Restriction Map of ADF1/YCL058W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ADF1/YCL058W-A on chromosome III from coordinates 23584 to 23925.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.29885

MwoI | FatI | |CviAII SetI | || NlaIII |TspDTI TatI \ \\ \ \\ \ ATGGGCAAGTGTAGCATGAAAAAGAAAGGTGTGGGCAAGAATGTTGGTGTTGGCAAGAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCGTTCACATCGTACTTTTTCTTTCCACACCCGTTCTTACAACCACAACCGTTCTTT / / // / / MwoI | |FatI | TspDTI | CviAII SetI NlaIII M G K C S M K K K G V G K N V G V G K K W A S V A * K R K V W A R M L V L A R K G Q V * H E K E R C G Q E C W C W Q E S ----:----|----:----|----:----|----:----|----:----|----:----| X P L H L M F F F P T P L F T P T P L F X P C T Y C S F S L H P C S H Q H Q C S H A L T A H F L F T H A L I N T N A L F TaqI SetI |MboI || DpnI || |BstKTI || || AciI Csp6I || || | NspBII* |RsaI || || | | Ksp632I* MaeIII || MnlI || || | | |BsiYI* |MboII \\ \ \\ \\ \ \ \\ \\ GTACAAAAAAAGAGGTCGATCAGCACCGCTGAAAGGAAGAGAACAAAGTTACAAGTGGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CATGTTTTTTTCTCCAGCTAGTCGTGGCGACTTTCCTTCTCTTGTTTCAATGTTCACCTT /// / // / // / / / ||TatI SetI || MboI || Ksp632I* | MaeIII ||MnlI |DpnI |BsiYI* MboII |Csp6I BstKTI NspBII* RsaI TaqI AciI V Q K K R S I S T A E R K R T K L Q V E Y K K R G R S A P L K G R E Q S Y K W K T K K E V D Q H R * K E E N K V T S G K ----:----|----:----|----:----|----:----|----:----|----:----| T C F F L D I L V A S L F L V F N C T S L V F F S T S * C R Q F S S F L T V L P Y L F L P R D A G S F P L S C L * L H F FauI |TseI |Hpy99I ||BisI |||BlsI ||||MnlI ||||TseI TatI |||||BisI |Csp6I BcgI ||||||BlsI ||RsaI | BbvI |||||||AciI |||BcgI MseI EcoP15I | | BbvI |||||||HgaI |||Hpy166II \ \ \ \ \ \\\\\\\\ \\\\ AAGTTAAACAAAAGTAGTGAAACAATGATACCGACGCTGCTGCGGGAGGCAAGTACACAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAATTTGTTTTCATCACTTTGTTACTATGGCTGCGACGACGCCCTCCGTTCATGTGTT / / / / // ////// / / //// MseI EcoP15I BcgI | || |||||| | HgaI |||TatI | || |||||| AciI ||Hpy166II | || |||||TseI ||Csp6I | || ||||BisI |RsaI | || |||BlsI BcgI | || ||TseI | || |BisI | || |MnlI | || BlsI | || FauI | |Hpy99I | BbvI BbvI K L N K S S E T M I P T L L R E A S T Q S * T K V V K Q * Y R R C C G R Q V H K V K Q K * * N N D T D A A A G G K Y T R ----:----|----:----|----:----|----:----|----:----|----:----| F N F L L L S V I I G V S S R S A L V C F T L C F Y H F L S V S A A A P P L Y V L * V F T T F C H Y R R Q Q P L C T C L AluI CviJI | MboI CviJI | BclI | Cac8I | SetI | | AluI | | DpnI | | CviJI | | |BstKTI | | | SetI | | || AsuI* | | | | BseMII | | || AvaII | | | | |BspCNI | | || |BseRI | | | | || BsmAI | | || |BmgT120I | | | | || | AluI | | || ||BssKI | | | | || | CviJI MnlI | | || ||EcoRII | | | | || | |DdeI | CviJI | | || ||| ScrFI | | | | || | ||SetI | |SecI* | | || ||| BseBI \ \ \ \ \\ \ \\\ \ \\ \ \ \\ \\\ \ GAGCCAGCTAAACTGAAAGCTGAGACTACTTTGAAAGCCGAGGAGCTGATCAAGGACCAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGTCGATTTGACTTTCGACTCTGATGAAACTTTCGGCTCCTCGACTAGTTCCTGGTC / / / // / // / / / // / // / / // // | | | |BspCNI | || DdeI MnlI | || | || | | || |BsiYI* | | | BseMII | |BsmAI | || | || | | || BseBI | | CviJI | CviJI | || | || | | || ScrFI | | AluI | AluI | || | || | | |AvaII | Cac8I SetI | || | || | | |AsuI* | SetI | || | || | | BmgT120I CviJI | || | || | BseRI | || | || BclI | || | || MboI | || | |DpnI | || | BstKTI | || CviJI | || AluI | |SetI | SecI* CviJI E P A K L K A E T T L K A E E L I K D Q S Q L N * K L R L L * K P R S * S R T R A S * T E S * D Y F E S R G A D Q G P G ----:----|----:----|----:----|----:----|----:----|----:----| S G A L S F A S V V K F A S S S I L S W L A L * V S L Q S * K S L R P A S * P G L W S F Q F S L S S Q F G L L Q D L V L MlyI PleI | BsiYI* | NmeAIII | | HinfI | | | StyI | | | SecI* | | | | Csp6I | | | | |RsaI ApoI FatI | | | | |SetI TspEI Hpy188I |CviAII \ \ \ \ \\ \ \ \\ GAAAAGGACTCCAAGGTACGAGAGCAAATTCGGACAGAAAAATCAAAAACAAACGACAGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCCTGAGGTTCCATGCTCTCGTTTAAGCCTGTCTTTTTAGTTTTTGTTTGCTGTCG // / / / // // / |PleI | | | |Csp6I |Hpy188I NlaIII NmeAIII | | | RsaI TspEI NspI EcoRII | | SecI* ApoI SphI BssKI | | StyI MlyI | SetI HinfI E K D S K V R E Q I R T E K S K T N D S K R T P R Y E S K F G Q K N Q K Q T T A K G L Q G T R A N S D R K I K N K R Q H ----:----|----:----|----:----|----:----|----:----|----:----| S F S E L T R S C I R V S F D F V F S L P F P S W P V L A F E S L F I L F L R C F L V G L Y S L L N P C F F * F C V V A EcoRV Cac8I MboI | Eco57I | SphI | DpnI | Eco57MI | NspI | |TaqI | |HpaII | NlaIII | |BstKTI | || CviJI \ \ \ \\ \ \\ \ ATGCTGAAGCAGATCGAAATGATATCCGGCTTTTCCTTATAG 310 320 330 340 ----:----|----:----|----:----|----:----|-- TACGACTTCGTCTAGCTTTACTATAGGCCGAAAAGGAATATC /// // // / // ||FatI || |TaqI | |CviJI |CviAII || MboI | HpaII Cac8I |DpnI Eco57MI BstKTI Eco57I EcoRV M L K Q I E M I S G F S L * C * S R S K * Y P A F P Y X A E A D R N D I R L F L I X ----:----|----:----|----:----|----:----|-- M S F C I S I I D P K E K Y C A S A S R F S I R S K R I H Q L L D F H Y G A K G * L # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AluI 3 AluBI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BcgI 1 BclI 1 FbaI,Ksp22I BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseMII 1 BseRI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 1 BssKI 1 BstSCI,StyD4I BstKTI 3 Cac8I 2 BstC8I Csp6I 3 CviQI,RsaNI CviAII 2 CviJI 6 CviKI-1 DdeI 1 BstDEI,HpyF3I DpnI 3 MalI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 2 FauI 1 SmuI HgaI 1 CseI HinfI 1 HpaII 1 HapII,BsiSI,MspI Hpy166II 1 Hpy8I Hpy188I 1 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeIII 1 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 MlyI 1 SchI MnlI 3 MseI 1 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NmeAIII 1 NspBII* 1 MspA1I NspI 1 BstNSI,XceI PleI 1 PpsI RsaI 3 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 6 SphI 1 PaeI,BbuI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaqI 2 TatI 2 TseI 2 ApeKI TspDTI 1 TspEI 1 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BceAI BciVI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseGI BsePI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstF5I BstXI BstZ17I BtgZI BtrI BtsCI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI CviRI* DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinP1I HpaI HphI Hpy178III*HspAI KasI KpnI MaeI MaeII MauBI McrI* MfeI MluI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NotI NruI NsiI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaiI TaqII TauI TfiI TsoI Tsp45I Tsp4CI* TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769