Restriction Map of DCC1/YCL016C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DCC1/YCL016C on chromosome III from coordinates 95763 to 94621.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.32074

EMBOSS_001 PsiI |BccI |BinI* || AluI || CviJI AvaI || | MboI |BmeT110I || | SetI || BinI* || | | DpnI || | MboI || | | |BstKTI BccI || | | DpnI || | | || HindII |SetI AciI || | | |BstKTI || | | ||BsrI Hpy166II \\ \ \\ \ \ \\ \\ \ \ \\\ \ ATGTCCATCAACCTACATTCCGCACCCGAGTATGATCCATCTTATAAGCTGATCCAGTTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGTAGTTGGATGTAAGGCGTGGGCTCATACTAGGTAGAATATTCGACTAGGTCAAC / / / // // / / / / // / / | BccI AciI || || MboI | | | || MboI Hpy166II SetI || |DpnI | | | |DpnI HindII || BstKTI | | | |BsrI |BinI* | | | BstKTI |AvaI | | CviJI BmeT110I | | AluI | BinI* | BccI | SetI PsiI M S I N L H S A P E Y D P S Y K L I Q L C P S T Y I P H P S M I H L I S * S S * V H Q P T F R T R V * S I L * A D P V D ----:----|----:----|----:----|----:----|----:----|----:----| X D M L R C E A G S Y S G D * L S I W N X T W * G V N R V R T H D M K Y A S G T H G D V * M G C G L I I W R I L Q D L Q BinI* | MboI | BamHI | XhoII | | DpnI | | NlaIV | | |BetI* | | |BstKTI | | ||HpaII | | ||| HphI BsrI SetI MaeIII BsrI | | ||| |BinI* | MseI |MseI \ \ \ \ \\\ \\ \ \ \\ ACACCAGAGTTACTGGATATAATACAGGATCCGGTTCAAAATCACCAGTTAAGGTTTAAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGTCTCAATGACCTATATTATGTCCTAGGCCAAGTTTTAGTGGTCAATTCCAAATTC / / / // / // / / / / | BsrI | || | || BinI* BsrI MseI MseI MaeIII | || | |BetI* SetI | || | HpaII | || | HphI | || XhoII | || BamHI | || MboI | |NlaIV | |DpnI | BstKTI BinI* T P E L L D I I Q D P V Q N H Q L R F K H Q S Y W I * Y R I R F K I T S * G L S T R V T G Y N T G S G S K S P V K V * V ----:----|----:----|----:----|----:----|----:----|----:----| V G S N S S I I C S G T * F * W N L N L S V L T V P Y L V P D P E F D G T L T * C W L * Q I Y Y L I R N L I V L * P K L Hpy188I | TatI | |Csp6I Eco57I | ||RsaI Eco57MI | ||| Tsp4CI* |TaqII \ \\\ \ \\ TCATTGGACAAAGACAAGTCTGAAGTTGTACTGTGTTCGCACGACAAGACTTGGGTGCTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAACCTGTTTCTGTTCAGACTTCAACATGACACAAGCGTGCTGTTCTGAACCCACGAC / /// // / Hpy188I ||Tsp4CI* |TaqII MwoI ||TatI Eco57MI |Csp6I Eco57I RsaI S L D K D K S E V V L C S H D K T W V L H W T K T S L K L Y C V R T T R L G C * I G Q R Q V * S C T V F A R Q D L G A E ----:----|----:----|----:----|----:----|----:----|----:----| D N S L S L D S T T S H E C S L V Q T S T M P C L C T Q L Q V T N A R C S K P A * Q V F V L R F N Y Q T R V V L S P H Q TseI MwoI |BisI BbvI ||BlsI | Eco57I |||Hin6I | Eco57MI ApoI ||||GlaI | | Tsp4CI* TspEI |||||HhaI | | | PpiI | XmnI Hpy178III* SetI \\\\\\ \ \ \ \ \ \ \ \ AAGCAGCGCAAACATTCAAACACAGTTCTACTAATGAGAGAATTTGTTCCTGAACAACCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGTCGCGTTTGTAAGTTTGTGTCAAGATGATTACTCTCTTAAACAAGGACTTGTTGGA ///// / / // / / / ||||Hin6I | | |PpiI TspEI | PpiI |||GlaI | | Tsp4CI* XmnI | SetI ||TseI | BbvI ApoI Hpy178III* ||HhaI Eco57MI |BisI Eco57I BlsI K Q R K H S N T V L L M R E F V P E Q P S S A N I Q T Q F Y * * E N L F L N N L A A Q T F K H S S T N E R I C S * T T Y ----:----|----:----|----:----|----:----|----:----|----:----| F C R L C E F V T R S I L S N T G S C G S A A C V N L C L E V L S L I Q E Q V V L L A F M * V C N * * H S F K N R F L R Tsp4CI* | CviJI | | XcmI | | Csp6I | | |RsaI | | ||FatI | | |||CviAII | | |||| NlaIII | | |||| | AcyI | | |||| | MaeII | | |||| | |ZraI | | |||| | || SetI | | |||| | || TaiI | | |||| | || AatII | | |||| | || | Hpy99I | | |||| | || | | TfiI PpiI TaqI Hpy99I BceAI | | |||| | || | | HinfI \ \ \ \ \ \ \\\\ \ \\ \ \ \ ATTACTTTCGACGAAACGCTCTTGTTTGGACTGTCCAAGCCGTACATGGACGTCGTGGGA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGAAAGCTGCTTTGCGAGAACAAACCTGACAGGTTCGGCATGTACCTGCAGCACCCT / / / / / / // ////// | TaqI | Tsp4CI* | | || |||||MaeII Hpy99I BceAI | | || |||||AcyI | | || ||||ZraI | | || |||Hpy99I | | || ||AatII | | || ||TaiI | | || ||SetI | | || |FatI | | || CviAII | | |NlaIII | | |Csp6I | | RsaI | XcmI CviJI I T F D E T L L F G L S K P Y M D V V G L L S T K R S C L D C P S R T W T S W D Y F R R N A L V W T V Q A V H G R R G I ----:----|----:----|----:----|----:----|----:----|----:----| I V K S S V S K N P S D L G Y M S T T P * * K R R F A R T Q V T W A T C P R R P N S E V F R E Q K S Q G L R V H V D H S TfiI HinfI | Hpy188I | |ApoI FatI | |BsmAI |CviAII ApoI | |TspEI || NlaIII TspEI | |Eco31I BsmAI || | TspEI EcoRI \ \\ \ \\ \ \ \ TTCGCCAAGACTGAATCAGAATTTGAGACCAGAGAGACACATGGCGAATTGAACTTGAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCGGTTCTGACTTAGTCTTAAACTCTGGTCTCTCTGTGTACCGCTTAACTTGAACTTA / // / / / // / HinfI || Eco31I BsmAI | |FatI TspEI TfiI || TspEI | CviAII || BsmAI NlaIII || ApoI |Hpy188I HinfI TfiI F A K T E S E F E T R E T H G E L N L N S P R L N Q N L R P E R H M A N * T * I R Q D * I R I * D Q R D T W R I E L E F ----:----|----:----|----:----|----:----|----:----|----:----| N A L V S D S N S V L S V C P S N F K F I R W S Q I L I Q S W L S V H R I S S S E G L S F * F K L G S L C M A F Q V Q I BsrI | TspGWI | | Hpy188I | | | Ksp632I* | | | |MnlI | | | |FatI | | | |BspHI | | | ||CviAII | | | ||Hpy178III* | | | ||| SetI Csp6I | | | ||| | MmeI |RsaI | | | ||| NlaIII | |MboII \\ \ \ \ \\\ \ \ \\ TCAGTACCAATATACAACGGAGAACTGGATTTCTCCGACAAAATCATGAAGAGGTCATCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCATGGTTATATGTTGCCTCTTGACCTAAAGAGGCTGTTTTAGTACTTCTCCAGTAGA / // / / / // /// / / / | |Csp6I | | Hpy188I || ||| SetI | TspDTI | RsaI | TspGWI || ||BspHI | MboII EcoRI BsrI || ||FatI MmeI TspEI || |Hpy178III* ApoI || |CviAII || Ksp632I* |NlaIII MnlI S V P I Y N G E L D F S D K I M K R S S Q Y Q Y T T E N W I S P T K S * R G H L S T N I Q R R T G F L R Q N H E E V I Y ----:----|----:----|----:----|----:----|----:----|----:----| E T G I Y L P S S S K E S L I M F L D D N L V L I C R L V P N R R C F * S S T M * Y W Y V V S F Q I E G V F D H L P * R SetI | Hpy178III* | | FalI | | FalI | | AsuI* | | AvaII | | DraII FatI | | PpuMI |CviAII | | SanDI || FalI | | |NlaIV || FalI | | |BmgT120I || |NlaIII | | ||NlaIV || || Hin6I | | |||BssKI || || Hin4II* | | |||SecI* BslFI || || Bce83I* | | |||EcoRII | SmlI || || |GlaI | | |||| ScrFI | |HphI || || ||HhaI TspDTI | | |||| BseBI | || MboII || || |||MaeI \ \ \ \\\\ \ \ \\ \ \\ \\ \\\\ ACAAAGGTTATCGGGACCCTGGAAGAACTACTTGAGAACTCACCATGTTCTGCGCTAGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTCCAATAGCCCTGGGACCTTCTTGATGAACTCTTGAGTGGTACAAGACGCGATCTT / / //// /// / / / / / // ///// / / SetI FalI |||| ||EcoRII | | SmlI | | || ||||| | SetI FalI |||| ||BssKI | MboII | | || ||||| MaeI |||| |SecI* BslFI | | || ||||Hin6I |||| BseBI HphI | | || |||GlaI |||| ScrFI | | || ||HhaI |||SanDI | | || |Hin4II* |||PpuMI | | || Bce83I* |||DraII | | |FatI |||AvaII | | CviAII |||AsuI* | NlaIII ||BmgT120I FalI ||NlaIV FalI |NlaIV Hpy178III* T K V I G T L E E L L E N S P C S A L E Q R L S G P W K N Y L R T H H V L R * K K G Y R D P G R T T * E L T M F C A R R ----:----|----:----|----:----|----:----|----:----|----:----| V F T I P V R S S S S S F E G H E A S S * L P * R S G P L V V Q S S V M N Q A L C L N D P G Q F F * K L V * W T R R * F MboI XhoII | DpnI TstI | |BstKTI | FalI SetI | || BinI* Tsp4CI* | FalI \ \ \\ \ \ \ \ GGTATATCAAAATGGCATAAGATTGGTGGATCTGTGAAAGACGGTGTGTTGTGTATTCTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCATATAGTTTTACCGTATTCTAACCACCTAGACACTTTCTGCCACACAACACATAAGAA // / / / / / || | | | | FalI || | | | | FalI || | | | TstI || | | Tsp4CI* || | BinI* || XhoII || MboI |DpnI BstKTI G I S K W H K I G G S V K D G V L C I L V Y Q N G I R L V D L * K T V C C V F F Y I K M A * D W W I C E R R C V V Y S F ----:----|----:----|----:----|----:----|----:----|----:----| P I D F H C L I P P D T F S P T N H I R L Y I L I A Y S Q H I Q S L R H T T Y E T Y * F P M L N T S R H F V T H Q T N K BtsI | TstI | | FatI | | CviRI* | | |FalI | | |FalI | | |CviAII | | ||TspRI | | |||TatI | | ||||NspI | | ||||Csp6I Hin6I BsrDI | | ||||NlaIII |GlaI | TfiI | | |||||RsaI ||HhaI | HinfI \ \ \\\\\\ \\\ \ \ TCACAAGACTTCCTTTTCAAAGCACTGCATGTACTACTGATGAGCGCAATGGCAGAATCA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGTTCTGAAGGAAAAGTTTCGTGACGTACATGATGACTACTCGCGTTACCGTCTTAGT / / / ///// /// / / | | | ||||TatI ||| BsrDI HinfI | | | |||Csp6I ||Hin6I TfiI | | | ||RsaI |GlaI | | | |FatI HhaI | | | CviAII | | CviRI* | | NlaIII | | NspI | FalI | FalI TspRI TstI BtsI S Q D F L F K A L H V L L M S A M A E S H K T S F S K H C M Y Y * * A Q W Q N H T R L P F Q S T A C T T D E R N G R I T ----:----|----:----|----:----|----:----|----:----|----:----| E C S K R K L A S C T S S I L A I A S D K V L S G K * L V A H V V S S R L P L I * L V E K E F C Q M Y * Q H A C H C F * AlwNI TaqI | MslI |MboI | Hpy188I DraIII || DpnI | |MnlI Hin4II* || |BstKTI | || BciVI | PpiI || ||SfeI* | || SfaNI BsaBI | | MnlI \\ \\\ \ \\ \ \ \ \ \ CTCGATCTACAGCATCTGAATGTTGAGGATACACATCACGCTGTGGGGAAGGACATTGAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCTAGATGTCGTAGACTTACAACTCCTATGTGTAGTGCGACACCCCTTCCTGTAACTC // / // // / / / / / / / || | || || | SfaNI BsaBI | | PpiI MnlI || | || || BciVI | Hin4II* || | || |MslI DraIII || | || |MnlI || | || Hpy188I || | |AlwNI || | SfeI* || MboI |DpnI BstKTI TaqI L D L Q H L N V E D T H H A V G K D I E S I Y S I * M L R I H I T L W G R T L R R S T A S E C * G Y T S R C G E G H * G ----:----|----:----|----:----|----:----|----:----|----:----| S S R C C R F T S S V C * A T P F S M S V R D V A D S H Q P Y V D R Q P S P C Q E I * L M Q I N L I C M V S H P L V N L Tsp4CI* | TspRI | | ApoI PpiI | | TspEI \ \ \ \ GACGAGTTCAATCCATACACAAGAGAAATCATTGAAACAGTGCTGAATAAATTTGCTGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTCAAGTTAGGTATGTGTTCTCTTTAGTAACTTTGTCACGACTTATTTAAACGACAA / / / / PpiI | Tsp4CI* TspEI TspRI ApoI D E F N P Y T R E I I E T V L N K F A V T S S I H T Q E K S L K Q C * I N L L F R V Q S I H K R N H * N S A E * I C C S ----:----|----:----|----:----|----:----|----:----|----:----| S S N L G Y V L S I M S V T S F L N A T P R T * D M C L L F * Q F L A S Y I Q Q V L E I W V C S F D N F C H Q I F K S N MaeII |BsaAI || SetI || TaiI AluI || | Hin6I CviJI || | |GlaI |DdeI || | ||HhaI ||SetI Hpy178III* || | |||SmlI ||Bce83I* | MnlI CviJI || | |||HaeII Tsp4CI* ||| Csp6I \ \ \ \\ \ \\\\ \ \\\ \ CAAGAGCAAGAGGCTGAAAACAATACGTGGCGCTTGAGAATACCGTTTATAGCTCAGTGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCGTTCTCCGACTTTTGTTATGCACCGCGAACTCTTATGGCAAATATCGAGTCACC // / / // //// / / / / / || CviJI | || |||| SmlI | | | DdeI |Hpy178III* | || |||Hin6I | | Bce83I* MnlI | || ||GlaI | | CviJI | || |HhaI | | TspRI | || HaeII | | AluI | |MaeII | SetI | BsaAI Tsp4CI* TaiI SetI Q E Q E A E N N T W R L R I P F I A Q W K S K R L K T I R G A * E Y R L * L S G R A R G * K Q Y V A L E N T V Y S S V V ----:----|----:----|----:----|----:----|----:----|----:----| * S C S A S F L V H R K L I G N I A * H E L A L P Q F C Y T A S S F V T * L E T L L L L S F V I R P A Q S Y R K Y S L P RsaI TspRI | TfiI | HinfI | BspCNI Hpy178III* | |BseMII | FatI | || Hin6I | |CviAII | || |GlaI | ||Cac8I | || |Eco47III | ||| SphI | || ||HhaI | ||| NspI | || |||DdeI | ||| NlaIII | || |||HaeII | ||| | MfeI | || |||Bpu10I | ||| | TspEI BslFI \ \\ \\\\ \ \\\ \ \ \ TACGGGATTCAAGCGCTAAGGAAATATGTTTCTGGAATAAGCATGCCAATTGATGAGTTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCCCTAAGTTCGCGATTCCTTTATACAAAGACCTTATTCGTACGGTTAACTACTCAAG // // / //// / / / /// / || || | |||| Bpu10I | | ||FatI TspEI || || | |||| DdeI | | |CviAII MfeI || || | |||Hin6I | | Cac8I || || | ||Eco47III | NlaIII || || | ||GlaI | NspI || || | |HhaI | SphI || || | HaeII Hpy178III* || || HinfI || || TfiI || |BseMII || BspCNI |Csp6I RsaI Y G I Q A L R K Y V S G I S M P I D E F T G F K R * G N M F L E * A C Q L M S S R D S S A K E I C F W N K H A N * * V P ----:----|----:----|----:----|----:----|----:----|----:----| Y P I * A S L F Y T E P I L M G I S S N T R S E L A L S I H K Q F L C A L Q H T V P N L R * P F I N R S Y A H W N I L E FatI MslI |CviAII |FatI || MaeIII ||CviAII || Tsp45I |||MnlI || |NlaIII |||| TseI || || BbvI |||| NspI MnlI TstI MboII SetI || || | TstI |||| NlaIII \ \ \ \ \\ \\ \ \ \\\\ \ CTCATCAAGTGGAAGTCCCTTTTCCCACCTTTCTTCCCATGTGACATTGACATTGACATG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTAGTTCACCTTCAGGGAAAAGGGTGGAAAGAAGGGTACACTGTAACTGTAACTGTAC / / / / / / // // / /// // | | TstI | SetI | || || | ||| |FatI | MnlI MboII | || || | ||| CviAII BslFI | || || | ||MnlI | || || | |NlaIII | || || | |NspI | || || | MslI | || || BbvI | || |Tsp45I | || |MaeIII | || TstI | |FatI | CviAII NlaIII L I K W K S L F P P F F P C D I D I D M S S S G S P F S H L S S H V T L T L T C H Q V E V P F P T F L P M * H * H * H A ----:----|----:----|----:----|----:----|----:----|----:----| R M L H F D R K G G K K G H S M S M S M G * * T S T G K G V K R G M H C Q C Q C E D L P L G K E W R E E W T V N V N V H BisI Tsp4CI* |BlsI CviJI CviJI | BsrI \\ \ \ \ \ CTGCGAGGCTATCATTTCAAGCCTACCGATAAGACTGTCCAGTATATAGCGAAAAGCACA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GACGCTCCGATAGTAAAGTTCGGATGGCTATTCTGACAGGTCATATATCGCTTTTCGTGT /// / / / / ||TseI CviJI CviJI | BsrI |BisI Tsp4CI* BlsI L R G Y H F K P T D K T V Q Y I A K S T C E A I I S S L P I R L S S I * R K A H A R L S F Q A Y R * D C P V Y S E K H T ----:----|----:----|----:----|----:----|----:----|----:----| S R P * * K L G V S L V T W Y I A F L V A A L S D N * A * R Y S Q G T Y L S F C Q S A I M E L R G I L S D L I Y R F A C CviJI |SfeI* || MaeIII || Tsp45I AsuI* BsiYI* || Tsp4CI* AvaII | Tsp4CI* || | Tsp4CI* |BmgT120I | | MseI || | | MnlI ||NlaIV | | |AhaIII* || | | |TspRI \\\ \ \ \\ \\ \ \ \\ CTACCAATGGACCCCAAAGAACGGTTTAAAGTCCTGTTTAGGCTACAGTCACAGTGGGAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GATGGTTACCTGGGGTTTCTTGCCAAATTTCAGGACAAATCCGATGTCAGTGTCACCCTG // / / // / // / / / || | | |MseI | || | | MnlI || | | AhaIII* | || | Tsp4CI* || | Tsp4CI* | || | Tsp45I || BsiYI* | || | MaeIII |AvaII | || TspRI |AsuI* | |SfeI* BmgT120I | Tsp4CI* NlaIV CviJI L P M D P K E R F K V L F R L Q S Q W D Y Q W T P K N G L K S C L G Y S H S G T T N G P Q R T V * S P V * A T V T V G L ----:----|----:----|----:----|----:----|----:----|----:----| S G I S G L S R N L T R N L S C D C H S V V L P G W L V T * L G T * A V T V T P * W H V G F F P K F D Q K P * L * L P V ApoI TspEI EcoRV |MnlI |BslFI || MboII || CviJI || |Hpy178III* || | TspEI MnlI || || SetI TspDTI Tsp4CI* \\ \ \ \ \\ \\ \ \ \ TTGGAGGATATCAAGCCTCTAATTGAAGAACTAAATTCAAGAGGTATGAAAATAGACAGT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTCCTATAGTTCGGAGATTAACTTCTTGATTTAAGTTCTCCATACTTTTATCTGTCA / // // / // // / / / | |CviJI |MnlI | || |SetI TspDTI | TspDTI | BslFI TspEI | || Hpy178III* Tsp4CI* EcoRV | |TspEI | |ApoI | MboII MnlI L E D I K P L I E E L N S R G M K I D S W R I S S L * L K N * I Q E V * K * T V G G Y Q A S N * R T K F K R Y E N R Q F ----:----|----:----|----:----|----:----|----:----|----:----| K S S I L G R I S S S F E L P I F I S L S P P Y * A E L Q L V L N L L Y S F L C Q L I D L R * N F F * I * S T H F Y V T BfiI | SecI* | DsaI* TspDTI | |Tsp4CI* | FatI | ||PshAI | BceAI | |||BspMI | BspHI AciI | ||||MaeIII | |CviAII Cac8I | ||||Tsp45I | |Hpy178III* | TspDTI | ||||| BsiI* | || NlaIII | | FauI BsrI | ||||| Hpy178III* \ \\ \ \ \ \ \ \ \\\\\ \ TTCATCATGAAGTATGCCCGCCGTAAAAGACTGGGCAAAAAGACCGTGGTCACGAGCAGG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAGTACTTCATACGGGCGGCATTTTCTGACCCGTTTTTCTGGCACCAGTGCTCGTCC / /// / / / / / / / / / / / / | ||BspHI | TspDTI FauI BsrI BfiI | | | | | | SetI | ||FatI | AciI | | | | | BsiI* | || Cac8I | | | | Hpy178III* | |Hpy178III* | | | | Tsp45I | |CviAII | | | | MaeIII | BceAI | | | BspMI NlaIII | | DsaI* | | SecI* | PshAI Tsp4CI* F I M K Y A R R K R L G K K T V V T S R S S * S M P A V K D W A K R P W S R A G H H E V C P P * K T G Q K D R G H E Q V ----:----|----:----|----:----|----:----|----:----|----:----| K M M F Y A R R L L S P L F V T T V L L N * * S T H G G Y F V P C F S R P * S C E D H L I G A T F S Q A F L G H D R A P SetI \ TAG --- ATC * X X --- Y T L # Enzymes that cut Frequency Isoschizomers AatII 1 AciI 2 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI AluI 2 AluBI AlwNI 1 CaiI ApoI 5 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BccI 2 Bce83I* 2 BpuEI BceAI 2 BciVI 1 BfuI BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 5 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 2 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseMII 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspCNI 1 BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 5 BtsI 1 Cac8I 2 BstC8I Csp6I 5 CviQI,RsaNI CviAII 9 CviJI 8 CviKI-1 CviRI* 1 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 5 MalI DraII 1 EcoO109I DraIII 1 AdeI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 2 AcuI Eco57MI 2 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 4 FatI 9 FauI 1 SmuI GlaI 5 HaeII 2 BstH2I HhaI 5 BstHHI,CfoI,AspLEI Hin4II* 2 HpyAV Hin6I 5 HinP1I,HspAI HindII 1 HincII HinfI 4 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 4 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 4 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MfeI 1 MunI MmeI 1 MnlI 9 MseI 3 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspI 3 BstNSI,XceI PpiI 2 PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsiI 1 AanI RsaI 5 AfaI SanDI 1 ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 13 SfaNI 1 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 2 SmoI SphI 1 PaeI,BbuI TaiI 2 TaqI 2 TaqII 1 TatI 2 TfiI 4 PfeI TseI 2 ApeKI Tsp45I 3 NmuCI Tsp4CI* 12 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 4 TscAI TstI 2 XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AccI AclI AflII AflIII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BalI BarI BbvCI BbvII* BcgI BclI BdaI BglI BglII BmtI BplI BsaXI BseGI BsePI BseRI BseSI BseYI BsgI BsmI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstF5I BstXI BstZ17I BtgZI BtrI BtsCI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DrdI Eam1105I EciI Ecl136II EcoICRI EcoNI EcoP15I EcoT22I EgeI EheI Esp3I EspI* FnuDII* FokI FseI FspAI GsaI GsuI HaeIII HgaI HgiAI* HgiCI* HgiJII* Hin4I HindIII HpaI KasI KpnI MauBI McrI* MluI MlyI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SapI SauI* ScaI SchI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TauI TsoI TspMI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769