDTI | | | EcoP15I \ \ \ \ \ \ \ TTCCTGACTATGAAACGCAAGGCCAAACAGCAGGACAGATAACACCGAAGTCCTGGCTCT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGACTGATACTTTGCGTTCCGGTTTGTCGTCCTGTCTATTGTGGCTTCAGGACCGAGA / / // / / / / | Hpy178III* |TspDTI BarI | | EcoP15I HinfI HaeIII | | MboII TfiI CviJI | EcoRII | BssKI | CviJI BseBI ScrFI F L T M K R K A K Q Q D R * H R S P G S S * L * N A R P N S R T D N T E V L A L P D Y E T Q G Q T A G Q I T P K S W L C ----:----|----:----|----:----|----:----|----:----|----:----| N R V I F R L A L C C S L Y C R L G P E I G S * S V C P W V A P C I V G F D Q S E Q S H F A L G F L L V S L V S T R A R DdeI Tsp4CI* | Hpy188I | AluI | | BsiYI* | CviJI | | | MnlI | |BarI | | | | BspCNI MboII TaqI | ||SetI | | | | |BseMII TatI \ \ \ \\\ \ \ \ \ \\ \ GTATGTTATCTTCGACTGTTCCAGCTACCAAATCCTCAGAATGGATTTTTGACACAGGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CATACAATAGAAGCTGACAAGGTCGATGGTTTAGGAGTCTTACCTAAAAACTGTGTCCTA / / / / / // / // | | | | CviJI |DdeI | |BseMII | | | | AluI | | BspCNI | | | SetI | MnlI | | BarI Hpy188I | Tsp4CI* BsiYI* TaqI V C Y L R L F Q L P N P Q N G F L T Q D Y V I F D C S S Y Q I L R M D F * H R M M L S S T V P A T K S S E W I F D T G C ----:----|----:----|----:----|----:----|----:----|----:----| T H * R R S N W S G F G * F P N K V C S Q I N D E V T G A V L D E S H I K S V P Y T I K S Q E L * W I R L I S K Q C L I TstI TstI |FatI | BinI* |FokI | | MaeI |AflIII | | | MboI |BspLU11I* | | | XhoII Csp6I ||CviAII McrI* | | | | DpnI |RsaI ||| NspI |Tsp4CI* | | | | |BstKTI ||BseGI ||| NlaIII ||TspDTI | | | | || MaeI \\\ \\\ \ \\\ \ \ \ \ \\ \ GTACTTCCCACATGTGCCACGACCGTTCCATTTTTTCATCATTTACTAGATCCTCTAGGA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CATGAAGGGTGTACACGGTGCTGGCAAGGTAAAAAAGTAGTAAATGATCTAGGAGATCCT //// / // / / / / /// / / |||TatI | || | Tsp4CI* TstI | ||| | MaeI |||TstI | || | TspDTI | ||| XhoII ||Csp6I | || McrI* | ||| MboI |RsaI | |BspLU11I* | ||DpnI BseGI | |AflIII | |BstKTI | |FokI | MaeI | |FatI BinI* | CviAII NlaIII NspI V L P T C A T T V P F F H H L L D P L G Y F P H V P R P F H F F I I Y * I L * E T S H M C H D R S I F S S F T R S S R K ----:----|----:----|----:----|----:----|----:----|----:----| T S G V H A V V T G N K * * K S S G R P H V E W M H W S R E M K E D N V L D E L Y K G C T G R G N W K K M M * * I R * S XcmI | FatI | |CviAII | ||BsiYI* | ||| NlaIII | ||| |BccI | ||| ||CviJI | ||| |||NlaIV | ||| ||||SduI | ||| ||||BetI* | ||| ||||BspMII* | ||| ||||HgiJII* MnlI | ||| |||||HpaII | MnlI AciI | ||| |||||Hpy178III* | Tth111I | NlaIV | ||| |||||| Tsp4CI* | | Hpy188I | | BseRI | ||| |||||| | Hpy166II \ \ \ \ \ \ \ \\\ \\\\\\ \ \ AAGACTTTGTCAGAGGAGTTGGCGGTTCCATACCCATCATGGGCTCCGGAACTGTAAACA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGAAACAGTCTCCTCAACCGCCAAGGTATGGGTAGTACCCGAGGCCTTGACATTTGT / / / / / / / // // // // / / | | | Hpy188I | BseRI | || || || || | Hpy166II | | Tth111I | NlaIV | || || || || Tsp4CI* | MnlI AciI | || || || |BspMII* MnlI | || || || |BetI* | || || || Hpy178III* | || || || HpaII | || || |NlaIV | || || CviJI | || || BccI | || |HgiJII* | || |FatI | || |SduI | || CviAII | |NlaIII | BsiYI* XcmI K T L S E E L A V P Y P S W A P E L * T R L C Q R S W R F H T H H G L R N C K H D F V R G V G G S I P I M G S G T V N I ----:----|----:----|----:----|----:----|----:----|----:----| F V K D S S N A T G Y G D H A G S S Y V F S K T L P T P P E M G M M P E P V T F L S Q * L L Q R N W V W * P S R F Q L C MaeII | SetI | TaiI Tsp4CI* | | Hpy178III* | TspRI | | | BsrI | |TspEI | | | | PsrI | || PsrI | | | | |MseI | || |FatI | | | | ||HpaI | || ||CviAII | | | | ||TspGWI | || ||| NlaIII | | | | ||HindII | || ||| |MaeII | | | | ||Hpy166II | || ||| || SetI | | | | ||| SetI | || ||| || TaiI | | | | ||| | EcoRV \ \\ \\\ \\ \ \ \ \ \ \\\ \ \ TTGGCACTGTTCAATTACATGACGTATCTTACGTTCCTGATTTACCAGTTAACCTGATAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGTGACAAGTTAATGTACTGCATAGAATGCAAGGACTAAATGGTCAATTGGACTATA / / / // // / / / / / / // / | | PsrI || || MaeII | | | PsrI | |MseI EcoRV | Tsp4CI* || |FatI | | | BsrI | |SetI TspRI || |TaiI | | | | Hpy166II || |SetI | | | | HindII || CviAII | | | | HpaI |NlaIII | | | TspGWI TspEI | | Hpy178III* | MaeII TaiI SetI L A L F N Y M T Y L T F L I Y Q L T * Y W H C S I T * R I L R S * F T S * P D I G T V Q L H D V S Y V P D L P V N L I S ----:----|----:----|----:----|----:----|----:----|----:----| N A S N L * M V Y R V N R I * W N V Q Y M P V T * N C S T D * T G S K G T L R I Q C Q E I V H R I K R E Q N V L * G S I MaeIII Ksp632I* | MaeII | | SetI | | TaiI CviRI* | | |Hpy166II MaeIII | MboII | | ||MnlI Tsp45I \ \ \ \ \\\ \ CCGTTTGAAAACTATGCACTAAATCAAACTCTTCTGTTACGTTCACAAAAGAGGGTGTCA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGCAAACTTTTGATACGTGATTTAGTTTGAGAAGACAATGCAAGTGTTTTCTCCCACAGT / / / // / / / | MboII | || Hpy166II | HphI CviRI* | || MnlI TspRI | |MaeII | MaeIII Ksp632I* TaiI SetI P F E N Y A L N Q T L L L R S Q K R V S R L K T M H * I K L F C Y V H K R G C H V * K L C T K S N S S V T F T K E G V T ----:----|----:----|----:----|----:----|----:----|----:----| G N S F * A S F * V R R N R E C F L T D D T Q F S H V L D F E E T V N V F S P T R K F V I C * I L S K Q * T * L L P H * SfeI* | AluI | BseYI | CviJI HphI | PvuII |Tsp4CI* | NspBII* || TspRI | | SetI MlyI FalI || CviRI* SetI | | | GsaI PleI HinfI FalI \\ \ \ \ \ \ \ \ \ \ CTGTGCAATCACCTGATGATGTGGTTTCTACAGCTGGGTATTCACAATAAAAGACTCTGG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GACACGTTAGTGGACTACTACACCAAAGATGTCGACCCATAAGTGTTATTTTCTGAGACC / / / /// / // // | | SetI ||| BseYI |PleI |HinfI | CviRI* ||NspBII* MlyI FalI Tsp4CI* ||PvuII FalI Tsp45I ||CviJI MaeIII ||AluI ||GsaI |SfeI* SetI L C N H L M M W F L Q L G I H N K R L W C A I T * * C G F Y S W V F T I K D S G V Q S P D D V V S T A G Y S Q * K T L G ----:----|----:----|----:----|----:----|----:----|----:----| S H L * R I I H N R C S P I * L L L S Q V T C D G S S T T E V A P Y E C Y F V R Q A I V Q H H P K * L Q T N V I F S E P AluI TatI CviJI |Csp6I | SetI StyI FalI ||RsaI | Cac8I SecI* FalI CviJI Hpy178III* \\\ \ \ \ \ \ \ GAAGTACAAAGCTCGCCTTGTCGCCCAAGGACATACTCAAAAGGCTGGTATTGACTATCA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCATGTTTCGAGCGGAACAGCGGGTTCCTGTATGAGTTTTCCGACCATAACTGATAGT /// / / / / / / ||| | | Cac8I | SecI* CviJI ||| | CviJI | StyI ||| | AluI FalI ||| SetI FalI ||TatI |Csp6I RsaI E V Q S S P C R P R T Y S K G W Y * L S K Y K A R L V A Q G H T Q K A G I D Y Q S T K L A L S P K D I L K R L V L T I R ----:----|----:----|----:----|----:----|----:----|----:----| S T C L E G Q R G L V Y E F P Q Y Q S D P L V F S A K D G L S M S L L S T N V I F Y L A R R T A W P C V * F A P I S * * BbvI | AsuI* | |CviJI | |HaeIII | |BmgT120I | || NheI | || |MaeI | || ||Cac8I | || ||| TseI SetI TaqI | || ||| AluI | CviRI* |MlyI | || ||| BmtI | | BsrI |PleI HinfI | || ||| CviJI \ \ \ \\ \ \ \\ \\\ \ GGAAACCTTTGCACCAGTCATTCGATATGACTCTGTTAGATTATTTCTGGCCCTTGCTAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTGGAAACGTGGTCAGTAAGCTATACTGAGACAATCTAATAAAGACCGGGAACGATC / / // // / /// / /// | SetI |BsrI |TaqI HinfI ||| | ||CviJI | CviRI* |PleI ||| | ||NheI Hpy178III* MlyI ||| | ||AluI ||| | |MaeI ||| | Cac8I ||| | SetI ||| BmtI ||AsuI* |BmgT120I |BbvI HaeIII CviJI G N L C T S H S I * L C * I I S G P C * E T F A P V I R Y D S V R L F L A L A S K P L H Q S F D M T L L D Y F W P L L A ----:----|----:----|----:----|----:----|----:----|----:----| P F R Q V L * E I H S Q * I I E P G Q * L F G K C W D N S I V R N S * K Q G K S S V K A G T M R Y S E T L N N R A R A L Hpy188I | MaeII FatI | | SetI NcoI | | TaiI StyI BisI | | |HindII SecI* |BlsI | | |Hpy166II DsaI* |SetI MnlI BccI | | || BtsI TspRI |CviAII \\ \ \ \ \ \\ \ \ \\ CTGCCTCAAACTAATAGTATATCAGATGGACGTTGACACTGCGTTTCTAAACTCAACCAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GACGGAGTTTGATTATCATATAGTCTACCTGCAACTGTGACGCAAAGATTTGAGTTGGTA /// / / / / / / / / ||TseI MnlI | | | | Hpy166II | CviAII |BisI | | | | HindII NlaIII BlsI | | | | TspRI | | | | BtsI | | | MaeII | | TaiI | | SetI | Hpy188I BccI L P Q T N S I S D G R * H C V S K L N H C L K L I V Y Q M D V D T A F L N S T M A S N * * Y I R W T L T L R F * T Q P W ----:----|----:----|----:----|----:----|----:----|----:----| S G * V L L I D S P R Q C Q T E L S L W A A E F * Y Y I L H V N V S R K * V * G Q R L S I T Y * I S T S V A N R F E V M NlaIII BssKI | CviJI |AvaI | BseGI |BssKI | | MboI |SecI* | | | DpnI |Cfr9I | | | |BstKTI ||HpaII | | | || FokI ||ScrFI | | | || |MaeII ||CauII* MnlI | | | || ||BsaAI ||BmeT110I MseI | | | || ||SnaBI |||SmaI |HpaI TfiI | | | || ||| SetI |||ScrFI |HindII HinfI | | | || ||| TaiI |||CauII* |Hpy166II | Hpy178III* \ \ \ \\ \\\ \ \\\\ \\ \ \ GGATGAGCCGATCTACGTAAAACAACCACCCGGGTTTGTTAACGAGAGGAATCCCGACTA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CCTACTCGGCTAGATGCATTTTGTTGGTGGGCCCAAACAATTGCTCTCCTTAGGGCTGAT / / / // // /// //// / // / / | | | || || ||FokI |||| | |MseI | Hpy178III* | | | || || |MaeII |||| | Hpy166II HinfI | | | || || SnaBI |||| | HindII TfiI | | | || || BsaAI |||| | HpaI | | | || |TaiI |||| MnlI | | | || |SetI |||BssKI | | | || MboI ||Cfr9I | | | |DpnI ||BssKI | | | BstKTI ||SecI* | | CviJI ||AvaI | BseGI |BmeT110I DsaI* |CauII* SecI* |HpaII StyI |ScrFI NcoI CauII* FatI ScrFI SmaI G * A D L R K T T T R V C * R E E S R L D E P I Y V K Q P P G F V N E R N P D Y M S R S T * N N H P G L L T R G I P T M ----:----|----:----|----:----|----:----|----:----|----:----| P H A S R R L V V V R T Q * R S S D R S H I L R D V Y F L W G P K N V L P I G V S S G I * T F C G G P N T L S L F G S * MlyI HinfI MslI AciI PleI |BceAI CviJI | BstXI \ \ \\ \ \ \ TGTATGGGAACTATACGGCGGTATGTATGGACTCAAACAAGCCCCATTACTATGGAACGA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| ACATACCCTTGATATGCCGCCATACATACCTGAGTTTGTTCGGGGTAATGATACCTTGCT / // / / / / | |PleI BceAI CviJI | MslI | MlyI HinfI BstXI AciI C M G T I R R Y V W T Q T S P I T M E R V W E L Y G G M Y G L K Q A P L L W N E Y G N Y T A V C M D S N K P H Y Y G T N ----:----|----:----|----:----|----:----|----:----|----:----| H I P V I R R Y T H V * V L G M V I S R I Y P F * V A T H I S E F L G W * * P V T H S S Y P P I Y P S L C A G N S H F S SalI |TaqI |AccI ||HindII FatI ||Hin4II* |CviAII ||Hpy166II ||MwoI ||| FatI ||| NlaIII ||| |CviAII ||| |CviJI MseI ||| || NlaIII ||| |TspDTI \ \\\ \\ \ \\\ \\ ACATATCAACAATACTCTTAAAAAGATTGGTTTCTGTCGACATGAAGGCGAACATGGCTT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATAGTTGTTATGAGAATTTTTCTAACCAAAGACAGCTGTACTTCCGCTTGTACCGAA / //// // // /// MseI |||| |FatI || ||CviJI |||| CviAII || |FatI |||NlaIII || TspDTI |||SalI || CviAII ||AccI |NlaIII ||TaqI MwoI |Hpy166II |HindII Hin4II* T Y Q Q Y S * K D W F L S T * R R T W L H I N N T L K K I G F C R H E G E H G L I S T I L L K R L V S V D M K A N M A Y ----:----|----:----|----:----|----:----|----:----|----:----| V Y * C Y E * F S Q N R D V H L R V H S F M D V I S K F L N T E T S M F A F M A C I L L V R L F I P K Q R C S P S C P K AccI |BssNAI |Hpy166II || MaeII || |BsaAI Hpy188I || |SnaBI | BceAI || || AccI | AsuI* || || SetI | AvaII || || TaiI BslFI | |BmgT120I BsrDI || || |Hpy166II | BccI | ||NlaIV | BccI || || || BbvI \ \ \ \\\ \ \ \\ \\ \\ \ ATATTTTCGTTCCACATCTGATGGTCCCATCTACATTGCCGTATACGTAGACGACTTACT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TATAAAAGCAAGGTGTAGACTACCAGGGTAGATGTAACGGCATATGCATCTGCTGAATGA / / / // / / // // // / | | | || | BccI || || |AccI BbvI | | | || BsrDI || || Hpy166II | | | |AvaII || |MaeII | | | |AsuI* || SnaBI | | | BmgT120I || BsaAI | | | NlaIV |AccI | | | BceAI |TaiI | | Hpy188I |SetI | BccI Hpy166II BslFI BssNAI I F S F H I * W S H L H C R I R R R L T Y F R S T S D G P I Y I A V Y V D D L L I F V P H L M V P S T L P Y T * T T Y L ----:----|----:----|----:----|----:----|----:----|----:----| I N E N W M Q H D W R C Q R I R L R S V * I K T G C R I T G D V N G Y V Y V V * Y K R E V D S P G M * M A T Y T S S K S TseI |BisI TspEI ||BlsI MnlI MseI | MseI TspEI \\\ \ \ \ \ \ TGTTGCTGCTCCCTCTCCTAAAATATATGACAGGGTTAAGCAAGAATTAACGAAATTATA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| ACAACGACGAGGGAGAGGATTTTATATACTGTCCCAATTCGTTCTTAATTGCTTTAATAT /// / / // / / ||TseI MnlI MseI |MseI | Hin4II* |BisI TspEI TspEI BlsI C C C S L S * N I * Q G * A R I N E I I V A A P S P K I Y D R V K Q E L T K L Y L L L P L L K Y M T G L S K N * R N Y T ----:----|----:----|----:----|----:----|----:----|----:----| Q Q Q E R E * F I H C P * A L I L S I I K N S S G R R F Y I V P N L L F * R F * T A A G E G L I Y S L T L C S N V F N Y MboI XhoII | DpnI | |BstKTI | || BinI* | || | TspDTI | || | | HindII | || | | Hpy166II | || | | |TaqII | || | | || ApoI | || | | || TspEI | || | | || | SecI* | || | | || | | TspDTI | || | | || | | | MseI Hin4II* | || | | || | | | | MnlI BsmAI \ \ \\ \ \ \\ \ \ \ \ \ \ CTCAATGAAGGATCTCGGTAAAGTTGACAAATTCCTCGGTCTTAACATTCATCAATCGTC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTTACTTCCTAGAGCCATTTCAACTGTTTAAGGAGCCAGAATTGTAAGTAGTTAGCAG // / // // / / / // || | || || | | | |MseI || | || || | | | MnlI || | || || | | SecI* || | || || | TspDTI || | || || TspEI || | || || ApoI || | || |Hpy166II || | || |HindII || | || TaqII || | |BinI* || | TspDTI || XhoII || MboI |DpnI BstKTI L N E G S R * S * Q I P R S * H S S I V S M K D L G K V D K F L G L N I H Q S S Q * R I S V K L T N S S V L T F I N R Q ----:----|----:----|----:----|----:----|----:----|----:----| S L S P D R Y L Q C I G R D * C E D I T V * H L I E T F N V F E E T K V N M L R E I F S R P L T S L N R P R L M * * D D TseI AluI MwoI CviJI |BisI ||BlsI ||SetI Hpy178III* |||CviRI* | BbvI |||| Hpy188I TspGWI | |Hin4II* |||| | SfaNI \ \ \\ \\\\ \ \ AAACGGAGACATCACTCTCTCCCTTCAAGACTATATTGCTAAAGCTGCATCTGAAAGCGA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGCCTCTGTAGTGAGAGAGGGAAGTTCTGATATAACGATTTCGACGTAGACTTTCGCT / / / / / // //// / / BsmAI TspGWI | | BbvI || |||| Hpy188I SfaNI | Hin4II* || |||CviRI* Hpy178III* || |||TseI || ||BisI || |BlsI || CviJI || AluI |SetI MwoI K R R H H S L P S R L Y C * S C I * K R N G D I T L S L Q D Y I A K A A S E S E T E T S L S P F K T I L L K L H L K A K ----:----|----:----|----:----|----:----|----:----|----:----| L R L C * E R G E L S Y Q * L Q M Q F R * V S V D S E G K L V I N S F S C R F A F P S M V R E R * S * I A L A A D S L S BsaXI HinfI | MseI | AciI | |AhaIII* | | BsrBI TaqI | || MlyI | | | CviRI* AsuII | || PleI | | | | BsaXI CviJI | MnlI \ \\ \ \ \ \ \ \ \ \ \ AATAAACACATTTAAACTTACACAGACTCCGCTCTGCAACTCAAAGCCTCTTTTCGAAAC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTGTGTAAATTTGAATGTGTCTGAGGCGAGACGTTGAGTTTCGGAGAAAAGCTTTG / // // / / // / / BsaXI |MseI |PleI | | |BsaXI CviJI AsuII | MlyI | | CviRI* MnlI AhaIII* | BsrBI TaqI | AciI HinfI N K H I * T Y T D S A L Q L K A S F R N I N T F K L T Q T P L C N S K P L F E T * T H L N L H R L R S A T Q S L F S K Q ----:----|----:----|----:----|----:----|----:----|----:----| F L C M * V * V S E A R C S L A E K R F F Y V C K F K C L S R E A V * L R K E F I F V N L S V C V G S Q L E F G R K S V AluI FauI CviJI AciI | SfaNI Hpy188I | SetI \ \ \ \ \ \ AACTTCCCCGCATCTAAAAGACATCACTCCTTATCAGAGCATAGTTGGTCAGCTTCTCTT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAAGGGGCGTAGATTTTCTGTAGTGAGGAATAGTCTCGTATCAACCAGTCGAAGAGAA / / / / / / AciI FauI SfaNI Hpy188I | CviJI | AluI SetI N F P A S K R H H S L S E H S W S A S L T S P H L K D I T P Y Q S I V G Q L L F L P R I * K T S L L I R A * L V S F S F ----:----|----:----|----:----|----:----|----:----|----:----| L K G A D L L C * E K D S C L Q D A E R C S G R M * F V D S R I L A Y N T L K E V E G C R F S M V G * * L M T P * S R K BssKI BsrI EcoRII | BetI* | ScrFI | BspMII* GsuI | BseBI | |HpaII Eco57MI BciVI | | SetI CviRI* | |Hpy178III* |BsrI |BsmAI | | NlaIV \ \ \\ \\ \\ \ \ \ TTGTGCAAATACTGGTCGTCCGGACATATCGTATCCAGTCTCATTACTCTCCAGGTTCCT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AACACGTTTATGACCAGCAGGCCTGTATAGCATAGGTCAGAGTAATGAGAGGTCCAAGGA / / // // / / // // CviRI* BsrI |BspMII* |BsrI BciVI | || |NlaIV |BetI* Eco57MI | || EcoRII | GsuI | || BssKI Hpy178III* | |BseBI HpaII | |ScrFI | SetI BsmAI L C K Y W S S G H I V S S L I T L Q V P C A N T G R P D I S Y P V S L L S R F L V Q I L V V R T Y R I Q S H Y S P G S F ----:----|----:----|----:----|----:----|----:----|----:----| K H L Y Q D D P C I T D L R M V R W T G K T C I S T T R V Y R I W D * * E G P E Q A F V P R G S M D Y G T E N S E L N R TaqI |Hpy178III* || Hin4II* Acc65I || | SetI HgiCI* || | | Hin6I Tsp4CI* || | | FnuDII* HinfI |Csp6I || | | |GlaI | FauI ||RsaI || | | |NmeAIII | | PleI ||NlaIV || | | ||HhaI | | |MlyI ||| KpnI || | | ||| MnlI | | || AciI ||| | SetI \\ \ \ \\\ \ \ \ \\ \ \\\ \ \ TCGAGAACCTCGCGCAATCCATTTGGAGTCTGCTCGGCGGGTTCTACGGTACCTATATAC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTCTTGGAGCGCGTTAGGTAAACCTCAGACGAGCCGCCCAAGATGCCATGGATATATG // // //// / / / / / // /// / || || |||| MnlI | | | AciI || ||HgiCI* Bce83I* || || |||Hin6I | | PleI || ||Acc65I || || ||GlaI | | MlyI || |Csp6I || || |FnuDII* | FauI || NlaIV || || |HhaI HinfI || RsaI || || NmeAIII || SetI || |Hin4II* |KpnI || SetI Tsp4CI* |Hpy178III* TaqI S R T S R N P F G V C S A G S T V P I Y R E P R A I H L E S A R R V L R Y L Y T E N L A Q S I W S L L G G F Y G T Y I P ----:----|----:----|----:----|----:----|----:----|----:----| E L V E R L G N P T Q E A P E V T G I Y K S F R A C D M Q L R S P P N * P V * I R S G R A I W K S D A R R T R R Y R Y V Hpy178III* MseI | MboI | BspCNI | XhoII | |BdaI | | DpnI | |BdaI | | |BstKTI | |BseMII SmlI | | ||DdeI | || SfaNI Bce83I* | BsmAI | | ||| BinI* | || Tsp4CI* \ \ \ \ \ \\\ \ \ \\ \ CACCAGAAGTATGTGTCTCAAGTATCGTTCTGGATCTCAGTTGGCATTAACTGTATATTG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTCTTCATACACAGAGTTCATAGCAAGACCTAGAGTCAACCGTAATTGACATATAAC / / /// / / / /// / / | BsmAI ||| | | BinI* ||| | SfaNI SmlI ||| | DdeI ||| Tsp4CI* ||| XhoII ||MseI ||| MboI |BseMII ||DpnI |BdaI |BstKTI |BdaI Hpy178III* BspCNI H Q K Y V S Q V S F W I S V G I N C I L T R S M C L K Y R S G S Q L A L T V Y C P E V C V S S I V L D L S W H * L Y I V ----:----|----:----|----:----|----:----|----:----|----:----| W W F Y T D * T D N Q I E T P M L Q I N G G S T H T E L I T R S R L Q C * S Y I V L L I H R L Y R E P D * N A N V T Y Q CviRI* | EcoT22I | | FatI BsrI | | |CviAII | MlyI | | || SfaNI | PleI | | || NlaIII | Csp6I | | || | AluI | |RsaI | | || | CviJI | ||BfiI | | || | | SetI | ||MaeII | | || | | | Hpy178III* | |||BsaAI | | || | | | |BdaI | |||MaeIII | | || | | | |BdaI | |||Tsp45I | | || | | | ||MboI | |||| SetI | | || | | | ||| DpnI | |||| TaiI | | || | | | ||| |BstKTI | |||| |HinfI \ \ \\ \ \ \ \\\ \\ \ \\\\ \\ TGATGCATCTCATGGAGCTATTCACGATCTACCACACTCTACTGGGGGGTACGTGACTCT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| ACTACGTAGAGTACCTCGATAAGTGCTAGATGGTGTGAGATGACCCCCCATGCACTGAGA / / / /// // / /// / / ///// // | | | ||| || | ||| MboI BsrI ||||| |HinfI | | | ||| || | ||DpnI ||||| Tsp45I | | | ||| || | |BstKTI ||||| MaeIII | | | ||| || | Hpy178III* ||||MaeII | | | ||| || BdaI |||BsaAI | | | ||| || BdaI ||Csp6I | | | ||| |SfaNI |BfiI | | | ||| CviJI |RsaI | | | ||| AluI |TaiI | | | ||SetI |SetI | | | |FatI |PleI | | | CviAII MlyI | | NlaIII | CviRI* EcoT22I * C I S W S Y S R S T T L Y W G V R D S D A S H G A I H D L P H S T G G Y V T L M H L M E L F T I Y H T L L G G T * L Y ----:----|----:----|----:----|----:----|----:----|----:----| H H M E H L * E R D V V S * Q P T R S E T I C R M S S N V I * W V R S P P V H S S A D * P A I * S R G C E V P P Y T V R SduI HgiAI* | MaeIII | | MaeII | | |BsaAI | | |BsiYI* AluI | | || SetI CviJI Csp6I | | || TaiI |SmlI |RsaI | | || Bce83I* ||SetI TfiI |BseMII | | || | TaqI ||| MboII HinfI ||BspCNI \ \ \\ \ \ \\\ \ \ \\\ ACTTGCTGGTGCTCCCGTTACGTGGTCATCGAAGAAGCTCAAGGGTGTGATTCCTGTACC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TGAACGACCACGAGGGCAATGCACCAGTAGCTTCTTCGAGTTCCCACACTAAGGACATGG / // // / / / / / //// / HgiAI* || |MaeII | | | MboII | |||| MnlI SduI || Bce83I* | | | SmlI | |||Csp6I || MaeIII | | CviJI | ||RsaI || BsaAI | | AluI | |BspCNI |TaiI | SetI | BseMII |SetI TaqI HinfI BsiYI* TfiI T C W C S R Y V V I E E A Q G C D S C T L A G A P V T W S S K K L K G V I P V P L L V L P L R G H R R S S R V * F L Y H ----:----|----:----|----:----|----:----|----:----|----:----| V Q Q H E R * T T M S S A * P H S E Q V * K S T S G N R P * R L L E L T H N R Y S A P A G T V H D D F F S L P T I G T G Tsp4CI* | FatI DdeI | |CviAII TfiI MnlI |BccI CviRI* | || NlaIII HinfI \ \\ \ \ \\ \ \ ATCTACTGAGGCAGAATACATTACTGCAAGTGAAACTGTCATGGAGATATAATGGATTCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TAGATGACTCCGTCTTATGTAATGACGTTCACTTTGACAGTACCTCTATATTACCTAAGT // / / / // / |DdeI CviRI* | | |FatI HinfI BccI | | CviAII TfiI | NlaIII Tsp4CI* I Y * G R I H Y C K * N C H G D I M D S S T E A E Y I T A S E T V M E I * W I Q L L R Q N T L L Q V K L S W R Y N G F K ----:----|----:----|----:----|----:----|----:----|----:----| M * Q P L I C * Q L H F Q * P S I I S E W R S L C F V N S C T F S D H L Y L P N D V S A S Y M V A L S V T M S I Y H I * CviJI HaeIII | Cac8I DdeI | | CviJI NdeI \ \ \ \ \ AAACTTGTTTGAACACTTAGGCCAGCCACTTATCTCATCAACATCATATGTAGATAATAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGAACAAACTTGTGAATCCGGTCGGTGAATAGAGTAGTTGTAGTATACATCTATTATT / / / / / / | | | CviJI NdeI SetI | | Cac8I | HaeIII | CviJI DdeI K L V * T L R P A T Y L I N I I C R * * N L F E H L G Q P L I S S T S Y V D N K T C L N T * A S H L S H Q H H M * I I N ----:----|----:----|----:----|----:----|----:----|----:----| F S T Q V S L G A V * R M L M M H L Y Y L V Q K F V * A L W K D * * C * I Y I I F K N S C K P W G S I E D V D Y T S L L FokI |BspMI || Tsp4CI* SetI || | BseGI BsiI* BsrDI \ \\ \ \ \ \ ACCTGCTATAAAACTGTCTAAACATCCTGTATTTCACACGAGAGCAAAACACATTGCTTT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TGGACGATATTTTGACAGATTTGTAGGACATAAAGTGTGCTCTCGTTTTGTGTAACGAAA // / / / || BseGI BsiI* BsrDI |Tsp4CI* |BspMI FokI T C Y K T V * T S C I S H E S K T H C F P A I K L S K H P V F H T R A K H I A L L L * N C L N I L Y F T R E Q N T L L * ----:----|----:----|----:----|----:----|----:----|----:----| V Q * L V T * V D Q I E C S L L V C Q K F R S Y F Q R F M R Y K V R S C F V N S G A I F S D L C G T N * V L A F C M A K CviRI* | TseI | MwoI | |BisI FatI | |BtsI AflIII | |TspRI BspLU11I* AluI | ||BlsI |CviAII CviJI | ||| Cac8I || NspI |DdeI | ||| | TspEI || NlaIII ||SetI | ||| | | BbvI || | EcoP15I \\\ \ \\\ \ \ \ \\ \ \ GAGATACCACAAGCTAAGAAATGCAGTGGCAGCAGGCATAATTACCATAGAACATGTTAT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTATGGTGTTCGATTCTTTACGTCACCGTCGTCCGTATTAATGGTATCTTGTACAATA / / / / / / / /// / / / / // | | | | | | | ||| Cac8I | BbvI | |BspLU11I* | | | | | | | ||TseI TspEI | |AflIII | | | | | | | |BisI | |FatI | | | | | | | BlsI | CviAII | | | | | | BtsI NlaIII | | | | | MwoI NspI | | | | CviRI* | | | TspRI | | DdeI | CviJI | AluI SetI E I P Q A K K C S G S R H N Y H R T C Y R Y H K L R N A V A A G I I T I E H V I D T T S * E M Q W Q Q A * L P * N M L S ----:----|----:----|----:----|----:----|----:----|----:----| S I G C A L F H L P L L C L * W L V H * Q S V V L * S I C H C C A Y N G Y F M N L Y W L S L F A T A A P M I V M S C T I AluI CviJI PvuII NspBII* | SetI | |TfiI | |HinfI | |Hin4II* | || MseI | || |AhaIII* \ \\ \\ CACAAAGAAACAAGTTGCTGACATATTTACAAAAATCCTTCCAGCTGAATCATTTAAAAC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTTTCTTTGTTCAACGACTGTATAAATGTTTTTAGGAAGGTCGACTTAGTAAATTTTG / / / / / // EcoP15I | | | | |MseI | | | | AhaIII* | | | HinfI | | | TfiI | | Hin4II* | NspBII* | PvuII | CviJI | AluI SetI H K E T S C * H I Y K N P S S * I I * N T K K Q V A D I F T K I L P A E S F K T Q R N K L L T Y L Q K S F Q L N H L K H ----:----|----:----|----:----|----:----|----:----|----:----| * L S V L Q Q C I * L F G E L Q I M * F D C L F L N S V Y K C F D K W S F * K F V F F C T A S M N V F I R G A S D N L V CviJI | FatI MslI | BspHI |FatI | |CviAII ||CviAII | |Hpy178III* ||| NlaIII | || NlaIII NlaIV ||| | TsoI \ \\ \ \ \\\ \ \ ACATAGGGCTGTCATGATAAGGGAACCAGAAACTACAAAATAACCATACTCATGCGTATT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATCCCGACAGTACTATTCCCTTGGTCTTTGATGTTTTATTGGTATGAGTACGCATAA / / // / // /// | | |BspHI NlaIV || ||TsoI | | |FatI || |FatI | | Hpy178III* || CviAII | | CviAII |NlaIII | NlaIII MslI CviJI T * G C H D K G T R N Y K I T I L M R I H R A V M I R E P E T T K * P Y S C V F I G L S * * G N Q K L Q N N H T H A Y S ----:----|----:----|----:----|----:----|----:----|----:----| V Y P Q * S L P V L F * L I V M S M R I C M P S D H Y P F W F S C F L W V * A Y C L A T M I L S G S V V F Y G Y E H T N FokI FatI MseI MaeIII |CviAII |BseGI BstEII SetI || NlaIII \\ \ \ \\ \ CAGTTATGGGGGGATGTTAAATGTGGTAACCTAATAGCATGATATGAGTAATGCTTTAGT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAATACCCCCCTACAATTTACACCATTGGATTATCGTACTATACTCATTACGAAATCA / / /// / // | MseI ||BstEII | |FatI BseGI ||MaeIII | CviAII |FokI NlaIII SetI Q L W G D V K C G N L I A * Y E * C F S S Y G G M L N V V T * * H D M S N A L V V M G G C * M W * P N S M I * V M L * Y ----:----|----:----|----:----|----:----|----:----|----:----| * N H P S T L H P L R I A H Y S Y H K L E T I P P H * I H Y G L L M I H T I S * L * P P I N F T T V * Y C S I L L A K T Hpy166II Hpy188I | SetI \ \ \ ATTGTTTCAGAGTTGTTTCAGTAATGTTTTAGACAAAGAAAACATATAATAGTAAACCTG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAAAGTCTCAACAAAGTCATTACAAAATCTGTTTCTTTTGTATATTATCATTTGGAC / // Hpy188I |SetI Hpy166II I V S E L F Q * C F R Q R K H I I V N L L F Q S C F S N V L D K E N I * * * T C C F R V V S V M F * T K K T Y N S K P V ----:----|----:----|----:----|----:----|----:----|----:----| I T E S N N * Y H K L C L F C I I T F R Y Q K L T T E T I N * V F F V Y L L L G N N * L Q K L L T K S L S F M Y Y Y V Q SetI |TatI ||Csp6I |||RsaI TatI |||ScaI Bsp1407I |||| SmlI |Csp6I |||| AflII |Hpy166II |||| |MseI ||RsaI TspEI \\\\ \\ \\\ \ TAATCAGGTAGTACTTAAGAAACTATACTTTCTGTGTACAAAACACTAACTATGTAATTC 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| ATTAGTCCATCATGAATTCTTTGATATGAAAGACACATGTTTTGTGATTGATACATTAAG / /// // //// / SetI ||| |AflII |||Bsp1407I TspEI ||| |SmlI |||TatI ||| MseI ||Csp6I ||TatI |RsaI |Csp6I Hpy166II ScaI RsaI * S G S T * E T I L S V Y K T L T M * F N Q V V L K K L Y F L C T K H * L C N S I R * Y L R N Y T F C V Q N T N Y V I L ----:----|----:----|----:----|----:----|----:----|----:----| Y D P L V * S V I S E T Y L V S V I Y N T I L Y Y K L F * V K Q T C F V L * T I L * T T S L F S Y K R H V F C * S H L E FatI AflIII BspLU11I* AsuI* |CviAII AvaII || NspI |BmgT120I || NlaIII ||SetI \\ \ \\\ TTACATTTACATAACATGTAGAAAGGTCCAATAAACTTACTATATTATGACATATAAGTT 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTAAATGTATTGTACATCTTTCCAGGTTATTTGAATGATATAATACTGTATATTCAA / // / // | || | |AvaII | || | |AsuI* | || | BmgT120I | || SetI | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI L H L H N M * K G P I N L L Y Y D I * V Y I Y I T C R K V Q * T Y Y I M T Y K L T F T * H V E R S N K L T I L * H I S * ----:----|----:----|----:----|----:----|----:----|----:----| K C K C L M Y F P G I F K S Y * S M Y T R V N V Y C T S L D L L S V I N H C I L * M * M V H L F T W Y V * * I I V Y L N MaeII MboI | SetI | DpnI | TaiI | |BstKTI | |HindII | || TspEI | |Hpy166II \ \\ \ \ \\ AGATCGTAATTCACTACGTCAACA 3130 3140 ----:----|----:----|---- TCTAGCATTAAGTGATGCAGTTGT // / / / / / || MboI | | | Hpy166II |DpnI | | | HindII BstKTI | | MaeII | TaiI | SetI TspEI R S * F T T S T D R N S L R Q X I V I H Y V N X ----:----|----:----|---- L D Y N V V D V * I T I * * T L S R L E S R * C # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 3 FblI,XmiI AciI 6 BspACI,SsiI AflII 2 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 3 AhaIII* 3 DraI AjuI 1 AluI 16 AluBI AlwNI 1 CaiI ApoI 4 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BarI 1 BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 2 BpuEI BceAI 2 BcgI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 2 BetI* 4 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 5 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmeT110I 2 BmgT120I 5 BmtI 1 BspOI BsaAI 4 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 7 BseRI 1 BseYI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 6 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 7 BspHI 1 CciI,PagI,RcaI BspLU11I* 3 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrDI 3 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 10 BstXI 1 BtgZI 1 BtsI 2 Cac8I 4 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr9I 1 TspMI,XmaCI,XmaI Csp6I 10 CviQI,RsaNI CviAII 16 CviJI 34 CviKI-1 CviRI* 12 HpyCH4V DdeI 10 BstDEI,HpyF3I DpnI 10 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco31I 3 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 2 EcoP15I 3 EcoRI 2 EcoRII 4 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 2 Mph1103I,NsiI,Zsp2I FalI 2 FatI 16 FauI 2 SmuI FnuDII* 5 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 2 GsaI 1 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 8 HpyAV Hin6I 2 HinP1I,HspAI HindII 7 HincII HindIII 1 HinfI 16 HpaI 2 KspAI HpaII 5 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 13 Hpy8I Hpy178III* 14 Hpy188III Hpy188I 11 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 10 HpyCH4IV MaeIII 9 MboI 10 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 7 SchI MnlI 15 MseI 18 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 16 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NmeAIII 1 NruI 1 BtuMI,Bsp68I NspBII* 3 MspA1I NspI 4 BstNSI,XceI PleI 7 PpsI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PsrI 1 PvuII 2 RsaI 10 AfaI SalI 1 SapI 1 LguI,PciSI,BspQI ScaI 2 BmcAI,AssI,ZrmI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 43 SfaNI 6 LweI SfeI* 3 BstSFI,SfcI,BfmI SmaI 1 SmlI 4 SmoI SnaBI 2 Eco105I,BstSNI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 10 TaqI 9 TaqII 3 TatI 5 TfiI 9 PfeI TseI 6 ApeKI TsoI 1 Tsp45I 4 NmuCI Tsp4CI* 15 HpyCH4III,TaaI,Bst4CI TspDTI 15 TspEI 17 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 5 TscAI TstI 1 Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XcmI 1 XhoII 5 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AgeI AlfI AloI ApaI ApaLI AscI AvrII BaeI BalI BbvCI BglI BplI Bpu10I BsePI BseSI BsgI BsmI Bsp120I BtrI Cfr10I CfrI ClaI CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EgeI EheI Esp3I EspI* FseI FspAI HaeII Hpy99I KasI MauBI MfeI MluI MmeI MroNI MstI* NaeI NarI NgoMIV NotI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PstI PvuI RsrII SacI SacII SanDI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TauI XbaI XhoI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769