Restriction Map of PDI1/YCL043C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PDI1/YCL043C on chromosome III from coordinates 50221 to 48653.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.13506

EMBOSS_001 FatI |BbvI TseI |CviAII BseRI EcoP15I || AsuI* |BisI | HgiCI* || AvaII ||BlsI | TspDTI || NlaIII |||MnlI BceAI | | NlaIV || |BmgT120I |||| Cac8I MnlI \ \ \ \ \\ \\ \\\\ \ \ ATGAAGTTTTCTGCTGGTGCCGTCCTGTCATGGTCCTCCCTGCTGCTCGCCTCCTCTGTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCAAAAGACGACCACGGCAGGACAGTACCAGGAGGGACGACGAGCGGAGGAGACAA / / / / / ///// / /// / / BceAI | | HgiCI* | ||||| | ||| Cac8I MnlI | NlaIV | ||||| | ||TseI EcoP15I | ||||| | |MnlI TspDTI | ||||| | |BisI | ||||| | BlsI | ||||| BseRI | ||||AvaII | ||||AsuI* | |||BmgT120I | ||BbvI | |FatI | CviAII NlaIII M K F S A G A V L S W S S L L L A S S V * S F L L V P S C H G P P C C S P P L F E V F C W C R P V M V L P A A R L L C F ----:----|----:----|----:----|----:----|----:----|----:----| X F N E A P A T R D H D E R S S A E E T X S T K Q Q H R G T M T R G A A R R R Q H L K R S T G D Q * P G G Q Q E G G R N HinfI | AciI | BbvII* | | DrdI | | NspBII* | | | MboII | | | | MseI | | | | | Eco57I | | | | | Eco57MI BsiYI* | | | | | | CfrI | CviJI | | | | | | | MlyI | | AsuI* | | | | | | | PleI | | |CviJI | | | | | | | BalI | | |HaeIII | | | | | | | CviJI | | |BmgT120I | | | | | | | HaeIII | | ||NlaIV | | | | | | | | BdaI MnlI | | ||| MlyI | | | | | | | | BdaI | MnlI | | ||| PleI | | | | | | | | HinfI \ \ \ \ \\\ \ \ \ \ \ \ \ \ \ \ TTCGCCCAACAAGAGGCTGTGGCCCCTGAAGACTCCGCTGTCGTTAAGTTGGCCACCGAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCGGGTTGTTCTCCGACACCGGGGACTTCTGAGGCGACAGCAATTCAACCGGTGGCTG / / / / ///// // / / // /// / | | BsiYI* CviJI ||||PleI || | | |MseI ||| BdaI | MnlI |||MlyI || | | | ||| BdaI MnlI ||AsuI* || | | | ||CfrI |BmgT120I || | | | |PleI |NlaIV || | | | HaeIII HaeIII || | | | CviJI CviJI || | | | BalI || | | | MlyI || | | Eco57MI || | | Eco57I || | BbvII* || | MboII || NspBII* || AciI |DrdI HinfI F A Q Q E A V A P E D S A V V K L A T D S P N K R L W P L K T P L S L S W P P T R P T R G C G P * R L R C R * V G H R L ----:----|----:----|----:----|----:----|----:----|----:----| K A W C S A T A G S S E A T T L N A V S K R G V L P Q P G Q L S R Q R * T P W R E G L L L S H G R F V G S D N L Q G G V FatI NcoI StyI TatI SecI* |Csp6I DsaI* |Hin4II* BdaI Cac8I |CviAII ||RsaI BdaI | AciI || NlaIII \\\ \ \ \ \\ \ TCCTTCAATGAGTACATTCAGTCGCACGACTTGGTGCTTGCGGAGTTTTTTGCTCCATGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAAGTTACTCATGTAAGTCAGCGTGCTGAACCACGAACGCCTCAAAAAACGAGGTACC / / /// / / / / // HinfI | ||TatI BdaI | AciI | |DsaI* | |Csp6I BdaI Cac8I | |SecI* | RsaI | |StyI Hin4II* | |NcoI | |FatI | BsiYI* | CviAII | PflMI NlaIII S F N E Y I Q S H D L V L A E F F A P W P S M S T F S R T T W C L R S F L L H G L Q * V H S V A R L G A C G V F C S M V ----:----|----:----|----:----|----:----|----:----|----:----| E K L S Y M * D C S K T S A S N K A G H S R * H T C E T A R S P A Q P T K Q E M G E I L V N L R V V Q H K R L K K S W P PflMI BsiYI* | CfrI | | BalI | | CviJI | | HaeIII | | | Tsp4CI* | | | | TspRI | | | | | FatI | | | | | |CviAII | | | | | || NlaIII | | | | | || |CviJI | | | | | || ||NlaIV BsmAI | | | | | || ||| Hpy178III* CviJI | | | | | || ||| | MaeII |AciI | | | | | || ||| | | MseI |BisI | | | | | || ||| | | SetI ||BlsI | | | | | || ||| | | TaiI |||TauI \ \ \ \ \ \\ \\\ \ \ \ \\\\ TGTGGCCACTGTAAGAACATGGCTCCTGAATACGTTAAAGCCGCCGAGACTTTAGTTGAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ACACCGGTGACATTCTTGTACCGAGGACTTATGCAATTTCGGCGGCTCTGAAATCAACTC // / / / //// / / / / ///// || | Tsp4CI* | |||| | | | | ||||BsmAI || CfrI | |||| | | | | |||AciI |HaeIII | |||| | | | | ||BisI |CviJI | |||| | | | | |BlsI |BalI | |||| | | | | CviJI TspRI | |||| | | | | TauI | |||| | | | MseI | |||| | | MaeII | |||| | TaiI | |||| | SetI | |||| Hpy178III* | |||NlaIV | ||CviJI | |FatI | CviAII NlaIII C G H C K N M A P E Y V K A A E T L V E V A T V R T W L L N T L K P P R L * L R W P L * E H G S * I R * S R R D F S * E ----:----|----:----|----:----|----:----|----:----|----:----| H P W Q L F M A G S Y T L A A S V K T S T H G S Y S C P E Q I R * L R R S K L Q T A V T L V H S R F V N F G G L S * N L NmeAIII | StyI | SecI* | | SetI | | | AsuI* | | | |CviJI | | | |HaeIII BssKI | | | |BmgT120I EcoRII | | | || MboI | ScrFI | | | || | DpnI | BseBI | | | || | |TaqI | | MboI | | | || | |BstKTI | | XhoII | | | || | || TatI | | | DpnI | | | || | || Tsp4CI* | | | |AlwNI | | | || | || |Csp6I | | | |BstKTI | | | || | || ||RsaI | | | || BinI* \ \ \ \\ \ \\ \\\ \ \ \ \\ \ AAAAACATTACCTTGGCCCAGATCGACTGTACTGAAAACCAGGATCTGTGTATGGAACAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGTAATGGAACCGGGTCTAGCTGACATGACTTTTGGTCCTAGACACATACCTTGTG / / //// // // / /// //// / / | SetI |||| || || | ||TatI |||| | BinI* NmeAIII |||| || || | |Csp6I |||| XhoII |||| || || | RsaI |||| MboI |||| || || Tsp4CI* |||DpnI |||| || |TaqI ||EcoRII |||| || MboI ||BstKTI |||| |DpnI ||BssKI |||| BstKTI |AlwNI |||AsuI* BseBI ||BmgT120I ScrFI |HaeIII |CviJI SecI* StyI K N I T L A Q I D C T E N Q D L C M E H K T L P W P R S T V L K T R I C V W N T K H Y L G P D R L Y * K P G S V Y G T Q ----:----|----:----|----:----|----:----|----:----|----:----| F F M V K A W I S Q V S F W S R H I S C S F C * R P G S R S Y Q F G P D T Y P V F V N G Q G L D V T S F V L I Q T H F V BdaI BdaI |MseI ||HpaI BssKI ||HindII EcoRII ||Hpy166II |SecI* ||| TaqI ||ScrFI ||| |MboI ||BseBI ||| |BtgZI ||| BdaI ||| || DpnI ||| BdaI ||| || |TaqI ||| |NlaIV ||| || |ClaI ||| || HindIII ||| || |PvuI ||| || | AluI ||| || |McrI* ||| || | CviJI ||| || |BstKTI ||| || | | SetI XmnI MboII ||| || ||MnlI \\\ \\ \ \ \ \ \ \\\ \\ \\\ AACATTCCAGGGTTCCCAAGCTTGAAGATTTTCAAAAACAGCGATGTTAACAACTCGATC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAAGGTCCCAAGGGTTCGAACTTCTAAAAGTTTTTGTCGCTACAATTGTTGAGCTAG /// / / / / / / / // //// ||| | | | | XmnI MboII | |MseI |||BtgZI ||| | | | HindIII | Hpy166II |||MboI ||| | | CviJI | HindII ||MnlI ||| | | AluI | HpaI |DpnI ||| | SetI BdaI BstKTI ||| NlaIV BdaI McrI* ||EcoRII TaqI ||BssKI PvuI ||SecI* |BdaI |BdaI BseBI ScrFI N I P G F P S L K I F K N S D V N N S I T F Q G S Q A * R F S K T A M L T T R S H S R V P K L E D F Q K Q R C * Q L D R ----:----|----:----|----:----|----:----|----:----|----:----| L M G P N G L K F I K L F L S T L L E I C C E L T G L S S S K * F C R H * C S S V N W P E W A Q L N E F V A I N V V R D TspEI | FatI | BspHI | |CviAII | |Hpy178III* AsuI* | || MboI AvaII | || BclI DraII | || |NlaIII PpuMI | || ||DpnI |NlaIV SecI* | || |||BstKTI |BmgT120I BslFI | || ||||NmeAIII || MaeI | CviJI | || ||||| BceAI || |SetI | HaeIII | || ||||| |CviJI || || MnlI | | TspDTI | || ||||| || Cfr10I \\ \\ \ \ \ \ \ \\ \\\\\ \\ \ GATTACGAGGGACCTAGAACTGCCGAGGCCATTGTCCAATTCATGATCAAGCAAAGCCAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATGCTCCCTGGATCTTGACGGCTCCGGTAACAGGTTAAGTACTAGTTCGTTTCGGTT / /// // // / /// / // ClaI ||| |MnlI |HaeIII | ||| BclI |BceAI TaqI ||| MaeI |TspDTI | ||| MboI CviJI ||PpuMI |CviJI | ||NmeAIII ||DraII BslFI | ||DpnI ||AvaII SecI* | |BstKTI ||AsuI* | |BspHI |BmgT120I | |FatI NlaIV | Hpy178III* SetI | CviAII NlaIII TspEI D Y E G P R T A E A I V Q F M I K Q S Q I T R D L E L P R P L S N S * S S K A N L R G T * N C R G H C P I H D Q A K P T ----:----|----:----|----:----|----:----|----:----|----:----| S * S P G L V A S A M T W N M I L C L W R N R P V * F Q R P W Q G I * S * A F G I V L S R S S G L G N D L E H D L L A L AluI CviJI | SetI | | MwoI | | |SetI MboI | | || BsmAI PshAI HpaII | DpnI | | || | GsuI | MaeIII | CviJI MwoI | |BstKTI | | || | Eco57MI | Tsp45I \ \ \ \ \\ \ \ \\ \ \ \ \ CCGGCTGTCGCCGTTGTTGCTGATCTACCAGCTTACCTTGCTAACGAGACTTTTGTCACT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCGACAGCGGCAACAACGACTAGATGGTCGAATGGAACGATTGCTCTGAAAACAGTGA // / // / / / / / / / / |Cfr10I MwoI || | | | MwoI | BsmAI PshAI Tsp45I |CviJI || | | | SetI Eco57MI MaeIII HpaII || | | CviJI GsuI BsrI || | | AluI || | SetI || MboI |DpnI BstKTI P A V A V V A D L P A Y L A N E T F V T R L S P L L L I Y Q L T L L T R L L S L G C R R C C * S T S L P C * R D F C H S ----:----|----:----|----:----|----:----|----:----|----:----| G A T A T T A S R G A * R A L S V K T V V P Q R R Q Q Q D V L K G Q * R S K Q * R S D G N N S I * W S V K S V L S K D S AjuI |FatI |NcoI |StyI |SecI* |DsaI* ||CviAII BetI* ||| CfrI BsrI |HpaII AcyI HgaI SetI ||| |NlaIII \ \\ \ \ \ \\\ \\ CCAGTTATCGTCCAATCCGGTAAGATTGACGCCGACTTCAACGCCACCTTTTACTCCATG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAATAGCAGGTTAGGCCATTCTAACTGCGGCTGAAGTTGCGGTGGAAAATGAGGTAC // / / / / / // |BetI* AcyI | SetI AjuI | |DsaI* HpaII HgaI | |SecI* | |StyI | |NcoI | |FatI | CviAII NlaIII P V I V Q S G K I D A D F N A T F Y S M Q L S S N P V R L T P T S T P P F T P W S Y R P I R * D * R R L Q R H L L L H G ----:----|----:----|----:----|----:----|----:----|----:----| G T I T W D P L I S A S K L A V K * E M E L * R G I R Y S Q R R S * R W R K S W W N D D L G T L N V G V E V G G K V G H AjuI |Tth111I || AciI || |BsmAI || ||NspBII* BalI || ||| MwoI CviJI BsaXI || ||| | BsaXI HaeIII Hin4I || ||| | | Hin4I \ \ \\ \\\ \ \ \ GCCAACAAACACTTCAACGACTACGACTTTGTCTCCGCTGAAAACGCAGACGATGATTTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTGTTTGTGAAGTTGCTGATGCTGAAACAGAGGCGACTTTTGCGTCTGCTACTAAAG / / / / / / / / / | CfrI | BsaXI AjuI Tth111I | | Hin4I HaeIII Hin4I | | BsaXI CviJI | BsmAI BalI | MwoI NspBII* AciI A N K H F N D Y D F V S A E N A D D D F P T N T S T T T T L S P L K T Q T M I S Q Q T L Q R L R L C L R * K R R R * F Q ----:----|----:----|----:----|----:----|----:----|----:----| A L L C K L S * S K T E A S F A S S S K P W C V S * R S R S Q R R Q F R L R H N G V F V E V V V V K D G S F V C V I I E AciI | FatI | NcoI | StyI | SecI* | DsaI* | |CviAII HindIII | || MnlI | AluI | || NlaIII AccI | CviJI | || | BsaXI |BssNAI | |BsaXI | || | | CviJI |Hpy166II | ||SetI EciI | || | | | SfeI* || Tsp4CI* \ \\\ \ \ \\ \ \ \ \ \\ \ AAGCTTTCTATTTACTTGCCCTCCGCCATGGACGAGCCTGTAGTATACAACGGTAAGAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGAAAGATAAATGAACGGGAGGCGGTACCTGCTCGGACATCATATGTTGCCATTCTTT / / / / // /// / / // / | | | EciI || ||| CviJI | |AccI Tsp4CI* | | HindIII || ||BsaXI | Hpy166II | CviJI || |DsaI* | BssNAI | AluI || |SecI* SfeI* BsaXI || |StyI SetI || |NcoI || |FatI || CviAII || MnlI |NlaIII AciI K L S I Y L P S A M D E P V V Y N G K K S F L F T C P P P W T S L * Y T T V R K A F Y L L A L R H G R A C S I Q R * E S ----:----|----:----|----:----|----:----|----:----|----:----| L S E I * K G E A M S S G T T Y L P L F * A K * K S A R R W P R A Q L I C R Y S L K R N V Q G G G H V L R Y Y V V T L F CviJI | EcoRV | |MwoI HgaI CviRI* CviJI \ \\ \ \ \ GCCGATATCGCTGACGCTGATGTTTTTGAAAAATGGTTGCAAGTGGAAGCCTTGCCCTAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCTATAGCGACTGCGACTACAAAAACTTTTTACCAACGTTCACCTTCGGAACGGGATG / / / / / / / | | EcoRV HgaI CviRI* CviJI BsiYI* | MwoI CviJI A D I A D A D V F E K W L Q V E A L P Y P I S L T L M F L K N G C K W K P C P T R Y R * R * C F * K M V A S G S L A L L ----:----|----:----|----:----|----:----|----:----|----:----| A S I A S A S T K S F H N C T S A K G * L R Y R Q R Q H K Q F I T A L P L R A R G I D S V S I N K F F P Q L H F G Q G V MaeII | TaqI HphI | SetI Hpy99I | TaiI TspGWI Tsp4CI* | | Hpy99I BsiYI* | TaqI | NlaIV | | | AciI MaeIII \ \ \ \ \ \ \ \ \ \ TTTGGTGAAATCGACGGTTCCGTTTTCGCCCAATACGTCGAAAGCGGTTTGCCTTTGGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCACTTTAGCTGCCAAGGCAAAAGCGGGTTATGCAGCTTTCGCCAAACGGAAACCCA / / / / / // / / / | | | | NlaIV || | TaqI AciI | | | Tsp4CI* || MaeII | | | HphI |Hpy99I | | TaqI TaiI | Hpy99I SetI TspGWI F G E I D G S V F A Q Y V E S G L P L G L V K S T V P F S P N T S K A V C L W V W * N R R F R F R P I R R K R F A F G L ----:----|----:----|----:----|----:----|----:----|----:----| K P S I S P E T K A W Y T S L P K G K P S Q H F R R N R K R G I R R F R N A K P K T F D V T G N E G L V D F A T Q R Q T FalI FalI CviJI MnlI TspEI | MboII |MboII MnlI CfrI \ \ \ \ \\ \ \ TACTTATTCTACAATGACGAGGAAGAATTGGAAGAATACAAGCCTCTCTTTACCGAGTTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAATAAGATGTTACTGCTCCTTCTTAACCTTCTTATGTTCGGAGAGAAATGGCTCAAC / / / / / / / / MaeIII MnlI | | MboII MboII MnlI FalI | TspEI CviJI FalI FalI FalI Y L F Y N D E E E L E E Y K P L F T E L T Y S T M T R K N W K N T S L S L P S W L I L Q * R G R I G R I Q A S L Y R V G ----:----|----:----|----:----|----:----|----:----|----:----| * K N * L S S S S N S S Y L G R K V S N N S I R C H R P L I P L I C A E R * R T V * E V I V L F F Q F F V L R E K G L Q BalI CviJI HaeIII | FalI TspDTI SfaNI | FalI |TaqI | ApoI | | MnlI SetI SfaNI |ClaI | TspEI \ \ \ \ \ \\ \ \ GCCAAAAAGAACAGAGGTCTAATGAACTTTGTTAGCATCGATGCCAGAAAATTCGGCAGA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTTTTCTTGTCTCCAGATTACTTGAAACAATCGTAGCTACGGTCTTTTAAGCCGTCT / / / / // / / / | | MnlI SetI || ClaI | TspEI | CfrI || TaqI | ApoI HaeIII |TspDTI SfaNI CviJI SfaNI BalI A K K N R G L M N F V S I D A R K F G R P K R T E V * * T L L A S M P E N S A D Q K E Q R S N E L C * H R C Q K I R Q T ----:----|----:----|----:----|----:----|----:----|----:----| A L F F L P R I F K T L M S A L F N P L P W F S C L D L S S Q * C R H W F I R C G F L V S T * H V K N A D I G S F E A S MroNI Cfr10I Hin4II* BccI |HpaII | FatI TspEI |FatI ||NaeI | |CviAII | FokI MnlI ||CviAII ||Cac8I | || NlaIII | | TspDTI BseGI ||| NlaIII \\\ \ \\ \ \ \ \ \ \\\ \ CACGCCGGCAACTTGAACATGAAGGAACAATTCCCTCTATTTGCCATCCACGACATGACT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCGGCCGTTGAACTTGTACTTCCTTGTTAAGGGAGATAAACGGTAGGTGCTGTACTGA /// / / // / / // / // ||| | | |FatI | FokI |MnlI | |FatI ||| | | CviAII TspDTI BseGI | CviAII ||| | NlaIII TspEI NlaIII ||| Hin4II* BccI ||Cfr10I ||MroNI |HpaII Cac8I NaeI H A G N L N M K E Q F P L F A I H D M T T P A T * T * R N N S L Y L P S T T * L R R Q L E H E G T I P S I C H P R H D * ----:----|----:----|----:----|----:----|----:----|----:----| C A P L K F M F S C N G R N A M W S M V V R R C S S C S P V I G E I Q W G R C S V G A V Q V H L F L E R * K G D V V H S BbvII* | Csp6I | |RsaI MboII | |MboII Ksp632I* | TspEI | || Tsp4CI* |MnlI | |MmeI | || | Eco57I || MnlI | || Eco57I | || | Eco57MI || |Hpy188I | || Eco57MI \ \\ \ \ \\ \\ \ \\ \ GAAGACTTGAAGTACGGTTTGCCTCAACTCTCTGAAGAGGCGTTTGACGAATTGAGCGAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTGAACTTCATGCCAAACGGAGTTGAGAGACTTCTCCGCAAACTGCTTAACTCGCTG //// / / // / / / / |||| Eco57MI | |Ksp632I* | | | TspEI |||| Eco57I | |Hpy188I | | Eco57MI |||Tsp4CI* | MnlI | | Eco57I ||Csp6I MnlI | MmeI |RsaI MboII BbvII* MboII E D L K Y G L P Q L S E E A F D E L S D K T * S T V C L N S L K R R L T N * A T R L E V R F A S T L * R G V * R I E R Q ----:----|----:----|----:----|----:----|----:----|----:----| S S K F Y P K G * S E S S A N S S N L S Q L S S T R N A E V R Q L P T Q R I S R F V Q L V T Q R L E R F L R K V F Q A V HinfI | DdeI | | PleI | | |MlyI | | |CviJI | | || TsoI | | || | TfiI MboI | | || | HinfI SfaNI | DpnI | | || | | FalI Hpy178III* | |BstKTI | | || | | FalI MseI | SetI \ \\ \ \ \\ \ \ \ \ \ \ AAGATCGTGTTGGAGTCTAAGGCTATTGAATCTTTGGTTAAGGACTTCTTGAAAGGTGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGCACAACCTCAGATTCCGATAACTTAGAAACCAATTCCTGAAGAACTTTCCACTA // / / / // / / / / // / || MboI | | || FalI HinfI MseI | |SetI FalI |DpnI | | || FalI TfiI | SfaNI FalI BstKTI | | |TsoI Hpy178III* | | CviJI | | PleI | | MlyI | DdeI HinfI K I V L E S K A I E S L V K D F L K G D R S C W S L R L L N L W L R T S * K V M D R V G V * G Y * I F G * G L L E R * C ----:----|----:----|----:----|----:----|----:----|----:----| L I T N S D L A I S D K T L S K K F P S C S R T P T * P * Q I K P * P S R S L H L D H Q L R L S N F R Q N L V E Q F T I MnlI Hpy178III* | MboII | | MboI | | BglII | | XhoII | | | AloI | | | DpnI | | | |BstKTI | | | || TaqI | | | || |Hpy178III* FalI | | | || || TfiI MnlI FalI | | | || || HinfI |MfeI BslFI | | | || || | MboII |TspEI | HphI | | | || || | BbvII* || AloI \ \ \ \ \ \\ \\ \ \ \\ \ GCCTCCCCAATCGTGAAGTCCCAAGAGATCTTCGAGAACCAAGATTCCTCTGTCTTCCAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGGGGTTAGCACTTCAGGGTTCTCTAGAAGCTCTTGGTTCTAAGGAGACAGAAGGTT // / / / / // / // / / / // || | | | | || | || | | | |MnlI || | | | | || | || | | | AloI || | | | | || | || | | BbvII* || | | | | || | || | HinfI || | | | | || | || | TfiI || | | | | || | || MboII || | | | | || | |Hpy178III* || | | | | || | TaqI || | | | | || XhoII || | | | | || BglII || | | | | || MboI || | | | | |DpnI || | | | | BstKTI || | | | AloI || | | MboII || | Hpy178III* || MnlI |BslFI HphI A S P I V K S Q E I F E N Q D S S V F Q P P Q S * S P K R S S R T K I P L S S N L P N R E V P R D L R E P R F L C L P I ----:----|----:----|----:----|----:----|----:----|----:----| A E G I T F D W S I K S F W S E E T K W H R G L R S T G L S R R S G L N R Q R G G G W D H L G L L D E L V L I G R D E L HindII Hpy166II | Hin4II* FatI | | BsiYI* |CviAII | | | MaeII || NlaIII | | | | SetI TatI || | DrdI | | | | TaiI |Csp6I \\ \ \ \ \ \ \ \ \\ TTGGTCGGTAAGAACCATGACGAAATCGTCAACGACCCAAAGAAGGACGTTCTTGTTTTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AACCAGCCATTCTTGGTACTGCTTTAGCAGTTGCTGGGTTTCTTCCTGCAAGAACAAAAC / / // / / / / / / TspEI | || DrdI | | BsiYI* | MaeII MfeI | |FatI | Hin4II* TaiI | CviAII Hpy166II SetI NlaIII HindII L V G K N H D E I V N D P K K D V L V L W S V R T M T K S S T T Q R R T F L F C G R * E P * R N R Q R P K E G R S C F V ----:----|----:----|----:----|----:----|----:----|----:----| N T P L F W S S I T L S G F F S T R T K I P R Y S G H R F R * R G L S P R E Q K Q D T L V M V F D D V V W L L V N K N Q FatI NcoI StyI SecI* DsaI* |CviAII || NlaIII || | PflMI || | BsiYI* AsuI* || | | MaeIII |CviJI MaeI || | | Tsp45I |HaeIII | AluI || | | | Tsp4CI* |BmgT120I | CviJI RsaI || | | | | TspRI ||NlaIV | | SetI \ \\ \ \ \ \ \ \\\ \ \ \ TACTATGCCCCATGGTGTGGTCACTGTAAGAGATTGGCCCCAACTTACCAAGAACTAGCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ATGATACGGGGTACCACACCAGTGACATTCTCTAACCGGGGTTGAATGGTTCTTGATCGA /// / // / / /// /// ||TatI | || | Tsp4CI* ||AsuI* ||CviJI |Csp6I | || | Tsp45I |BmgT120I ||AluI RsaI | || | MaeIII |NlaIV |MaeI | || TspRI HaeIII SetI | |DsaI* CviJI | |SecI* | |StyI | |NcoI | |FatI | BsiYI* | CviAII | PflMI NlaIII Y Y A P W C G H C K R L A P T Y Q E L A T M P H G V V T V R D W P Q L T K N * L L C P M V W S L * E I G P N L P R T S * ----:----|----:----|----:----|----:----|----:----|----:----| Y * A G H H P * Q L L N A G V * W S S A T S H G M T H D S Y S I P G L K G L V L V I G W P T T V T L S Q G W S V L F * S BseGI | Hpy188I | | MaeII | | | Hpy99I FokI | | | |SetI MaeI TspRI |SetI | | | |TaiI | MmeI | HgaI \\ \ \ \ \\ \ \ \ \ GATACCTACGCCAACGCCACATCCGACGTTTTGATTGCTAAACTAGACCACACTGAAAAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGGATGCGGTTGCGGTGTAGGCTGCAAAACTAACGATTTGATCTGGTGTGACTTTTG / / / / / / / / / SetI FokI BseGI | | MaeII | TspRI MnlI | TaiI MmeI | SetI MaeI Hpy188I Hpy99I D T Y A N A T S D V L I A K L D H T E N I P T P T P H P T F * L L N * T T L K T Y L R Q R H I R R F D C * T R P H * K R ----:----|----:----|----:----|----:----|----:----|----:----| S V * A L A V D S T K I A L S S W V S F Q Y R R W R W M R R K S Q * V L G C Q F I G V G V G C G V N Q N S F * V V S F V BssKI SecI* EcoRII Hpy99I MaeIII | ScrFI Hpy188I Hin4II* BstEII | BseBI MnlI | AcyI |TspEI | SetI | | SetI \ \ \ \\ \ \ \ \ \ GATGTCAGAGGCGTCGTAATTGAAGGTTACCCAACAATCGTCTTATACCCAGGTGGTAAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAGTCTCCGCAGCATTAACTTCCAATGGGTTGTTAGCAGAATATGGGTCCACCATTC // / / / / / / //// || | | | | SetI BstEII |||EcoRII || | | | TspEI MaeIII |||BssKI || | | Hin4II* ||SecI* || | AcyI |BseBI || Hpy99I |ScrFI |Hpy188I SetI HgaI D V R G V V I E G Y P T I V L Y P G G K M S E A S * L K V T Q Q S S Y T Q V V R C Q R R R N * R L P N N R L I P R W * E ----:----|----:----|----:----|----:----|----:----|----:----| S T L P T T I S P * G V I T K Y G P P L R H * L R R L Q L N G L L R R I G L H Y I D S A D Y N F T V W C D D * V W T T L Csp6I Hpy166II |RsaI || StyI || SecI* || | BinI* || | |SetI || | || Hpy178III* || | || | MboI || | || | XhoII || | || | | DpnI || | || | | |MlyI || | || | | |PleI || | || | | |BstKTI || | || | | ||StyI || | || | | ||SecI* Hpy188I || | || | | ||| HinfI |TfiI || | || | | ||| | TspDTI |HinfI || | || | | ||| | | TaqI \\ \\ \ \\ \ \ \\\ \ \ \ AAGTCCGAATCTGTTGTGTACCAAGGTTCAAGATCCTTGGACTCTTTATTCGACTTCATC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGGCTTAGACAACACATGGTTCCAAGTTCTAGGAACCTGAGAAATAAGCTGAAGTAG / / /// / / / ///// / / / | HinfI ||| | | | ||||| | TspDTI TaqI | TfiI ||| | | | ||||| | HinfI Hpy188I ||| | | | ||||| SecI* ||| | | | ||||| StyI ||| | | | ||||XhoII ||| | | | ||||MboI ||| | | | ||||PleI ||| | | | |||MlyI ||| | | | ||DpnI ||| | | | |BstKTI ||| | | | Hpy178III* ||| | | BinI* ||| | SecI* ||| | StyI ||| SetI ||Csp6I |RsaI Hpy166II K S E S V V Y Q G S R S L D S L F D F I S P N L L C T K V Q D P W T L Y S T S S V R I C C V P R F K I L G L F I R L H Q ----:----|----:----|----:----|----:----|----:----|----:----| F D S D T T Y W P E L D K S E K N S K M S T R I Q Q T G L N L I R P S K I R S * L G F R N H V L T * S G Q V R * E V E D MaeIII Tsp45I Tsp4CI* | TaqI | | AcyI | | MaeII | | |ZraI | | ||SalI | | ||SgrDI | | ||Hpy99I | | |||TaqI | | |||AccI | | |||SetI | | |||TaiI | | |||AatII | | ||||HindII BbvI | | ||||Hpy166II |CviJI | | |||||Hpy99I ||BssKI | | |||||| Hpy99I ||SecI* | | |||||| Tsp4CI* ||EcoRII | | |||||| | StuI ||| ScrFI | | |||||| | CviJI ||| BseBI | | |||||| | HaeIII ||| | MboII | | |||||| | EcoP15I ||| | |BseMII | | |||||| | | Csp6I ||| | ||BspCNI | | |||||| | | |RsaI ||| | ||| MnlI \ \ \\\\\\ \ \ \\ \\\ \ \\\ \ AAGGAAAACGGTCACTTCGACGTCGACGGTAAGGCCTTGTACGAAGAAGCCCAGGAAAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTTTGCCAGTGAAGCTGCAGCTGCCATTCCGGAACATGCTTCTTCGGGTCCTTTTT / / / ///////// / / // / //// / | | | ||||||||| | | |Csp6I | |||| SetI | | | ||||||||| | | RsaI | |||| MnlI | | | ||||||||| | EcoP15I | |||EcoRII | | | ||||||||| HaeIII | |||BspCNI | | | ||||||||| CviJI | |||BssKI | | | ||||||||| StuI | ||BseMII | | | ||||||||Tsp4CI* | ||MboII | | | |||||||SgrDI | ||SecI* | | | |||||||SalI | |BseBI | | | ||||||AccI | |ScrFI | | | ||||||TaqI | BbvI | | | |||||Hpy166II CviJI | | | |||||HindII | | | ||||Hpy99I | | | |||MaeII | | | |||AcyI | | | ||ZraI | | | |Hpy99I | | | AatII | | | TaqI | | | TaiI | | | SetI | | Hpy99I | Tsp45I | MaeIII Tsp4CI* K E N G H F D V D G K A L Y E E A Q E K R K T V T S T S T V R P C T K K P R K K G K R S L R R R R * G L V R R S P G K S ----:----|----:----|----:----|----:----|----:----|----:----| L S F P * K S T S P L A K Y S S A W S F * P F R D S R R R R Y P R T R L L G P F L F V T V E V D V T L G Q V F F G L F F TseI AluI CviJI |BisI ||BlsI ||SetI ||| DdeI BcgI ||| BbvCI TspEI ||| Bpu10I | MwoI ||| |SfaNI | HgaI MboII ||| || MwoI | | CviJI | MboII ||| || | CviJI | | | SfaNI | Hpy178III* \\\ \\ \ \ \ \ \ \ \ \ GCTGCTGAGGAAGCCGATGCTGACGCTGAATTGGCTGACGAAGAAGATGCCATTCACGAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGACTCCTTCGGCTACGACTGCGACTTAACCGACTGCTTCTTCTACGGTAAGTGCTA //// // / / / / / / / / / / / / |||| || | CviJI | | | | | SfaNI | | | BcgI |||| || SfaNI | | | | HgaI | | Hpy178III* |||| |Bpu10I | | | CviJI | MboII |||| |BbvCI | | TspEI MboII |||| |DdeI | MwoI |||| MwoI BcgI |||TseI ||BisI |BlsI CviJI AluI A A E E A D A D A E L A D E E D A I H D L L R K P M L T L N W L T K K M P F T M C * G S R C * R * I G * R R R C H S R * ----:----|----:----|----:----|----:----|----:----|----:----| A A S S A S A S A S N A S S S S A M * S L Q Q P L R H Q R Q I P Q R L L H W E R S S L F G I S V S F Q S V F F I G N V I TspEI |BcgI \\ GAATTGTAA ----:---- CTTAACATT / TspEI E L * N C X I V X ----:---- S N Y H I T F Q L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 2 FblI,XmiI AciI 6 BspACI,SsiI AcyI 3 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AjuI 1 AloI 1 AluI 5 AluBI AlwNI 1 CaiI ApoI 1 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 4 MlsI,MluNI,MscI,Msp20I BbvCI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 1 BceAI 2 BcgI 1 BclI 1 FbaI,Ksp22I BdaI 4 BetI* 1 BsaWI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 5 Bpu10I 1 BsaXI 2 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseRI 1 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 1 BspHI 1 CciI,PagI,RcaI BsrI 1 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 8 BtgZI 1 Cac8I 3 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 4 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CviAII 10 CviJI 27 CviKI-1 CviRI* 1 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 8 MalI DraII 1 EcoO109I DrdI 2 AasI,DseDI DsaI* 4 BtgI,BstDSI EciI 1 Eco57I 3 AcuI Eco57MI 4 EcoP15I 2 EcoRII 4 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 4 FatI 10 FokI 2 GsuI 1 BpmI HaeIII 9 BsnI,BsuRI,BshFI,PhoI HgaI 4 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 1 Hin4II* 4 HpyAV HindII 3 HincII HindIII 2 HinfI 7 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 4 Hpy99I 7 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 5 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 4 SchI MmeI 2 MnlI 17 MroNI 1 NgoMIV MseI 4 Tru1I,Tru9I MwoI 6 HpyF10VI,BstMWI NaeI 1 PdiI NcoI 4 Bsp19I NlaIII 10 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NmeAIII 2 NspBII* 2 MspA1I PflMI 2 BasI,AccB7I,Van91I PleI 4 PpsI PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PvuI 1 MvrI,Ple19I,BpvUI RsaI 6 AfaI SalI 1 ScrFI 4 BmrFI,MspR9I,Bme1390I SecI* 11 BseDI,BssECI,BsaJI SetI 20 SfaNI 5 LweI SfeI* 1 BstSFI,SfcI,BfmI SgrDI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 7 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 10 TatI 3 TauI 1 TfiI 3 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 9 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI Tth111I 1 PflFI,PsyI,AspI XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AflIII AgeI AhaIII* AlfI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BamHI BarI Bce83I* BciVI BfiI BglI BmeT110I BmtI BplI BsaAI BsaBI BsePI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BstAPI BstXI BtrI BtsI CauII* Cfr9I CspCI DinI DraIII Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FauI FnuDII* FseI FspAI GlaI GsaI HaeII HgiAI* HgiJII* HhaI Hin6I HinP1I HspAI KasI KpnI MauBI MluI Mph1103I MslI MstI* NarI NdeI NheI NotI NruI NsiI NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PsiI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI SwaI TaqII TspMI TstI VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769