Restriction Map of YCL020W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YCL020W on chromosome III from coordinates 85102 to 86418.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.29985

FatI |CviAII ||Ksp632I* MboII ||| NlaIII TspDTI ||| | Hin6I | MaeII ||| | |GlaI TfiI | | SetI ||| | ||HhaI HinfI TspEI | | TaiI ||| | |||HaeII MaeIII \ \ \ \ \ \\\ \ \\\\ \ ATGGAATCCCAACAATTACATCAAAATCCACGTTCTCTTCATGGTAGCGCCTATGCTTCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTAGGGTTGTTAATGTAGTTTTAGGTGCAAGAGAAGTACCATCGCGGATACGAAGC / / // / / / /// //// HinfI TspEI || | MaeII | ||| |||Hin6I TfiI || TaiI | ||| ||GlaI || SetI | ||| |HhaI |MboII | ||| HaeII TspDTI | ||Ksp632I* | |FatI | CviAII NlaIII M E S Q Q L H Q N P R S L H G S A Y A S W N P N N Y I K I H V L F M V A P M L R G I P T I T S K S T F S S W * R L C F G ----:----|----:----|----:----|----:----|----:----|----:----| X S D W C N C * F G R E R * P L A * A E X P I G V I V D F D V N E E H Y R R H K H F G L L * M L I W T R K M T A G I S R TspGWI | BceAI | BinI* | | BccI | | |Hpy178III* MwoI | | || MboI | AluI | | || XhoII | CviJI | | || | DpnI | | SetI BslFI DdeI | | || | |BstKTI CviJI | | | TspEI BetI* \ \ \ \ \\ \ \\ \ \ \ \ \ \ GTTACTTCTAAGGAAGTCCCATCAAATCAAGATCCGTTAGCCGTTTCAGCTTCCAATTTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGAAGATTCCTTCAGGGTAGTTTAGTTCTAGGCAATCGGCAAAGTCGAAGGTTAAAT / / / /// /// / / / / / / | DdeI | ||| ||| XhoII | | | CviJI TspEI MaeIII | ||| ||| MboI | | | AluI BslFI | ||| ||DpnI | | SetI | ||| |BstKTI | MwoI | ||| | CviJI | ||| Hpy178III* | ||BccI | |BceAI | BinI* TspGWI V T S K E V P S N Q D P L A V S A S N L L L L R K S H Q I K I R * P F Q L P I Y Y F * G S P I K S R S V S R F S F Q F T ----:----|----:----|----:----|----:----|----:----|----:----| T V E L S T G D F * S G N A T E A E L K P * K * P L G M L D L D T L R K L K W N N S R L F D W * I L I R * G N * S G I * BssKI EcoRII |SecI* HpaII MseI ||ScrFI | ApoI TfiI SetI ||BseBI | TspEI HinfI DdeI |TspEI BsmAI |||SetI \ \ \ \ \\ \ \\\\ CCGGAATTTGATAGAGATTCCACTAAGGTTAATTCTCAACAAGAGACAACACCTGGGACA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTTAAACTATCTCTAAGGTGATTCCAATTAAGAGTTGTTCTCTGTTGTGGACCCTGT // / / // / / / / / / || TspEI HinfI |DdeI | TspEI BsmAI | | EcoRII || ApoI TfiI SetI MseI | | BssKI |BetI* | | SecI* HpaII | BseBI | ScrFI SetI P E F D R D S T K V N S Q Q E T T P G T R N L I E I P L R L I L N K R Q H L G H G I * * R F H * G * F S T R D N T W D I ----:----|----:----|----:----|----:----|----:----|----:----| G S N S L S E V L T L E * C S V V G P V V P I Q Y L N W * P * N E V L S L V Q S R F K I S I G S L N I R L L L C C R P C MslI BseRI AluI |FatI CviJI ||CviAII PvuII |||BccI SetI NspBII* |||| NlaIII | MnlI | SetI |||| |Eco57I | | BspMI | | BslFI |||| |Eco57MI | | |Csp6I | | |Hpy178III* |||| || BsmAI | | ||RsaI SetI \ \ \\ \\\\ \\ \ \ \ \\\ \ TCAGCTGTTCCAGAGAACCATCATCATGTCTCTCCTCAACCTGCTTCAGTACCACCTCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCGACAAGGTCTCTTGGTAGTAGTACAGAGAGGAGTTGGACGAAGTCATGGTGGAGGT / / // / // // // / //// | NspBII* |BslFI | || |FatI |SetI MnlI |||SetI | PvuII | | || Eco57MI BsmAI ||BspMI | CviJI | | || CviAII |Csp6I | AluI | | || Eco57I RsaI SetI | | || BccI | | |NlaIII | | MslI | BseRI Hpy178III* S A V P E N H H H V S P Q P A S V P P P Q L F Q R T I I M S L L N L L Q Y H L H S C S R E P S S C L S S T C F S T T S T ----:----|----:----|----:----|----:----|----:----|----:----| D A T G S F W * * T E G * G A E T G G G M L Q E L S G D D H R E E V Q K L V V E * S N W L V M M M D R R L R S * Y W R W AluI CviJI PflMI Tsp4CI* FatI | SetI BsiYI* |Csp6I |CviAII | | CviJI |MnlI ||RsaI || NlaIII BceAI | | HaeIII BsiYI* \\ \\\ \\ \ \ \ \ \ \ CAGAATGGACAGTACCAACAGCACGGCATGATGACCCCAAACAAAGCTATGGCCTCTAAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTACCTGTCATGGTTGTCGTGCCGTACTACTGGGGTTTGTTTCGATACCGGAGATTG / / / // / // / / / / / | MnlI | |Csp6I | |FatI | | CviJI | BsiYI* BsiYI* | RsaI | CviAII | | AluI HaeIII PflMI Tsp4CI* NlaIII | SetI CviJI BceAI Q N G Q Y Q Q H G M M T P N K A M A S N R M D S T N S T A * * P Q T K L W P L T E W T V P T A R H D D P K Q S Y G L * L ----:----|----:----|----:----|----:----|----:----|----:----| C F P C Y W C C P M I V G F L A I A E L V S H V T G V A R C S S G L C L * P R * L I S L V L L V A H H G W V F S H G R V MaeII AflIII MnlI |BtrI MaeII |BsrI || SetI |MaeIII || SduI || TaiI |Tsp45I || BseSI || | Hpy166II || SetI || | BfiI Tsp4CI* || | | HphI || TaiI SetI \\ \ \ \ \\ \ \ \ \\ \ \ TGGGCACATTACCAACAACCGTCTATGATGACGTGTTCACATTATCAAACGTCACCTGCG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCGTGTAATGGTTGTTGGCAGATACTACTGCACAAGTGTAATAGTTTGCAGTGGACGC / / / / // / / / / / / / BseSI BfiI Tsp4CI* | || | | HphI | | | Tsp45I MnlI | || | Hpy166II | | | MaeIII BsrI | || AflIII | | SetI SduI | |MaeII | MaeII | BtrI TaiI TaiI SetI SetI W A H Y Q Q P S M M T C S H Y Q T S P A G H I T N N R L * * R V H I I K R H L R G T L P T T V Y D D V F T L S N V T C V ----:----|----:----|----:----|----:----|----:----|----:----| Q A C * W C G D I I V H E C * * V D G A S P V N G V V T * S S T N V N D F T V Q P C M V L L R R H H R T * M I L R * R R DdeI BetI* | TatI |HpaII | |HphI || AsuI* | |Csp6I || AvaII | |TspRI || |BmgT120I Tsp4CI* | ||RsaI AarI || ||NlaIV | BseMII | ||ScaI BspMI || ||TspGWI TstI | |BspCNI | |||TstI \ \\ \\\ \ \ \\ \ \\\\ TATTATCAACCGGACCCACACTATCCGTTGCCACAGTATATCCCACCACTGAGTACTTCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATAGTTGGCCTGGGTGTGATAGGCAACGGTGTCATATAGGGTGGTGACTCATGAAGG / //// / / // / / / /// | |||| TstI | || TspRI | | ||TatI | |||AvaII | |BspCNI | | |Csp6I | |||AsuI* | BseMII | | ScaI | ||BmgT120I Tsp4CI* | | RsaI | ||NlaIV | DdeI | |BetI* | HphI | TspGWI TstI | HpaII BspMI AarI Y Y Q P D P H Y P L P Q Y I P P L S T S I I N R T H T I R C H S I S H H * V L P L S T G P T L S V A T V Y P T T E Y F L ----:----|----:----|----:----|----:----|----:----|----:----| Y * * G S G C * G N G C Y I G G S L V E T N D V P G V S D T A V T Y G V V S Y K I I L R V W V I R Q W L I D W W Q T S G TfiI HinfI |BdaI |BdaI || Bce83I* || | Hpy188I || | | Csp6I || | | |RsaI || | | |BseMII || | | ||BspCNI || | | ||| SmlI || | | ||| |SetI BinI* || | | ||| ||BsmAI | MboI || | | ||| ||| AluI | SetI || | | ||| ||| CviJI | | DpnI || | | ||| ||| |DdeI | | |MnlI || | | ||| ||| ||SetI | | |BstKTI || | | ||| ||| ||| MnlI | | || TaqI || | | ||| ||| ||| | Eco57I | | || ClaI || | | ||| ||| ||| | Eco57MI | | || | TfiI || | | ||| ||| ||| | | BdaI | | || | HinfI || | | ||| ||| ||| | | BdaI \ \ \\ \ \ \\ \ \ \\\ \\\ \\\ \ \ \ TCACCTGATCCAATCGATTCACAGAATCAACACTCTGAAGTACCTCAAGCTGAGACAAAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGGACTAGGTTAGCTAAGTGTCTTAGTTGTGAGACTTCATGGAGTTCGACTCTGTTTC / // / / / / / / //// //// /// // | || MboI | | | Bce83I* | |||| |||| ||| |SetI | |MnlI | | | HinfI | |||| |||| ||| BdaI | |DpnI | | | TfiI | |||| |||| ||| BdaI | BstKTI | | BdaI | |||| |||| ||Eco57MI BinI* | | BdaI | |||| |||| ||Eco57I SetI | HinfI | |||| |||| |DdeI | TfiI | |||| |||| MnlI ClaI | |||| |||BsmAI TaqI | |||| ||CviJI | |||| ||AluI | |||| |SmlI | |||| SetI | |||Csp6I | ||RsaI | ||SetI | |BspCNI | BseMII Hpy188I S P D P I D S Q N Q H S E V P Q A E T K H L I Q S I H R I N T L K Y L K L R Q R T * S N R F T E S T L * S T S S * D K G ----:----|----:----|----:----|----:----|----:----|----:----| E G S G I S E C F * C E S T G * A S V F R V Q D L R N V S D V S Q L V E L Q S L * R I W D I * L I L V R F Y R L S L C L MaeII MboII |HphI | FatI || SetI | |CviAII SetI || TaiI MseI Hpy188I | || NlaIII \ \\ \ \ \ \ \\ \ GTGAGAAATAACGTCTTACCACCACACACTTTAACATCAGAAGAAAACTTTTCTACATGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CACTCTTTATTGCAGAATGGTGGTGTGTGAAATTGTAGTCTTCTTTTGAAAAGATGTACC // / / / / / // || MaeII MseI Hpy188I | | |FatI |HphI | | CviAII TaiI | NlaIII SetI MboII V R N N V L P P H T L T S E E N F S T W * E I T S Y H H T L * H Q K K T F L H G E K * R L T T T H F N I R R K L F Y M G ----:----|----:----|----:----|----:----|----:----|----:----| T L F L T K G G C V K V D S S F K E V H P S F Y R R V V V C K L M L L F S K * M H S I V D * W W V S * C * F F V K R C P MseI MboII BssKI | ApoI | MaeIII EcoRII | TspEI Hpy188I | Tsp45I HphI |SecI* \ \ \ \ \ \ \\ GTTAAATTTTACATCAGATTTTTGAAGAACTCTAATCTCGGTGACATCATTCCAAATGAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTTAAAATGTAGTCTAAAAACTTCTTGAGATTAGAGCCACTGTAGTAAGGTTTACTG / / / / / / | TspEI Hpy188I MboII | HphI | ApoI Tsp45I MseI MaeIII V K F Y I R F L K N S N L G D I I P N D L N F T S D F * R T L I S V T S F Q M T * I L H Q I F E E L * S R * H H S K * P ----:----|----:----|----:----|----:----|----:----|----:----| T L N * M L N K F F E L R P S M M G F S P * I K C * I K S S S * D R H C * E L H N F K V D S K Q L V R I E T V D N W I V FatI |CviAII || NspI || NlaIII ScrFI || | MboII BseBI HphI || | |TspDTI SetI \ \ \\ \ \\ \ CAGGGTGAAATCAAAAGACAAATGACTTATGAAGAACATGCGTATATATACAATACCTTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCCACTTTAGTTTTCTGTTTACTGAATACTTCTTGTACGCATATATATGTTATGGAAG / / / / // / / | EcoRII HphI | || TspDTI SetI | BssKI | || MboII | SecI* | |FatI BseBI | CviAII ScrFI NlaIII NspI Q G E I K R Q M T Y E E H A Y I Y N T F R V K S K D K * L M K N M R I Y T I P S G * N Q K T N D L * R T C V Y I Q Y L P ----:----|----:----|----:----|----:----|----:----|----:----| W P S I L L C I V * S S C A Y I Y L V K G P H F * F V F S K H L V H T Y I C Y R L T F D F S L H S I F F M R I Y V I G E TspEI | FokI FatI | |MseI Hin4II* |CviAII ApoI | |VspI |TspDTI || NlaIII TspEI | ||TspEI \\ \\ \ \ \ \\\ CAAGCATTTGCCCCATTTCATTTATTGCCAACATGGGTAAAACAAATTTTAGAAATTAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGTAAACGGGGTAAAGTAAATAACGGTTGTACCCATTTTGTTTAAAATCTTTAATTA / / // / /// Hin4II* | |FatI TspEI ||FokI TspDTI | CviAII ApoI |VspI NlaIII |MseI TspEI Q A F A P F H L L P T W V K Q I L E I N K H L P H F I Y C Q H G * N K F * K L I S I C P I S F I A N M G K T N F R N * L ----:----|----:----|----:----|----:----|----:----|----:----| W A N A G N * K N G V H T F C I K S I L G L M Q G M E N I A L M P L V F K L F * L C K G W K M * Q W C P Y F L N * F N I BseGI Tsp4CI* CviRI* Hpy178III* \ \ \ \ TATGCTGACATCCTTACAGTCCTTTGTAAAAGTGTGTCCAAAATGCAAACTAACAATCAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ATACGACTGTAGGAATGTCAGGAAACATTTTCACACAGGTTTTACGTTTGATTGTTAGTT / / / / / | BseGI Tsp4CI* CviRI* Hpy178III* TspEI Y A D I L T V L C K S V S K M Q T N N Q M L T S L Q S F V K V C P K C K L T I K C * H P Y S P L * K C V Q N A N * Q S R ----:----|----:----|----:----|----:----|----:----|----:----| * A S M R V T R Q L L T D L I C V L L * N H Q C G * L G K Y F H T W F A F * C D I S V D K C D K T F T H G F H L S V I L AluI CviJI | SetI Hpy99I | | EcoP15I | TatI | | | SmlI | |Csp6I | | | |SetI | ||RsaI TspEI | | | || Csp6I | ||| Bce83I* | MseI | | | || |RsaI | ||| | TspGWI \ \ \ \ \ \\ \\ \ \\\ \ \ GAATTAAAGGATTGGATAGCTCTTGCCAACCTTGAGTACGACGGAAGTACATCTGCTGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAATTTCCTAACCTATCGAGAACGGTTGGAACTCATGCTGCCTTCATGTAGACGACTA // / / // / // /// / |MseI | CviJI |SetI | |Hpy99I ||| TspGWI TspEI | AluI EcoP15I | |Csp6I ||Bce83I* SetI | RsaI ||TatI SmlI |Csp6I RsaI E L K D W I A L A N L E Y D G S T S A D N * R I G * L L P T L S T T E V H L L I I K G L D S S C Q P * V R R K Y I C * Y ----:----|----:----|----:----|----:----|----:----|----:----| S N F S Q I A R A L R S Y S P L V D A S L I L P N S L E Q W G Q T R R F Y M Q Q F * L I P Y S K G V K L V V S T C R S I Tsp4CI* | Csp6I | |RsaI | || MboI | || | DpnI | || | |MnlI | || | |BstKTI | || | || Hpy188I TspEI | || | || | CviJI \ \ \\ \ \\ \ \ ACATTTGAAATTACAGTCAGTACGATCATTCAGAGGCTAAAAGAAAACAATATCAATGTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAAACTTTAATGTCAGTCATGCTAGTAAGTCTCCGATTTTCTTTTGTTATAGTTACAA / / // // / / / | | || || | | CviJI | | || || | Hpy188I | | || || MboI | | || |DpnI | | || |MnlI | | || BstKTI | | |Csp6I | | RsaI | Tsp4CI* TspEI T F E I T V S T I I Q R L K E N N I N V H L K L Q S V R S F R G * K K T I S M L I * N Y S Q Y D H S E A K R K Q Y Q C * ----:----|----:----|----:----|----:----|----:----|----:----| V N S I V T L V I M * L S F S F L I L T Y M Q F * L * Y S * E S A L L F C Y * H C K F N C D T R D N L P * F F V I D I N SetI CviJI | BetI* HaeIII | |HpaII HphI | HindII | || MaeIII | SetI | Hpy166II MseI | || Tsp45I | |MaeII \ \ \ \ \\ \ \ \\ AGCGACAGATTGGCCTGTCAACTAATACTTAAAGGTCTATCCGGTGACTTCAAATACCTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTGTCTAACCGGACAGTTGATTATGAATTTCCAGATAGGCCACTGAAGTTTATGGAT / / // // / // / | Hpy166II |SetI || | || TaiI | HindII MseI || | || SetI HaeIII || | |SetI CviJI || | HphI || Tsp45I || MaeIII |BetI* HpaII S D R L A C Q L I L K G L S G D F K Y L A T D W P V N * Y L K V Y P V T S N T Y R Q I G L S T N T * R S I R * L Q I P T ----:----|----:----|----:----|----:----|----:----|----:----| L S L N A Q * S I S L P R D P S K L Y R * R C I P R D V L V * L D I R H S * I G A V S Q G T L * Y K F T * G T V E F V * BsaAI SnaBI FatI | SetI Csp6I |CviAII TspEI ApoI | TaiI |RsaI || NlaIII | TspDTI TspEI \ \ \\ \\ \ \ \ \ CGTAATCAATATCGTACCAAAACGAACATGAAACTTTCCCAATTATTCGCTGAAATTCAG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GCATTAGTTATAGCATGGTTTTGCTTGTACTTTGAAAGGGTTAATAAGCGACTTTAAGTC // // / // / / / |MaeII |Csp6I | |FatI | TspEI TspEI SnaBI RsaI | CviAII TspDTI ApoI BsaAI NlaIII R N Q Y R T K T N M K L S Q L F A E I Q V I N I V P K R T * N F P N Y S L K F S * S I S Y Q N E H E T F P I I R * N S V ----:----|----:----|----:----|----:----|----:----|----:----| R L * Y R V L V F M F S E W N N A S I * V Y D I D Y W F S C S V K G I I R Q F E T I L I T G F R V H F K G L * E S F N L FatI BspHI |CviAII |Hpy178III* || TfiI || BslFI || HinfI TspDTI MseI || NlaIII |Tsp4CI* \ \\ \ \\ TTAATATATGACGAAAATAAAATCATGAATCTAAATAAACCGTCCCAATACAAACAACAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AATTATATACTGCTTTTATTTTAGTACTTAGATTTATTTGGCAGGGTTATGTTTGTTGTG / / // // / / MseI | || |BslFI | Tsp4CI* | || HinfI TspDTI | || TfiI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII L I Y D E N K I M N L N K P S Q Y K Q H * Y M T K I K S * I * I N R P N T N N T N I * R K * N H E S K * T V P I Q T T Q ----:----|----:----|----:----|----:----|----:----|----:----| N I Y S S F L I M F R F L G D W Y L C C T L I H R F Y F * S D L Y V T G I C V V * Y I V F I F D H I * I F R G L V F L V MaeIII | SetI \ \ AGCGAATACAAAAATGTTTCTCGCACATCTCCAAACACGACTAACACAAAGGTTACAACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTTATGTTTTTACAAAGAGCGTGTAGAGGTTTGTGCTGATTGTGTTTCCAATGTTGA / / SetI MaeIII S E Y K N V S R T S P N T T N T K V T T A N T K M F L A H L Q T R L T Q R L Q L R I Q K C F S H I S K H D * H K G Y N S ----:----|----:----|----:----|----:----|----:----|----:----| L S Y L F T E R V D G F V V L V F T V V C R I C F H K E C M E L C S * C L P * L A F V F I N R A C R W V R S V C L N C S TseI |BisI ||BlsI ||| MwoI ||| | AluI ||| | CviJI ||| | | SetI TspEI Hpy188I ||| | | |BbvI SspI Bce83I* \ \ \\\ \ \ \\ \ \ CGTAATTATCAGAGAACAAATAGTTCAAAACCAAGAGCAGCAAAAGCTCACAATATTGCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GCATTAATAGTCTCTTGTTTATCAAGTTTTGGTTCTCGTCGTTTTCGAGTGTTATAACGA / / /// / / // / | Hpy188I ||| | CviJI || Bce83I* TspEI ||| | AluI |SspI ||| SetI BbvI ||MwoI ||TseI |BisI BlsI R N Y Q R T N S S K P R A A K A H N I A V I I R E Q I V Q N Q E Q Q K L T I L L * L S E N K * F K T K S S K S S Q Y C Y ----:----|----:----|----:----|----:----|----:----|----:----| R L * * L V F L E F G L A A F A * L I A E Y N D S F L Y N L V L L L L L E C Y Q T I I L S C I T * F W S C C F S V I N S Hpy166II | MboI | BclI | | DpnI | | |HphI | | |BstKTI ApoI | | || MseI TfiI TspEI | | || VspI HinfI Tsp4CI* MaeI | SmlI | | || MslI |TspDTI | TspDTI \ \ \ \ \ \\ \ \\ \ \ ACATCTAGTAAATTCTCAAGGGTGAACAATGATCACATTAATGAATCAACCGTTTCATCA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGATCATTTAAGAGTTCCCACTTGTTACTAGTGTAATTACTTAGTTGGCAAAGTAGT / / / / // / / / / / / / MaeI | SmlI | || | | | | | | TspDTI TspEI | || | | | | | Tsp4CI* ApoI | || | | | | HinfI | || | | | | TfiI | || | | | TspDTI | || | | VspI | || | | MseI | || | MslI | || BclI | || MboI | |HphI | |DpnI | BstKTI Hpy166II T S S K F S R V N N D H I N E S T V S S H L V N S Q G * T M I T L M N Q P F H H I * * I L K G E Q * S H * * I N R F I T ----:----|----:----|----:----|----:----|----:----|----:----| V D L L N E L T F L S * M L S D V T E D * M * Y I R L P S C H D C * H I L R K M C R T F E * P H V I I V N I F * G N * * SmlI DdeI CviJI AflII |BtgZI HaeIII TfiI |MseI || DdeI | Cac8I HinfI \\ \\ \ \ \ \ CAATACTTAAGCGATGACAACGAACTTAGTCTTAGGCCAGCAACAGAAAGAATCTAA 1270 1280 1290 1300 1310 ----:----|----:----|----:----|----:----|----:----|----:-- GTTATGAATTCGCTACTGTTGCTTGAATCAGAATCCGGTCGTTGTCTTTCTTAGATT // / / / / / / |AflII | | | | Cac8I HinfI |SmlI | | | HaeIII TfiI MseI | | | CviJI | | DdeI | BtgZI DdeI Q Y L S D D N E L S L R P A T E R I * N T * A M T T N L V L G Q Q Q K E S X I L K R * Q R T * S * A S N R K N L X ----:----|----:----|----:----|----:----|----:----|----:-- C Y K L S S L S S L R L G A V S L I * V I S L R H C R V * D * A L L L F F R L V * A I V V F K T K P W C C F S D L # Enzymes that cut Frequency Isoschizomers AarI 1 AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AluI 6 AluBI ApoI 5 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BccI 2 Bce83I* 3 BpuEI BceAI 2 BclI 1 FbaI,Ksp22I BdaI 2 BetI* 3 BsaWI BfiI 1 BmrI,BmuI BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 2 BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspMI 2 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 4 BtgZI 1 BtrI 1 BmgBI,AjiI Cac8I 1 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 8 CviQI,RsaNI CviAII 8 CviJI 11 CviKI-1 CviRI* 1 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 4 MalI Eco57I 2 AcuI Eco57MI 2 EcoP15I 1 EcoRII 2 AjnI,Psp6I,PspGI FatI 8 FokI 1 GlaI 1 HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 7 HpaII 3 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 5 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 5 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MnlI 6 MseI 9 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PvuII 1 RsaI 8 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 24 SmlI 4 SmoI SnaBI 1 Eco105I,BstSNI SspI 1 TaiI 5 TaqI 1 TatI 2 TfiI 7 PfeI TseI 1 ApeKI Tsp45I 3 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 14 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 1 TscAI TstI 1 VspI 2 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AccI AciI AclI AcyI AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BcgI BciVI BglI BglII BmeT110I BmtI BplI Bpu10I BsaBI BsaXI BsePI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtsI CauII* Cfr10I Cfr9I CfrI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GsaI GsuI HgaI HgiAI* HgiCI* HgiJII* Hin4I HindIII HpaI KasI KpnI MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* SchI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TauI TsoI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769