Restriction Map of HIS4/YCL030C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

HIS4/YCL030C on chromosome III from coordinates 68333 to 65934.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 MboI | DpnI | |BstKTI | || CviJI | || HaeIII | || | FatI | || | |CviAII Tsp4CI* | || | || NlaIII | MseI | || | || | MnlI TfiI | Hin4I | || | || | Hin4II* HinfI | |TspEI | || | || | | Hin4I \ \ \\ \ \\ \ \\ \ \ \ ATGGTTTTGCCGATTCTACCGTTAATTGATGATCTGGCCTCATGGAATAGTAAGAAGGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAAAACGGCTAAGATGGCAATTAACTACTAGACCGGAGTACCTTATCATTCTTCCTT / / / / / // / / / // / / | | | | | || | | | || | Hin4I | | | | | || | | | || Hin4II* | | | | | || | | | || MnlI | | | | | || | | | |FatI | | | | | || | | | CviAII | | | | | || | | NlaIII | | | | | || | HaeIII | | | | | || | CviJI | | | | | || MboI | | | | | |DpnI | | | | | BstKTI | | | | TspEI | | | MseI | | Tsp4CI* | Hin4I HinfI TfiI M V L P I L P L I D D L A S W N S K K E W F C R F Y R * L M I W P H G I V R R N G F A D S T V N * * S G L M E * * E G I ----:----|----:----|----:----|----:----|----:----|----:----| X T K G I R G N I S S R A E H F L L F S X P K A S E V T L Q H D P R M S Y Y S P H N Q R N * R * N I I Q G * P I T L L F BseMII |CviJI |BspCNI ||AvaI ||XhoI ||SmlI ||PspXI ||BseGI |||TaqI |||BmeT110I |||| CviJI |||| | DdeI Csp6I |||| | FokI MaeII |RsaI |||| | | GsuI XmnI | SetI |SetI |||| | | Eco57MI |TfiI | TaiI || BccI |||| | | |Ksp632I* |HinfI \ \ \\ \ \\\\ \ \ \\ \\ TACGTTTCACTTGTTGGTCAGGTACTTTTGGATGGCTCGAGCCTGAGTAATGAAGAGATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCAAAGTGAACAACCAGTCCATGAAAACCTACCGAGCTCGGACTCATTACTTCTCTAA / / / // / //// /// / // / / / | MaeII | || BccI |||| ||| | || | | HinfI TaiI | |Csp6I |||| ||| | || | | TfiI SetI | RsaI |||| ||| | || | XmnI SetI |||| ||| | || Ksp632I* |||| ||| | |FokI |||| ||| | DdeI |||| ||| Eco57MI |||| ||| GsuI |||| ||CviJI |||| |PspXI |||| |SmlI |||| |XhoI |||| |AvaI |||| BmeT110I |||| TaqI |||CviJI ||BseGI |BspCNI BseMII Y V S L V G Q V L L D G S S L S N E E I T F H L L V R Y F W M A R A * V M K R F R F T C W S G T F G W L E P E * * R D S ----:----|----:----|----:----|----:----|----:----|----:----| Y T E S T P * T S K S P E L R L L S S I I R K V Q Q D P V K P H S S G S Y H L S V N * K N T L Y K Q I A R A Q T I F L N BsrI |MboII ||TspDTI ApoI ||| MnlI XmnI MboII CviJI TspEI \\\ \ \ \ \ \ CTCCAGTTCTCCAAAGAGGAAGAAGTTCCATTGGTGGCTTTGTCCTTGCCAAGTGGTAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GAGGTCAAGAGGTTTCTCCTTCTTCAAGGTAACCACCGAAACAGGAACGGTTCACCATTT / / / / / / | | MnlI XmnI MboII CviJI | TspDTI | MboII BsrI L Q F S K E E E V P L V A L S L P S G K S S S P K R K K F H W W L C P C Q V V N P V L Q R G R S S I G G F V L A K W * I ----:----|----:----|----:----|----:----|----:----|----:----| R W N E L S S S T G N T A K D K G L P L E G T R W L P L L E M P P K T R A L H Y E L E G F L F F N W Q H S Q G Q W T T F TspGWI | BsrDI TspDTI | | SfaNI |Hpy178III* | | |NheI BsrDI || Hin4II* | | ||MaeI | BtgZI || | MboII TspDTI | | |||Cac8I \ \ \\ \ \ \ \ \ \\\\ TTCAGCGATGATGAAATCATTGCCTTCTTGAACAACGGAGTTTCTTCTCTGTTCATTGCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTCGCTACTACTTTAGTAACGGAAGAACTTGTTGCCTCAAAGAAGAGACAAGTAACGA / / / / / / / / / / / TspEI BsrDI | | | MboII TspDTI | BsrDI | Cac8I ApoI | | Hin4II* TspGWI BmtI | Hpy178III* TspDTI BtgZI F S D D E I I A F L N N G V S S L F I A S A M M K S L P S * T T E F L L C S L L Q R * * N H C L L E Q R S F F S V H C * ----:----|----:----|----:----|----:----|----:----|----:----| N L S S S I M A K K F L P T E E R N M A I * R H H F * Q R R S C R L K K E T * Q E A I I F D N G E Q V V S N R R Q E N S MwoI BmtI TsoI MfeI Csp6I CviJI | CviJI TspEI |RsaI \ \ \ \ \\ AGCCAAGATGCTAAAACAGCCGAACACTTGGTTGAACAATTGAATGTACCAAAGGAGCGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGTTCTACGATTTTGTCGGCTTGTGAACCAACTTGTTAACTTACATGGTTTCCTCGCA // // / / // |CviJI |TsoI CviJI TspEI |Csp6I |NheI MwoI MfeI RsaI SfaNI MaeI S Q D A K T A E H L V E Q L N V P K E R A K M L K Q P N T W L N N * M Y Q R S V P R C * N S R T L G * T I E C T K G A C ----:----|----:----|----:----|----:----|----:----|----:----| L W S A L V A S C K T S C N F T G F S R * G L H * F L R V S P Q V I S H V L P A A L I S F C G F V Q N F L Q I Y W L L T TspEI | XcmI Tsp4CI* | | FatI | MboII | | |CviAII ApoI Ksp632I* | | TspDTI | | || NlaIII TspEI \ \ \ \ \ \ \\ \ \ GTTGTTGTGGAAGAGAACGGTGTTTTCTCCAATCAATTCATGGTAAAACAAAAATTCTCG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAACACCTTCTCTTGCCACAAAAGAGGTTAGTTAAGTACCATTTTGTTTTTAAGAGC / / / / / / // / Ksp632I* | | TspDTI | | |FatI TspEI | MboII | | CviAII ApoI Tsp4CI* | NlaIII | TspEI XcmI V V V E E N G V F S N Q F M V K Q K F S L L W K R T V F S P I N S W * N K N S R C C G R E R C F L Q S I H G K T K I L A ----:----|----:----|----:----|----:----|----:----|----:----| T T T S S F P T K E L * N M T F C F N E H Q Q P L S R H K R W D I * P L V F I R N N H F L V T N E G I L E H Y F L F E R FalI FalI TspEI | HindII TspEI | MseI | Hpy166II \ \ \ \ \ CAAGATAAAATTGTGTCCATAAAGAAATTAAGCAAGGATATGTTGACCAAAGAAGTGCTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTATTTTAACACAGGTATTTCTTTAATTCGTTCCTATACAACTGGTTTCTTCACGAA / // / / TspEI |MseI FalI Hpy166II TspEI FalI HindII Q D K I V S I K K L S K D M L T K E V L K I K L C P * R N * A R I C * P K K C L R * N C V H K E I K Q G Y V D Q R S A W ----:----|----:----|----:----|----:----|----:----|----:----| C S L I T D M F F N L L S I N V L S T S A L Y F Q T W L S I L C P Y T S W L L A L I F N H G Y L F * A L I H Q G F F H K Csp6I |RsaI ||MaeII |||BsaAI |||SnaBI ||||Csp6I |||||RsaI |||||SetI SalI |||||TaiI Tsp4CI* |TaqI ||||||HphI | Hpy178III* |AccI ||||||FalI | | CspCI ||HindII ||||||FalI | | |Tsp4CI* MaeI ||Hpy166II \\\\\\\ \ \ \\ \ \\\ GGTGAAGTACGTACAGACCGTCCTGACGGTTTATATACCACCCTAGTTGTCGACCAATAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTTCATGCATGTCTGGCAGGACTGCCAAATATATGGTGGGATCAACAGCTGGTTATA ////// / // / / /// / |||||| | || Tsp4CI* MaeI ||SalI CspCI |||||| | |CspCI |AccI |||||| | Hpy178III* |TaqI |||||| Tsp4CI* Hpy166II |||||Csp6I HindII ||||HphI ||||RsaI |||MaeII ||SnaBI ||BsaAI |Csp6I FalI FalI RsaI TaiI SetI G E V R T D R P D G L Y T T L V V D Q Y V K Y V Q T V L T V Y I P P * L S T N M * S T Y R P S * R F I Y H P S C R P I * ----:----|----:----|----:----|----:----|----:----|----:----| P S T R V S R G S P K Y V V R T T S W Y Q H L V Y L G D Q R N I Y W G L Q R G I T F Y T C V T R V T * I G G * N D V L I CviJI HaeIII | TaqI | ClaI TaqI SfeI* | | BstXI CspCI MaeI MboII AsuII | MboII | | |BccI \ \ \ \ \ \ \ \ \\ GAGCGTTGTCTAGGGTTGGTGTATTCTTCGAAGAAATCTATAGCAAAGGCCATCGATTTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGCAACAGATCCCAACCACATAAGAAGCTTCTTTAGATATCGTTTCCGGTAGCTAAAC / / / // / / / / | MboII AsuII |SfeI* | | | BccI MaeI TaqI MboII | | ClaI | | TaqI | BstXI HaeIII CviJI E R C L G L V Y S S K K S I A K A I D L S V V * G W C I L R R N L * Q R P S I W A L S R V G V F F E E I Y S K G H R F G ----:----|----:----|----:----|----:----|----:----|----:----| S R Q R P N T Y E E F F D I A F A M S K H A N D L T P T N K S S I * L L P W R N L T T * P Q H I R R L F R Y C L G D I Q Hpy178III* | MboI | | DpnI | | |BstKTI | | || TspDTI MaeI TstI | | || | BinI* \ \ \ \ \\ \ \ GGTCGTGGCGTTTATTATTCTCGTTCTAGGAATGAAATCTGGATCAAGGGTGAAACTTCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGCACCGCAAATAATAAGAGCAAGATCCTTACTTTAGACCTAGTTCCCACTTTGAAGA / /// / / / MaeI ||| | BinI* HphI TstI ||| TspDTI TstI ||| MboI ||DpnI |BstKTI Hpy178III* G R G V Y Y S R S R N E I W I K G E T S V V A F I I L V L G M K S G S R V K L L S W R L L F S F * E * N L D Q G * N F W ----:----|----:----|----:----|----:----|----:----|----:----| P R P T * * E R E L F S I Q I L P S V E P D H R K N N E N * S H F R S * P H F K T T A N I I R T R P I F D P D L T F S R HphI | TstI | |CfrI | || BalI | || CviJI SfaNI | || HaeIII |Tsp4CI* | || |BsrDI || TfiI | || || HindIII || HinfI | || || | AluI || | Hpy188I | || || | CviJI || | | BseGI FokI | || || | | SetI || | | |MseI | MmeI \ \\ \\ \ \ \ \\ \ \ \\ \ \ GGCAATGGCCAAAAGCTTTTACAAATCTCTACTGACTGTGATTCGGATGCCTTAAAGTTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTTACCGGTTTTCGAAAATGTTTAGAGATGACTGACACTAAGCCTACGGAATTTCAAA // / / / / / / // / / / || | | | HindIII | | || | | MmeI || | | CviJI | | || | MseI || | | AluI | | || BseGI || | SetI | | |Hpy188I || CfrI | | HinfI |HaeIII | | TfiI |CviJI | SfaNI |BalI Tsp4CI* BsrDI G N G Q K L L Q I S T D C D S D A L K F A M A K S F Y K S L L T V I R M P * S L Q W P K A F T N L Y * L * F G C L K V Y ----:----|----:----|----:----|----:----|----:----|----:----| P L P W F S K C I E V S Q S E S A K F N Q C H G F A K V F R * Q S H N P H R L T A I A L L K * L D R S V T I R I G * L K ApoI AclI Hin4I FatI TspEI MaeII BsaXI |CviAII EcoRI | SetI | BsmAI |Tth111I BsaXI | TaiI | Eco31I || NlaIII | Hin4I \ \ \ \ \\ \ \ \ ATCGTTGAACAAGAAAACGTTGGATTTTGCCACTTGGAGACCATGTCTTGCTTTGGTGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCAACTTGTTCTTTTGCAACCTAAAACGGTGAACCTCTGGTACAGAACGAAACCACTT / / / / / / / /// / FokI | | | BsaXI | | ||FatI BsaXI | | Hin4I | | |CviAII Hin4I | MaeII | | Tth111I | AclI | NlaIII TaiI Eco31I SetI BsmAI I V E Q E N V G F C H L E T M S C F G E S L N K K T L D F A T W R P C L A L V N R * T R K R W I L P L G D H V L L W * I ----:----|----:----|----:----|----:----|----:----|----:----| I T S C S F T P N Q W K S V M D Q K P S * R Q V L F R Q I K G S P S W T K S Q H D N F L F V N S K A V Q L G H R A K T F FatI CviJI GsuI |HphI |MaeI Eco57MI |CviAII || TfiI | CviJI MnlI || NlaIII || HinfI | |SfeI* | Hpy178III* \\ \ \\ \ \ \\ \ \ TTCAAGCATGGTTTGGTGGGGCTAGAATCTTTACTAAAACAAAGGCTACAGGACGCTCCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTCGTACCAAACCACCCCGATCTTAGAAATGATTTTGTTTCCGATGTCCTGCGAGGT / / // / / / / / / / / | | |FatI | | HinfI | | | MnlI Hpy178III* | | CviAII | | TfiI | | SfeI* | NlaIII | MaeI | CviJI | HphI CviJI Eco57MI EcoRI GsuI TspEI ApoI F K H G L V G L E S L L K Q R L Q D A P S S M V W W G * N L Y * N K G Y R T L Q Q A W F G G A R I F T K T K A T G R S R ----:----|----:----|----:----|----:----|----:----|----:----| N L C P K T P S S D K S F C L S C S A G I * A H N P P A L I K V L V F A V P R E E L M T Q H P * F R * * F L P * L V S W BbvII* |MlyI |PleI || MboII HgaI || | HinfI MboI | TfiI || | | SfaNI | DpnI | HinfI MaeI || | | |CviRI* | |BstKTI \ \ \ \\ \ \ \\ \ \\ GAGGAATCTTATACTAGAAGACTATTCAACGACTCTGCATTGTTAGATGCCAAGATCAAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTAGAATATGATCTTCTGATAAGTTGCTGAGACGTAACAATCTACGGTTCTAGTTC // / // / / / / // / |HinfI MaeI || | | | SfaNI || MboI |TfiI || | | CviRI* |DpnI HgaI || | HinfI BstKTI || BbvII* || MboII |PleI MlyI E E S Y T R R L F N D S A L L D A K I K R N L I L E D Y S T T L H C * M P R S R G I L Y * K T I Q R L C I V R C Q D Q G ----:----|----:----|----:----|----:----|----:----|----:----| S S D * V L L S N L S E A N N S A L I L L P I K Y * F V I * R S Q M T L H W S * L F R I S S S * E V V R C Q * I G L D L AluI CviJI | SetI BbvI | | BseMII AluI TseI | | |BspCNI Eco57I CviJI CviJI | | ||MboII DdeI Eco57MI | SetI |BisI | | ||| MnlI | MboII |Hin4II* | |MnlI ||BlsI \ \ \\\ \ \ \ \\ \ \\ \\\ GAAGAAGCTGAAGAACTGACTGAGGCAAAGGGTAAGAAGGAGCTTTCTTGGGAGGCTGCC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTCGACTTCTTGACTGACTCCGTTTCCCATTCTTCCTCGAAAGAACCCTCCGACGG / / // / / / / / / / / / / //// | | || | MnlI | | | Hin4II* | | | BbvI |||TseI | | || MboII | | Eco57MI | | MnlI ||BisI | | |BspCNI | | Eco57I | CviJI |BlsI | | BseMII | DdeI | AluI CviJI | CviJI MboII SetI | AluI SetI E E A E E L T E A K G K K E L S W E A A K K L K N * L R Q R V R R S F L G R L P R S * R T D * G K G * E G A F L G G C R ----:----|----:----|----:----|----:----|----:----|----:----| S S A S S S V S A F P L F S S E Q S A A P L L Q L V S Q P L P Y S P A K K P P Q F F S F F Q S L C L T L L L K R P L S G CviRI* | CfrI | | BalI | | CviJI | | HaeIII | | |BsrI | | |TspRI AcyI | | || TspEI MaeII | | || | BstXI |ZraI | | || | | CfrI || TaqI | | || | | | BalI || SetI | | || | | | CviJI || TaiI | | || | | | HaeIII || AatII | | || | | | |TspDTI Hin4II* || |Hpy178III* \ \ \\ \ \ \ \\ \ \\ \\ GATTTGTTCTACTTTGCACTGGCCAAATTAGTGGCCAACGATGTTTCATTGAAGGACGTC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAACAAGATGAAACGTGACCGGTTTAATCACCGGTTGCTACAAAGTAACTTCCTGCAG / / // / / / // / / //// | | || | | | || CfrI Hin4II* |||MaeII | | || | | | |HaeIII |||AcyI | | || | | | |CviJI ||ZraI | | || | | | |BalI |Hpy99I | | || | | | TspDTI AatII | | || | | TspEI TaiI | | || | BstXI SetI | | || CfrI | | |HaeIII | | |CviJI | | |BalI | | BsrI | CviRI* TspRI D L F Y F A L A K L V A N D V S L K D V I C S T L H W P N * W P T M F H * R T S F V L L C T G Q I S G Q R C F I E G R R ----:----|----:----|----:----|----:----|----:----|----:----| S K N * K A S A L N T A L S T E N F S T R N T R S Q V P W I L P W R H K M S P R I Q E V K C Q G F * H G V I N * Q L V D Eco57I Hin4II* Eco57MI | Hpy188I | DdeI | | SfaNI | EspI* | | MaeIII | |TspGWI | | |TspDTI | MmeI || CviJI Hpy99I Hpy188I | | ||SetI SfaNI | SetI || |HphI \ \ \ \ \\\ \ \ \ \\ \\ GAGAATAATCTGAATATGAAGCATCTGAAGGTTACAAGACGGAAAGGTGATGCTAAGCCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTATTAGACTTATACTTCGTAGACTTCCAATGTTCTGCCTTTCCACTACGATTCGGT // / / / // // // / / // || Hpy188I | | || |MaeIII || MmeI | |CviJI |Hpy178III* | | || SfaNI |Eco57MI | |HphI TaqI | | |TspDTI |Eco57I | EspI* | | SetI |SetI | DdeI | Hpy188I SfaNI TspGWI Hin4II* E N N L N M K H L K V T R R K G D A K P R I I * I * S I * R L Q D G K V M L S Q E * S E Y E A S E G Y K T E R * C * A K ----:----|----:----|----:----|----:----|----:----|----:----| S F L R F I F C R F T V L R F P S A L G R S Y D S Y S A D S P * L V S L H H * A L I I Q I H L M Q L N C S P F T I S L W MboII | AgeI | BetI* | MboII | Cfr10I | |HpaII | || AsuI* | || AvaII | || |Eco57I | || |Eco57MI MaeII | || |BmgT120I |BtrI CviJI | || || TspEI |Hin4II* \ \ \\ \\ \ \\ AAGTTTGTTGGACAACCAAAGGCTGAAGAAGAAAAACTGACCGGTCCAATTCACTTGGAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAACAACCTGTTGGTTTCCGACTTCTTCTTTTTGACTGGCCAGGTTAAGTGAACCTG / / / ///// / /// CviJI | | ||||| TspEI ||BtrI | | ||||AvaII |Hin4II* | | ||||AsuI* TaiI | | |||BmgT120I SetI | | ||Cfr10I | | ||BetI* | | ||AgeI | | |HpaII | | Eco57MI | | Eco57I | MboII MboII K F V G Q P K A E E E K L T G P I H L D S L L D N Q R L K K K N * P V Q F T W T V C W T T K G * R R K T D R S N S L G R ----:----|----:----|----:----|----:----|----:----|----:----| F N T P C G F A S S S F S V P G I * K S L T Q Q V V L P Q L L F V S R D L E S P L K N S L W L S F F F F Q G T W N V Q V CviJI SetI | HphI Hin4II* CviJI TaiI | Hpy188I | CviRI* |MmeI BsgI \ \ \ \ \ \\ \ GTGGTGAAGGCTTCCGACAAAGTTGGTGTGCAGAAGGCTTTGAGCAGACCAATCCAAAAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CACCACTTCCGAAGGCTGTTTCAACCACACGTCTTCCGAAACTCGTCTGGTTAGGTTTTC / / / / / // / MaeII | Hpy188I | | |CviJI BsgI | HphI | | MmeI CviJI | CviRI* Hin4II* V V K A S D K V G V Q K A L S R P I Q K W * R L P T K L V C R R L * A D Q S K R G E G F R Q S W C A E G F E Q T N P K D ----:----|----:----|----:----|----:----|----:----|----:----| T T F A E S L T P T C F A K L L G I W F R P S P K R C L Q H A S P K S C V L G F H H L S G V F N T H L L S Q A S W D L L MboI Hpy188I | DpnI Hpy188I CviRI* | |BstKTI MaeIII | TspEI | EcoT22I | || TaqI BsmAI | SetI \ \ \ \ \ \\ \ \ \ \ ACTTCTGAAATTATGCATTTAGTCAATCCGATCATCGAAAATGTTAGAGACAAAGGTAAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGACTTTAATACGTAAATCAGTTAGGCTAGTAGCTTTTACAATCTCTGTTTCCATTG / // / / // / / / / / | || CviRI* | || | TaqI BsmAI SetI MaeIII | |EcoT22I | || MboI | TspEI | |DpnI Hpy188I | BstKTI Hpy188I T S E I M H L V N P I I E N V R D K G N L L K L C I * S I R S S K M L E T K V T F * N Y A F S Q S D H R K C * R Q R * L ----:----|----:----|----:----|----:----|----:----|----:----| V E S I I C K T L G I M S F T L S L P L S K Q F * A N L * D S * R F H * L C L Y S R F N H M * D I R D D F I N S V F T V TatI |Csp6I ||RsaI |||Hpy166II |||| BccI TspEI MseI \\\\ \ \ \ TCTGCCCTTTTGGAGTACACAGAAAAGTTTGATGGTGTAAAATTATCCAATCCTGTTCTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGGGAAAACCTCATGTGTCTTTTCAAACTACCACATTTTAATAGGTTAGGACAAGAA /// / / ||TatI BccI TspEI |Hpy166II |Csp6I RsaI S A L L E Y T E K F D G V K L S N P V L L P F W S T Q K S L M V * N Y P I L F L C P F G V H R K V * W C K I I Q S C S * ----:----|----:----|----:----|----:----|----:----|----:----| E A R K S Y V S F N S P T F N D L G T R S Q G K P T C L F T Q H H L I I W D Q E R G K Q L V C F L K I T Y F * G I R N K Hin4II* | MboII | | MnlI HindIII | | SetI | AluI | | |MseI | CviJI | | || SecI* | | SetI | | || | AjuI | | | AsuI* | | || | | Hin4II* | | | AvaII \ \ \\ \ \ \ \ \ \ \ AATGCTCCATTCCCAGAAGAATACTTTGAAGGTTTAACCGAGGAAATGAAGGAAGCTTTG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGAGGTAAGGGTCTTCTTATGAAACTTCCAAATTGGCTCCTTTACTTCCTTCGAAAC / / / / / // // / / / / MseI | | | | |MseI |SecI* | | | TspDTI | | | | AjuI Hin4II* | | HindIII | | | MnlI | CviJI | | SetI | AluI | MboII SetI Hin4II* N A P F P E E Y F E G L T E E M K E A L M L H S Q K N T L K V * P R K * R K L W C S I P R R I L * R F N R G N E G S F G ----:----|----:----|----:----|----:----|----:----|----:----| L A G N G S S Y K S P K V S S I F S A K * H E M G L L I S Q L N L R P F S P L K I S W E W F F V K F T * G L F H L F S Q MaeII | SetI | TaiI | |BbvI | |AciI | || ApoI | || TspEI | || | FatI | || | |CviAII TspDTI | || | || TseI BmgT120I | || | || NlaIII | SetI | || | || |BisI | | MfeI | || | || ||BlsI BsmAI | | TspEI | || | || ||| MfeI | MlyI HinfI | | | AjuI | || | || ||| TspEI | PleI | Hpy178III* \ \ \ \ \ \\ \ \\ \\\ \ \ \ \ \ GACCTTTCAATTGAAAACGTCCGCAAATTCCATGCTGCTCAATTGCCAACAGAGACTCTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGAAAGTTAACTTTTGCAGGCGTTTAAGGTACGACGAGTTAACGGTTGTCTCTGAGAA /// / / / / / / // ///// / /// / / ||| AjuI | | | | | || ||||TseI | ||BsmAI | Hpy178III* ||AvaII | | | | | || |||BisI | |PleI HinfI ||AsuI* | | | | | || ||BlsI | MlyI |BmgT120I | | | | | || |FatI TspEI SetI | | | | | || CviAII MfeI | | | | | |NlaIII | | | | | TspEI | | | | | ApoI | | | | BbvI | | | AciI | | MaeII | TaiI | SetI TspEI MfeI D L S I E N V R K F H A A Q L P T E T L T F Q L K T S A N S M L L N C Q Q R L L P F N * K R P Q I P C C S I A N R D S * ----:----|----:----|----:----|----:----|----:----|----:----| S R E I S F T R L N W A A * N G V S V R P G K L Q F R G C I G H Q E I A L L S E V K * N F V D A F E M S S L Q W C L S K BssKI SexAI EcoRII | ScrFI Hpy178III* | BseBI | TfiI | |SetI | HinfI MnlI \ \\ \ \ \ GAAGTTGAAACCCAACCTGGTGTCTTGTGTTCCAGATTCCCTCGTCCTATTGAAAAAGTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAACTTTGGGTTGGACCACAGAACACAAGGTCTAAGGGAGCAGGATAACTTTTTCAA / / / / / / | | EcoRII | HinfI MnlI | | SexAI | TfiI | | BssKI Hpy178III* | BseBI | ScrFI SetI E V E T Q P G V L C S R F P R P I E K V K L K P N L V S C V P D S L V L L K K L S * N P T W C L V F Q I P S S Y * K S W ----:----|----:----|----:----|----:----|----:----|----:----| S T S V W G P T K H E L N G R G I S F T Q L Q F G V Q H R T N W I G E D * Q F L F N F G L R T D Q T G S E R T R N F F N TatI |Csp6I BssKI ||RsaI SecI* ||ScaI EcoRII ||| CviRI* | ScrFI ||| | MseI | BseBI BtsI TspRI ||| | VspI \ \ \ \ \\\ \ \ GGTTTGTATATCCCTGGTGGCACTGCCATTTTACCAAGTACTGCATTAATGCTTGGTGTT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAACATATAGGGACCACCGTGACGGTAAAATGGTTCATGACGTAATTACGAACCACAA //// /// / / |||TspRI ||| | VspI |||BtsI ||| | MseI ||EcoRII ||| CviRI* ||BssKI ||TatI |SecI* |Csp6I BseBI ScaI ScrFI RsaI G L Y I P G G T A I L P S T A L M L G V V C I S L V A L P F Y Q V L H * C L V F F V Y P W W H C H F T K Y C I N A W C S ----:----|----:----|----:----|----:----|----:----|----:----| P K Y I G P P V A M K G L V A N I S P T Q N T Y G Q H C Q W K V L Y Q M L A Q H T Q I D R T A S G N * W T S C * H K T N MwoI BstAPI | BsaXI SfaNI | | BsiYI* CviRI* BsaXI BccI Hpy188I \ \ \ \ \ \ \ CCAGCACAAGTTGCCCAATGTAAGGAGATTGTGTTTGCATCTCCACCAAGAAAATCTGAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGTGTTCAACGGGTTACATTCCTCTAACACAAACGTAGAGGTGGTTCTTTTAGACTA / / / / / / / / | | BsiYI* | BsaXI | | Hpy188I | BsaXI CviRI* | BccI BstAPI SfaNI MwoI P A Q V A Q C K E I V F A S P P R K S D Q H K L P N V R R L C L H L H Q E N L M S T S C P M * G D C V C I S T K K I * W ----:----|----:----|----:----|----:----|----:----|----:----| G A C T A W H L S I T N A D G G L F D S E L V L Q G I Y P S Q T Q M E V L F I Q W C L N G L T L L N H K C R W W S F R I Hin6I |GlaI ||HhaI HphI |||HaeII \ \\\\ GGTAAAGTTTCACCCGAAGTTGTTTATGTCGCAGAAAAAGTTGGCGCTTCCAAGATTGTT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTTCAAAGTGGGCTTCAACAAATACAGCGTCTTTTTCAACCGCGAAGGTTCTAACAA / //// HphI |||Hin6I ||GlaI |HhaI HaeII G K V S P E V V Y V A E K V G A S K I V V K F H P K L F M S Q K K L A L P R L F * S F T R S C L C R R K S W R F Q D C S ----:----|----:----|----:----|----:----|----:----|----:----| P L T E G S T T * T A S F T P A E L I T H Y L K V R L Q K H R L F L Q R K W S Q T F N * G F N N I D C F F N A S G L N N MaeI | AluI | BceAI | CviJI | | SetI | | | MwoI | | | HgiCI* TseI | | | | BbvI MwoI | | | | NlaIV |BisI | | | | | SduI ||BlsI | | | | | BseSI ||| MwoI XmnI Hin4I | | | | | | CviJI ||| | CviJI | BslFI Hin4I \ \ \ \ \ \ \ \\\ \ \ \ \ \ CTAGCTGGTGGTGCCCAAGCCGTTGCTGCTATGGCTTACGGGACAGAAACTATTCCTAAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GATCGACCACCACGGGTTCGGCAACGACGATACCGAATGCCCTGTCTTTGATAAGGATTT /// // // / / / / /// / / / / ||| || || | | | | ||MwoI CviJI XmnI | BslFI ||| || || | | | | ||TseI Hin4I ||| || || | | | | |BisI Hin4I ||| || || | | | | BlsI ||| || || | | | MwoI ||| || || | | CviJI ||| || || | BbvI ||| || || HgiCI* ||| || |NlaIV ||| || BseSI ||| || SduI ||| |MwoI ||| BceAI ||CviJI ||AluI |MaeI SetI L A G G A Q A V A A M A Y G T E T I P K * L V V P K P L L L W L T G Q K L F L K S W W C P S R C C Y G L R D R N Y S * S ----:----|----:----|----:----|----:----|----:----|----:----| R A P P A W A T A A I A * P V S V I G L E L Q H H G L R Q Q * P K R S L F * E * * S T T G L G N S S H S V P C F S N R F MboI BglII XhoII | DpnI | |BstKTI | || AsuI* | || AvaII | || |NlaIV | || |BmgT120I | || ||BssKI | || ||EcoRII | || ||| ScrFI | || ||| BseBI | || ||| | SetI | || ||| | | TspEI | || ||| | | | Hin4I AciI | || ||| | | | Hin4I BisI | || ||| | | | |MaeIII |BlsI | || ||| | | | |Tsp45I ||TauI Bce83I* \ \\ \\\ \ \ \ \\ \\\ \ GTGGATAAGATCTTGGGTCCAGGTAATCAATTTGTGACTGCCGCCAAAATGTATGTTCAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTATTCTAGAACCCAGGTCCATTAGTTAAACACTGACGGCGGTTTTACATACAAGTT // / ///// / / / / //// / || | ||||| | | TspEI | |||AciI Bce83I* || | ||||| | Hin4I | ||BisI || | ||||| | Hin4I | |BlsI || | ||||| EcoRII | TauI || | ||||| BssKI Tsp45I || | ||||BseBI MaeIII || | ||||ScrFI || | |||SetI || | ||AvaII || | ||AsuI* || | |BmgT120I || | NlaIV || XhoII || BglII || MboI |DpnI BstKTI V D K I L G P G N Q F V T A A K M Y V Q W I R S W V Q V I N L * L P P K C M F K G * D L G S R * S I C D C R Q N V C S K ----:----|----:----|----:----|----:----|----:----|----:----| T S L I K P G P L * N T V A A L I Y T * L P Y S R P D L Y D I Q S Q R W F T H E H I L D Q T W T I L K H S G G F H I N L Cac8I | AluI | CviJI | PvuII | NspBII* | | SetI | | Cac8I | | |AsuI* | | ||CviJI AluI | | ||HaeIII CviJI | | ||BmgT120I SmlI | SetI MslI | | ||| TsoI BcgI \ \ \ \ \ \ \\\ \ \ AATGACACTCAAGCTCTATGTTCCATTGATATGCCAGCTGGCCCAAGTGAAGTTTTGGTT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTGTGAGTTCGAGATACAAGGTAACTATACGGTCGACCGGGTTCACTTCAAAACCAA /// / / / / //// / ||CviJI MslI | | | |||TsoI BcgI ||AluI | | | ||AsuI* |SmlI | | | |BmgT120I SetI | | | HaeIII | | | CviJI | | Cac8I | NspBII* | PvuII | CviJI | AluI Cac8I SetI N D T Q A L C S I D M P A G P S E V L V M T L K L Y V P L I C Q L A Q V K F W L * H S S S M F H * Y A S W P K * S F G Y ----:----|----:----|----:----|----:----|----:----|----:----| F S V * A R H E M S I G A P G L S T K T F H C E L E I N W Q Y A L Q G L H L K P I V S L S * T G N I H W S A W T F N Q N MboII |TspDTI || BcgI Cac8I || | Hin4I | AluI || | Hin4I | CviJI SfaNI || | | CviRI* | | SetI \ \\ \ \ \ \ \ \ ATTGCCGATGAAGATGCCGATGTGGATTTTGTTGCAAGTGATTTGCTATCGCAAGCTGAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGGCTACTTCTACGGCTACACCTAAAACAACGTTCACTAAACGATAGCGTTCGACTT / / // / / / / SfaNI | |BcgI CviRI* | | Hin4I | Hin4I | | Hin4I | Hin4I | CviJI TspDTI | AluI MboII Cac8I SetI I A D E D A D V D F V A S D L L S Q A E L P M K M P M W I L L Q V I C Y R K L N C R * R C R C G F C C K * F A I A S * T ----:----|----:----|----:----|----:----|----:----|----:----| I A S S S A S T S K T A L S K S D C A S * Q R H L H R H P N Q Q L H N A I A L Q N G I F I G I H I K N C T I Q * R L S F Hin4I Hin4I MseI |MlyI |HpaI |PleI |HindII ApoI |Tsp4CI* |Hpy166II TspEI || FalI || SmlI | Hpy178III* || FalI || |FalI | | SfaNI || | HinfI || |FalI | | Bce83I* \\ \ \ \\ \\ \ \ \ CACGGTATTGACTCCCAAGTTATCCTTGTTGGTGTTAACTTGAGCGAAAAGAAAATTCAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCCATAACTGAGGGTTCAATAGGAACAACCACAATTGAACTCGCTTTTCTTTTAAGTT /// / /// / // / ||PleI HinfI ||MseI SmlI || Hpy178III* |MlyI |Hpy166II |Bce83I* Tsp4CI* |HindII TspEI FalI |HpaI ApoI FalI FalI FalI H G I D S Q V I L V G V N L S E K K I Q T V L T P K L S L L V L T * A K R K F K R Y * L P S Y P C W C * L E R K E N S R ----:----|----:----|----:----|----:----|----:----|----:----| C P I S E W T I R T P T L K L S F F I * V R Y Q S G L * G Q Q H * S S R F S F E V T N V G L N D K N T N V Q A F L F N L MaeII Hpy166II AflIII | HindIII |PmaCI TfiI | | AluI |BsaAI HinfI | | CviJI || SetI | Hpy178III* | | | SetI || TaiI \ \ \ \ \ \ \\ \ GAGATTCAAGATGCTGTCCACAATCAAGCTTTACAACTGCCACGTGTGGATATTGTTCGT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAAGTTCTACGACAGGTGTTAGTTCGAAATGTTGACGGTGCACACCTATAACAAGCA / / / / / / / / // / | | | | | | HindIII | || AflIII | | | | | CviJI | |MaeII | | | | | AluI | BsaAI | | | | SetI | PmaCI | | | Hpy166II TaiI | | Hpy178III* SetI | HinfI | TfiI SfaNI E I Q D A V H N Q A L Q L P R V D I V R R F K M L S T I K L Y N C H V W I L F V D S R C C P Q S S F T T A T C G Y C S * ----:----|----:----|----:----|----:----|----:----|----:----| S I * S A T W L * A K C S G R T S I T R L S E L H Q G C D L K V V A V H P Y Q E L N L I S D V I L S * L Q W T H I N N T Tsp4CI* |Csp6I ||RsaI MaeIII ||| MboI Tsp45I ||| | DpnI | FalI ||| | |PvuI | FalI ||| | |McrI* | | MaeIII ||| | |BstKTI | | Tsp4CI* CviJI MboII \\\ \ \\ \ \ \ \ \ AAATGTATTGCTCACAGTACGATCGTTCTTTGTGACGGTTACGAAGAAGCCCTTGAAATG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACATAACGAGTGTCATGCTAGCAAGAAACACTGCCAATGCTTCTTCGGGAACTTTAC / // // / / / / / / | || || MboI FalI | MaeIII | MboII | || |DpnI FalI Tsp4CI* CviJI | || BstKTI Tsp45I | || McrI* MaeIII | || PvuI | |Csp6I | RsaI Tsp4CI* K C I A H S T I V L C D G Y E E A L E M N V L L T V R S F F V T V T K K P L K C M Y C S Q Y D R S L * R L R R S P * N V ----:----|----:----|----:----|----:----|----:----|----:----| L H I A * L V I T R Q S P * S S A R S I Y I Y Q E C Y S R E K H R N R L L G Q F F T N S V T R D N K T V T V F F G K F H MmeI FalI |TfiI FalI CviRI* |HinfI MseI \ \ \\ \ TCCAACCAATATGCACCAGAACATTTGATTCTACAAATCGCCAATGCTAACGATTATGTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGGTTATACGTGGTCTTGTAAACTAAGATGTTTAGCGGTTACGATTGCTAATACAA / / / / FalI CviRI* MmeI HinfI FalI TfiI S N Q Y A P E H L I L Q I A N A N D Y V P T N M H Q N I * F Y K S P M L T I M L Q P I C T R T F D S T N R Q C * R L C * ----:----|----:----|----:----|----:----|----:----|----:----| D L W Y A G S C K I R C I A L A L S * T T W G I H V L V N S E V F R W H * R N H G V L I C W F M Q N * L D G I S V I I N HindII Hpy166II | TspGWI | | CviRI* | | | AsuI* | | | AvaII | | | |NlaIV Hpy178III* | | | |BmgT120I | AciI | | | || GsuI | TfiI | MaeIII TspEI | | | ||TaqII Eco57MI | HinfI | Tsp45I \ \ \ \ \\\ \ \ \ \ \ AAATTGGTTGACAATGCAGGGTCCGTATTTGTGGGTGCTTACACTCCAGAATCGTGCGGT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACCAACTGTTACGTCCCAGGCATAAACACCCACGAATGTGAGGTCTTAGCACGCCA / / // / //// / / / / | | || | |||| Eco57MI | HinfI AciI | | || | |||| GsuI | TfiI | | || | |||AvaII Hpy178III* | | || | |||AsuI* | | || | ||BmgT120I | | || | |NlaIV | | || | TaqII | | || CviRI* | | |TspGWI | | Hpy166II | | HindII | TspEI MseI K L V D N A G S V F V G A Y T P E S C G N W L T M Q G P Y L W V L T L Q N R A V I G * Q C R V R I C G C L H S R I V R * ----:----|----:----|----:----|----:----|----:----|----:----| L N T S L A P D T N T P A * V G S D H P * I P Q C H L T R I Q P H K C E L I T R F Q N V I C P G Y K H T S V S W F R A T TsoI | SetI TatI HphI | PflMI |Csp6I | Csp6I | BsiYI* ||RsaI | |RsaI TsoI | | MaeIII MaeI ||| Tsp4CI* \ \\ \ \ \ \ \ \\\ \ GACTATTCAAGTGGTACTAACCATACATTACCAACCTATGGTTACGCTAGGCAGTACAGT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTGATAAGTTCACCATGATTGGTATGTAATGGTTGGATACCAATGCGATCCGTCATGTCA / / // / /// / / //// | HphI |Csp6I TsoI ||BsiYI* | MaeI |||Tsp4CI* Tsp45I RsaI ||PflMI MaeIII |||TatI MaeIII |SetI ||Csp6I TsoI |RsaI TspRI D Y S S G T N H T L P T Y G Y A R Q Y S T I Q V V L T I H Y Q P M V T L G S T V L F K W Y * P Y I T N L W L R * A V Q W ----:----|----:----|----:----|----:----|----:----|----:----| S * E L P V L W V N G V * P * A L C Y L H S N L H Y * G Y M V L R H N R * A T C V I * T T S V M C * W G I T V S P L V T HgiCI* | NlaIV | TspRI | | BtsI | | | MwoI | | | | CviRI* | | | | | TspRI Hin4II* | | | | | | SetI | BtsI TspRI Hin4II* SetI \ \ \ \ \ \ \ \ \ \ \ \ GGTGCCAACACTGCAACCTTCCAAAAGTTTATCACTGCCCAAAACATTACCCCTGAAGGT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGGTTGTGACGTTGGAAGGTTTTCAAATAGTGACGGGTTTTGTAATGGGGACTTCCA / /// / / / / / / | ||MwoI | SetI | TspRI Hin4II* SetI | |TspRI CviRI* | BtsI | |BtsI Hin4II* | HgiCI* NlaIV G A N T A T F Q K F I T A Q N I T P E G V P T L Q P S K S L S L P K T L P L K V C Q H C N L P K V Y H C P K H Y P * R F ----:----|----:----|----:----|----:----|----:----|----:----| P A L V A V K W F N I V A W F M V G S P H H W C Q L R G F T * * Q G F C * G Q L T G V S C G E L L K D S G L V N G R F T XbaI Eco57I |MaeI Eco57MI |Hpy178III* | AluI || MaeIII | CviJI Hin4II* || Tsp45I | | SetI | MnlI || Tsp4CI* \ \ \ \ \ \\ \ TTAGAAAACATCGGTAGAGCTGTTATGTGCGTTGCCAAGAAGGAGGGTCTAGACGGTCAC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTTTGTAGCCATCTCGACAATACACGCAACGGTTCTTCCTCCCAGATCTGCCAGTG / / / / / // / / | | CviJI | MnlI || | Tsp45I | | AluI Hin4II* || | MaeIII | SetI || Tsp4CI* Eco57MI |XbaI Eco57I Hpy178III* MaeI L E N I G R A V M C V A K K E G L D G H * K T S V E L L C A L P R R R V * T V T R K H R * S C Y V R C Q E G G S R R S Q ----:----|----:----|----:----|----:----|----:----|----:----| K S F M P L A T I H T A L F S P R S P * N L F C R Y L Q * T R Q W S P P D L R D * F V D T S S N H A N G L L L T * V T V HindIII | AluI | CviJI | | SetI | | |BinI* | | || MboI | | || | DpnI Hpy188I | | || | |BstKTI BsrI \ \ \ \\ \ \\ \ AGAAACGCTGTGAAAATCAGAATGAGTAAGCTTGGGTTGATCCCAAAGGATTTCCAGTAG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTGCGACACTTTTAGTCTTACTCATTCGAACCCAACTAGGGTTTCCTAAAGGTCATC / / / / / // / / Hpy188I | | | | || MboI BsrI | | | | |DpnI | | | | BstKTI | | | BinI* | | HindIII | CviJI | AluI SetI R N A V K I R M S K L G L I P K D F Q * E T L * K S E * V S L G * S Q R I S S X K R C E N Q N E * A W V D P K G F P V X ----:----|----:----|----:----|----:----|----:----|----:----| L F A T F I L I L L S P N I G F S K W Y C F R Q S F * F S Y A Q T S G L P N G T S V S H F D S H T L K P Q D W L I E L L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AjuI 1 AluI 11 AluBI ApoI 5 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI BalI 3 MlsI,MluNI,MscI,Msp20I BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 2 BpuEI BceAI 1 BcgI 1 BetI* 1 BsaWI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 1 BmgT120I 5 BmtI 1 BspOI BsaAI 2 BstBAI,Ppu21I BsaXI 2 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 2 BsrDI 3 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstAPI 1 BstKTI 7 BstXI 2 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 3 Cac8I 4 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 3 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 9 CviQI,RsaNI CspCI 1 CviAII 5 CviJI 32 CviKI-1 CviRI* 10 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 7 MalI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 4 AcuI Eco57MI 7 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 6 FatI 5 FokI 2 GlaI 1 GsuI 3 BpmI HaeII 1 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 12 HpyAV Hin6I 1 HinP1I,HspAI HindII 4 HincII HindIII 4 HinfI 12 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 8 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 9 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 8 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 14 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 3 MunI MlyI 3 SchI MmeI 4 MnlI 8 MseI 8 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PflMI 1 BasI,AccB7I,Van91I PleI 3 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PspXI 1 PvuI 1 MvrI,Ple19I,BpvUI PvuII 1 RsaI 9 AfaI SalI 1 ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 29 SexAI 1 MabI SfaNI 8 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 3 SmoI SnaBI 1 Eco105I,BstSNI TaiI 7 TaqI 6 TaqII 1 TatI 3 TauI 1 TfiI 9 PfeI TseI 3 ApeKI TsoI 4 Tsp45I 4 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 18 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 5 TscAI TstI 1 Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XbaI 1 XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflII AhaIII* AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvrII BaeI BamHI BarI BbvCI BciVI BclI BdaI BfiI BglI BplI Bpu10I BsaBI BsePI BseRI BseYI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BsrBI BssNAI Bst1107I BstEII BstZ17I CauII* Cfr9I DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRV EgeI EheI Esp3I FauI FnuDII* FseI FspAI GsaI HgiAI* HgiJII* KasI KpnI MauBI MluI MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NmeAIII NotI NruI NspI OliI PacI PasI PfoI PmeI PpiI PpuMI PshAI PsiI PspOMI PsrI PstI RsrII SacI SacII SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TspMI XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769