Restriction Map of YCL001W-B



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YCL001W-B on chromosome III from coordinates 113770 to 114024.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.32350

FatI |CviAII || NlaIII || | Hin6I || | |GlaI || | ||BcgI || | ||AciI || | ||HhaI || | ||FnuDII* || | ||| BbvI \\ \ \\\ \ ATGGACGATTTCCTTGAACATTTGAGCAAAGACGATAACAAAGCATGGTATGGCGCGGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTGCTAAAGGAACTTGTAAACTCGTTTCTGCTATTGTTTCGTACCATACCGCGCCTT / // /// / | |FatI ||| AciI | CviAII ||FnuDII* NlaIII ||Hin6I |GlaI HhaI BcgI M D D F L E H L S K D D N K A W Y G A E W T I S L N I * A K T I T K H G M A R K G R F P * T F E Q R R * Q S M V W R G R ----:----|----:----|----:----|----:----|----:----|----:----| X S S K R S C K L L S S L L A H Y P A S X P R N G Q V N S C L R Y C L M T H R P H V I E K F M Q A F V I V F C P I A R F MboII | TseI | AluI | CviJI | |BisI | ||BlsI | ||SetI TatI | ||SfaNI |Csp6I | |||CviRI* CviRI* |Hpy166II | |||| TspEI |BcgI ||RsaI \ \\\\ \ \\ \\\ GAAACCGAGAGAGCTGCAAAATTAGATGCAATAGAAACACTACTTATTACAGATAGTGTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGGCTCTCTCGACGTTTTAATCTACGTTATCTTTGTGATGAATAATGTCTATCACAT / / / //// / / // /// BbvI | | |||| | | |CviRI* ||Csp6I | | |||| | | BcgI |RsaI | | |||| | TspEI Hpy166II | | |||| SfaNI | | |||CviRI* | | |||TseI | | ||BisI | | |BlsI | | CviJI | | AluI | SetI MboII E T E R A A K L D A I E T L L I T D S V K P R E L Q N * M Q * K H Y L L Q I V Y N R E S C K I R C N R N T T Y Y R * C T ----:----|----:----|----:----|----:----|----:----|----:----| S V S L A A F N S A I S V S S I V S L T L F R S L Q L I L H L L F V V * * L Y H F G L S S C F * I C Y F C * K N C I T Y MaeII |BtrI ||Hpy99I MaeII |||SetI | SetI MaeI |||TaiI | TaiI |SetI SetI BcgI \\\\ \ \ \\ \ \ CTAAAAAGGAACGACGTGAAAAAACGTGAAAAATACCTAGACCTAATAGAGAATAGTGGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTTTCCTTGCTGCACTTTTTTGCACTTTTTATGGATCTGGATTATCTCTTATCACCT / / / // / / / // / TatI | | |MaeII | MaeII SetI |SetI BcgI | | BtrI TaiI MaeI | TaiI SetI | SetI Hpy99I L K R N D V K K R E K Y L D L I E N S G * K G T T * K N V K N T * T * * R I V E K K E R R E K T * K I P R P N R E * W K ----:----|----:----|----:----|----:----|----:----|----:----| S F L F S T F F R S F Y R S R I S F L P V L F S R R S F V H F I G L G L L S Y H * F P V V H F F T F F V * V * Y L I T S Csp6I |RsaI || DdeI || | TatI || | |Csp6I || | ||RsaI || | ||ScaI || | ||| BcgI || | ||| | BspCNI || | ||| | |BseMII || | ||| | || Tsp4CI* SspI || | ||| | || | TspRI \ \\ \ \\\ \ \\ \ \ AACAACAATGGCAAAATATTCGTACTCAGTACTTCAAAAATCACAGTGAGCAACTTGACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTGTTACCGTTTTATAAGCATGAGTCATGAAGTTTTTAGTGTCACTCGTTGAACTGT / // / /// // / / SspI || | ||| || | Tsp4CI* || | ||| || TspRI || | ||| |BseMII || | ||| BspCNI || | ||BcgI || | ||TatI || | |Csp6I || | ScaI || | RsaI || DdeI |Csp6I RsaI N N N G K I F V L S T S K I T V S N L T T T M A K Y S Y S V L Q K S Q * A T * Q Q Q W Q N I R T Q Y F K N H S E Q L D K ----:----|----:----|----:----|----:----|----:----|----:----| F L L P L I N T S L V E F I V T L L K V F C C H C F I R V * Y K L F * L S C S S V V I A F Y E Y E T S * F D C H A V Q C AACCAACAGATATAG 250 ----:----|----: TTGGTTGTCTATATC N Q Q I * T N R Y X P T D I X ----:----|----: F W C I Y L G V S I V L L Y L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AluI 1 AluBI BbvI 1 BseXI,BstV1I,Lsp1109I BcgI 2 BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BseMII 1 BspCNI 1 BtrI 1 BmgBI,AjiI Csp6I 3 CviQI,RsaNI CviAII 1 CviJI 1 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I FatI 1 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 1 HhaI 1 BstHHI,CfoI,AspLEI Hin6I 1 HinP1I,HspAI Hpy166II 1 Hpy8I Hpy99I 1 MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MboII 1 NlaIII 1 Hin1II,Hsp92II,FaeI RsaI 3 AfaI ScaI 1 BmcAI,AssI,ZrmI SetI 5 SfaNI 1 LweI SspI 1 TaiI 2 TatI 2 TseI 1 ApeKI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspEI 1 TasI,Tsp509I,Sse9I TspRI 1 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BceAI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FokI FseI FspAI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* Hin4I Hin4II* HindII HindIII HinfI HpaI HpaII HphI Hpy178III*Hpy188I KasI KpnI Ksp632I* MaeIII MauBI MboI McrI* MfeI MluI MlyI MmeI MnlI Mph1103I MroNI MseI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SchI ScrFI SduI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TaqI TaqII TauI TfiI TsoI Tsp45I TspDTI TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769