Restriction Map of PCA1/YBR295W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

PCA1/YBR295W on chromosome II from coordinates 792849 to 796499.


Acc65I HgiCI* |Csp6I ||RsaI TspDTI ||SetI CviJI | BetI* ||NlaIV |HpaII | Ksp632I* |||BccI BtgZI || MboII | |HpaII ||||KpnI | Hin4I \\ \ \ \\ \\\\\ \ \ ATGAAGCCGGAAAAACTCTTCTCCGGTTTAGGTACCAGCGATGGCGAGTATGGAGTGGTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCGGCCTTTTTGAGAAGAGGCCAAATCCATGGTCGCTACCGCTCATACCTCACCAT / // / // / / /// / / | || TspDTI || | | ||HgiCI* | BtgZI | |HpaII || | | ||Acc65I Hin4I | MboII || | | ||BccI CviJI || | | |Csp6I || | | NlaIV || | | RsaI || | KpnI || SetI |BetI* Ksp632I* HpaII M K P E K L F S G L G T S D G E Y G V V * S R K N S S P V * V P A M A S M E W * E A G K T L L R F R Y Q R W R V W S G K ----:----|----:----|----:----|----:----|----:----|----:----| X F G S F S K E P K P V L S P S Y P T T X S A P F V R R R N L Y W R H R T H L P H L R F F E E G T * T G A I A L I S H Y BinI* Hin4I | MboI CviRI* | XhoII SfaNI | MnlI | | DpnI \ \ \ \ \ \ AATAGCGAGAACATATCAATAGATGCTATGCAAGATAATAGAGGCGAGTGTCATCGTAGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCGCTCTTGTATAGTTATCTACGATACGTTCTATTATCTCCGCTCACAGTAGCATCT / / / / / // SfaNI | | MnlI | |DpnI | CviRI* | BstKTI Hin4I BinI* N S E N I S I D A M Q D N R G E C H R R I A R T Y Q * M L C K I I E A S V I V D * R E H I N R C Y A R * * R R V S S * I ----:----|----:----|----:----|----:----|----:----|----:----| F L S F M D I S A I C S L L P S H * R L L Y R S C I L L H * A L Y Y L R T D D Y I A L V Y * Y I S H L I I S A L T M T S FatI CviRI* |CviAII ||Cac8I ||EcoT22I BsmAI ||| SphI BseYI ||| NspI |BsmAI Tsp4CI* BstKTI ||| NlaIII |Eco31I |Csp6I | MslI ||| |MslI || GsaI ||RsaI \ \ \\\ \\ \\ \ \\\ TCCATAGAAATGCATGCTAATGACAATCTGGGATTGGTCTCCCAGCGAGACTGTACCAAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTATCTTTACGTACGATTACTGTTAGACCCTAACCAGAGGGTCGCTCTGACATGGTTA / / / / //// / // / // | | | | |||MslI | || | |Csp6I | | | | ||FatI | || | RsaI | | | | |CviAII | || Tsp4CI* | | | | Cac8I | |Eco31I | | | CviRI* | |BsmAI | | | NlaIII | BseYI | | | NspI | BsmAI | | | SphI GsaI | | EcoT22I | MslI XhoII MboI S I E M H A N D N L G L V S Q R D C T N P * K C M L M T I W D W S P S E T V P I H R N A C * * Q S G I G L P A R L Y Q S ----:----|----:----|----:----|----:----|----:----|----:----| D M S I C A L S L R P N T E W R S Q V L I W L F A H * H C D P I P R G A L S Y W G Y F H M S I V I Q S Q D G L S V T G I DdeI SauI* | Hpy178III* | | MnlI | | | BsmAI AsuI* | | | |BseMII FatI |CviJI | | | ||BspCNI |CviAII |HaeIII | | | |||BseMII ||BglI |BmgT120I | | | |||| Hin4I ||MwoI || BseRI | | | |||| Hin4I ||| NlaIII || | TspEI | | | |||| | DdeI ||| |BccI \\ \ \ \ \ \ \\\\ \ \ \\\ \\ CGGCCCAAAATTACTCCTCAGGAATGTTTGAGTGAGACTGAGCAGATATGCCATCATGGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCCGGGTTTTAATGAGGAGTCCTTACAAACTCACTCTGACTCGTCTATACGGTAGTACCG /// / // / /// // / // // / ||AsuI* TspEI || | ||| |BsmAI DdeI || || BccI |BmgT120I || | ||| Hin4I || |FatI HaeIII || | ||| Hin4I || CviAII CviJI || | ||BseMII |NlaIII BseRI || | |BspCNI MwoI || | BseMII BglI || MnlI |Hpy178III* SauI* DdeI R P K I T P Q E C L S E T E Q I C H H G G P K L L L R N V * V R L S R Y A I M A A Q N Y S S G M F E * D * A D M P S W R ----:----|----:----|----:----|----:----|----:----|----:----| R G L I V G * S H K L S V S C I H W * P D A W F * E E P I N S H S Q A S I G D H P G F N S R L F T Q T L S L L Y A M M A BseYI CviJI MboI | GsaI AgeI BclI Hin4I | | SfaNI BetI* | DpnI Hin4I | | | AccI Cfr10I | |BstKTI | DdeI | | | |Hpy166II |HpaII | || MslI \ \ \ \ \ \\ \\ \ \\ \ GAGAATAGGACTAAGGCTGGGTTAGATGTAGACGATGCTGAAACCGGTGGTGATCACACC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTATCCTGATTCCGACCCAATCTACATCTGCTACGACTTTGGCCACCACTAGTGTGG / / / / / // // // / // Hin4I | | BseYI | |AccI || || | |HphI Hin4I | CviJI | Hpy166II || || | MslI | GsaI SfaNI || || BclI DdeI || || MboI || |DpnI || BstKTI |Cfr10I |BetI* |AgeI HpaII E N R T K A G L D V D D A E T G G D H T R I G L R L G * M * T M L K P V V I T P E * D * G W V R C R R C * N R W * S H Q ----:----|----:----|----:----|----:----|----:----|----:----| S F L V L A P N S T S S A S V P P S * V R S Y S * P Q T L H L R H Q F R H H D C L I P S L S P * I Y V I S F G T T I V G DdeI | TspDTI | | BseMII | | |BspCNI | | |Hpy166II | | || BsmAI | | || | DdeI HphI TspDTI | | || | | TspRI | TfiI | BseMII | | || | | | CviJI | HinfI | |BspCNI | | || | | | |BsrI \ \ \ \\ \ \ \\ \ \ \ \\ AATGAATCCCGTGTAGATGAATGTTGTGCTGAGAAAGTGAACGACACTGAGACTGGCTTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTAGGGCACATCTACTTACAACACGACTCTTTCACTTGCTGTGACTCTGACCGAAC / / // / / // / / / / // HinfI | |BspCNI | | || | | | DdeI |CviJI TfiI | BseMII | | || | | BsmAI BsrI TspDTI | | || | TspRI | | || Hpy166II | | |BspCNI | | BseMII | DdeI TspDTI N E S R V D E C C A E K V N D T E T G L M N P V * M N V V L R K * T T L R L A W * I P C R * M L C * E S E R H * D W L G ----:----|----:----|----:----|----:----|----:----|----:----| L S D R T S S H Q A S F T F S V S V P K W H I G H L H I N H Q S L S R C Q S Q S I F G T Y I F T T S L F H V V S L S A Q BseGI Hpy166II | AluI | CviJI | PvuII | NspBII* | |SfaNI | ||SetI | ||FokI | ||| AciI BtgZI | ||| MwoI |SetI MslI | ||| |BisI ||MaeIII | HphI BbvI | ||| ||BlsI ||Tsp45I | | TfiI BccI | ||| |||TauI ||BstEII | | HinfI SfaNI \ \\\ \\\\ \\\ \ \ \ \ GATGTGGACAGCTGTTGCGGCGATGCTCAAACAGGTGGTGACCACACCAATGAATCCTGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTACACCTGTCGACAACGCCGCTACGAGTTTGTCCACCACTGGTGTGGTTACTTAGGACA / / / / / //// / / / // / / | | | | | |||BisI SetI | | |HphI | BccI | | | | | |||AciI | | MslI HinfI | | | | | ||BlsI | BstEII TfiI | | | | | |FokI | Tsp45I | | | | | |TauI | MaeIII | | | | | SfaNI BtgZI | | | | MwoI | | | NspBII* | | | PvuII | | | CviJI | | | AluI | | SetI | Hpy166II BseGI D V D S C C G D A Q T G G D H T N E S C M W T A V A A M L K Q V V T T P M N P V C G Q L L R R C S N R W * P H Q * I L C ----:----|----:----|----:----|----:----|----:----|----:----| S T S L Q Q P S A * V P P S W V L S D Q P H P C S N R R H E F L H H G C W H I R I H V A T A A I S L C T T V V G I F G T TspDTI | TseI TseI | Eco57I |BisI | Eco57MI ||BlsI | |BisI |||TseI | ||BlsI |||AluI | ||BseGI |||CviJI | ||| MboII |||PvuII | ||| | FokI |||NspBII* | ||| | | TfiI MnlI ||||BisI | ||| | | HinfI | TspRI BbvI |||||BlsI | ||| | | | BccI | | TaqI | MaeIII |||||SetI \ \\\ \ \ \ \ \ \ \ \ \ \\\\\\ GTTGATGGATGCTGCGTTAGAGATTCTTCAGTGATGGTCGAGGAAGTTACAGGCAGCTGC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTACCTACGACGCAATCTCTAAGAAGTCACTACCAGCTCCTTCAATGTCCGTCGACG // / //// / /// / / / / / ////// || | |||| MboII ||| | MnlI TaqI | | |||||TseI || | |||TseI ||| BccI | | ||||BisI || | ||BisI ||TspRI | | |||BlsI || | |BlsI |HinfI | | ||NspBII* || | BseGI |TfiI | | ||PvuII || Eco57MI FokI | | ||CviJI || Eco57I | | ||TseI |TspDTI | | ||AluI SfaNI | | |BisI BbvI | | BlsI | | SetI | MaeIII BbvI V D G C C V R D S S V M V E E V T G S C L M D A A L E I L Q * W S R K L Q A A A * W M L R * R F F S D G R G S Y R Q L R ----:----|----:----|----:----|----:----|----:----|----:----| T S P H Q T L S E E T I T S S T V P L Q H Q H I S R * L N K L S P R P L * L C S N I S A A N S I R * H H D L F N C A A A MboII | AluI | CviJI AluI | |BbvI MfeI CviJI Hin4II* | ||SetI TspEI | SetI XmnI | Hpy188I \ \\\ \ \ \ \ \ \ GAAGCTGTATCTTCTAAAGAACAATTGCTGACCAGCTTTGAAGTTGTTCCAAGCAAATCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGACATAGAAGATTTCTTGTTAACGACTGGTCGAAACTTCAACAAGGTTCGTTTAGA // / / / / / / / / || | BbvI TspEI | CviJI XmnI | Hpy188I || CviJI MfeI | AluI Hin4II* || AluI SetI |SetI MboII E A V S S K E Q L L T S F E V V P S K S K L Y L L K N N C * P A L K L F Q A N L S C I F * R T I A D Q L * S C S K Q I * ----:----|----:----|----:----|----:----|----:----|----:----| S A T D E L S C N S V L K S T T G L L D R L Q I K * L V I A S W S Q L Q E L C I F S Y R R F F L Q Q G A K F N N W A F R FatI BspHI |CviAII |Hpy178III* ||Eco57I ||Eco57MI TseI SetI ||| NlaIII |BisI |TspDTI ||| | BsmAI ||BlsI || CviRI* ||| | | BbvI |||CviRI* TspEI \\ \ \\\ \ \ \ \\\\ \ GAAGGTCTGCAATCTATTCATGATATTAGAGAGACAACTCGCTGCAATACCAATTCCAAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCAGACGTTAGATAAGTACTATAATCTCTCTGTTGAGCGACGTTATGGTTAAGGTTG / / / / // / / /// / | | CviRI* | |BspHI | BbvI ||CviRI* TspEI | TspDTI | |FatI BsmAI ||TseI SetI | Hpy178III* |BisI | CviAII BlsI Eco57MI Eco57I NlaIII E G L Q S I H D I R E T T R C N T N S N K V C N L F M I L E R Q L A A I P I P T R S A I Y S * Y * R D N S L Q Y Q F Q P ----:----|----:----|----:----|----:----|----:----|----:----| S P R C D I * S I L S V V R Q L V L E L Q L D A I * E H Y * L S L E S C Y W N W F T Q L R N M I N S L C S A A I G I G V MmeI |CviJI || CviRI* || | TaqI || | | TfiI || | | HinfI || | | | MlyI || | | | PleI || | | | Bce83I* || | | | |SfaNI || | | | || MaeIII || | | | || Tsp45I SmlI Hin4II* || | | | || | HinfI | Hpy178III* \ \\ \ \ \ \\ \ \ \ \ CAACACACAGGGAAGGGTAGGCTTTGCATCGAATCAAGTGACTCTACACTCAAGAAAAGA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTGTGTCCCTTCCCATCCGAAACGTAGCTTAGTTCACTGAGATGTGAGTTCTTTTCT / / / / // // / // / Hin4II* | | | || || | |HinfI Hpy178III* | | | || || | Tsp45I SmlI | | | || || | MaeIII | | | || || SfaNI | | | || |PleI | | | || HinfI | | | || TfiI | | | || MlyI | | | |Bce83I* | | | TaqI | | CviRI* | CviJI MmeI Q H T G K G R L C I E S S D S T L K K R N T Q G R V G F A S N Q V T L H S R K E T H R E G * A L H R I K * L Y T Q E K K ----:----|----:----|----:----|----:----|----:----|----:----| W C V P F P L S Q M S D L S E V S L F L G V C L S P Y A K C R I L H S * V * S F L V C P L T P K A D F * T V R C E L F S SetI | BsrI TseI | BseMII TspDTI | |BspCNI |BisI MnlI | || CviJI ||BlsI | TspEI | ||BbvI | DdeI |||CviRI* \ \ \ \\\ \ \ \\\\ AGTTGTAAAGTTAGCAGACAGAAAATTGAGGTTTCCAGTAAGCCTGAGTGCTGCAACATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCAACATTTCAATCGTCTGTCTTTTAACTCCAAAGGTCATTCGGACTCACGACGTTGTAA / // // // // /// MnlI |SetI |BspCNI || || ||CviRI* TspEI BseMII || || ||TseI BsrI || || |BisI || || BlsI || |TspDTI || DdeI |CviJI BbvI S C K V S R Q K I E V S S K P E C C N I V V K L A D R K L R F P V S L S A A T F L * S * Q T E N * G F Q * A * V L Q H F ----:----|----:----|----:----|----:----|----:----|----:----| L Q L T L L C F I S T E L L G S H Q L M F N Y L * C V S F Q P K W Y A Q T S C C T T F N A S L F N L N G T L R L A A V N SfaNI FatI |AluI MmeI |CviAII |CviJI | MseI || NlaIII AciI || SetI | |AhaIII* || |Hin4I BsrBI CviRI* || |MnlI Hin4I | || SetI \\ \\ \ \ \\ \\ \ \ \\ \ TCATGTGTTGAGCGGATTGCATCTCGTAGCTGTGAAAAGAGGACTTTTAAAGGTAGCACC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGTACACAACTCGCCTAACGTAGAGCATCGACACTTTTCTCCTGAAAATTTCCATCGTGG / // / / / / / /// / /// | |FatI | AciI CviRI* | | ||Hin4I MmeI ||SetI | CviAII BsrBI | | |SfaNI |MseI NlaIII | | MnlI AhaIII* Hin4I | CviJI | AluI SetI S C V E R I A S R S C E K R T F K G S T H V L S G L H L V A V K R G L L K V A P M C * A D C I S * L * K E D F * R * H Q ----:----|----:----|----:----|----:----|----:----|----:----| E H T S R I A D R L Q S F L V K L P L V K M H Q A S Q M E Y S H F S S K * L Y C * T N L P N C R T A T F L P S K F T A G Tsp4CI* AluI | Eco57I ApoI CviJI | Eco57MI TspEI | SetI | |MseI MboII XmnI \ \ \ \ \\ \ \ AATGTTGGAATTTCTGGGAGTAGCTCTACCGACAGTTTAAGCGAGAAGTTCTTCAGCGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAACCTTAAAGACCCTCATCGAGATGGCTGTCAAATTCGCTCTTCAAGAAGTCGCTT / / / // / / / TspEI | CviJI || | MboII XmnI ApoI | AluI || MseI SetI |Eco57MI |Eco57I Tsp4CI* N V G I S G S S S T D S L S E K F F S E M L E F L G V A L P T V * A R S S S A N C W N F W E * L Y R Q F K R E V L Q R T ----:----|----:----|----:----|----:----|----:----|----:----| L T P I E P L L E V S L K L S F N K L S W H Q F K Q S Y S * R C N L R S T R * R I N S N R P T A R G V T * A L L E E A F TatI Tsp4CI* |Csp6I ||RsaI ||ScaI ||| XbaI ||| |MaeI ||| |Hpy178III* ||| || TatI ||| || Bsp1407I ||| || |Csp6I ||| || ||RsaI MnlI ||| || ||| BseRI | ApoI ||| || ||| | MaeIII TspEI | TspEI SetI MaeIII \\\ \\ \\\ \ \ \ \ \ \ \ CAGTACTCTAGAATGTACAATCGTTACTCCTCAATTTTGAAAAATTTAGGTTGTATCTGT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATGAGATCTTACATGTTAGCAATGAGGAGTTAAAACTTTTTAAATCCAACATAGACA / /// // /// / / / // | ||| |XbaI ||Bsp1407I MaeIII | MnlI |SetI | ||| | ||TatI TspEI TspEI | ||| | |Csp6I ApoI | ||| | BseRI | ||| | RsaI | ||| Hpy178III* | ||| MaeI | ||TatI | |Csp6I | ScaI | RsaI Tsp4CI* Q Y S R M Y N R Y S S I L K N L G C I C S T L E C T I V T P Q F * K I * V V S V V L * N V Q S L L L N F E K F R L Y L * ----:----|----:----|----:----|----:----|----:----|----:----| C Y E L I Y L R * E E I K F F K P Q I Q V T S * F T C D N S R L K S F N L N Y R L V R S H V I T V G * N Q F I * T T D T Csp6I TfiI MnlI |RsaI HinfI BsmAI SetI FauI | AciI \\ \ \ \ \ \ \ AACTATTTGCGTACTTTGGGAAAAGAATCTTGTTGTCTCCCAAAGGTGCGTTTTTGTAGC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTGATAAACGCATGAAACCCTTTTCTTAGAACAACAGAGGGTTTCCACGCAAAAACATCG / // / // / / MaeIII |Csp6I HinfI |BsmAI | MnlI RsaI TfiI SetI FauI N Y L R T L G K E S C C L P K V R F C S T I C V L W E K N L V V S Q R C V F V A L F A Y F G K R I L L S P K G A F L * R ----:----|----:----|----:----|----:----|----:----|----:----| L * K R V K P F S D Q Q R G F T R K Q L Y S N A Y K P F L I K N D G L P A N K Y V I Q T S Q S F F R T T E W L H T K T A Tsp4CI* | Hpy178III* | | MseI AciI | | BseGI \ \ \ \ GGGGAGGGTGCTTCTAAAAAGACAAAATACTCCTACCGCAACAGTTCTGGATGTTTAACA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCTCCCACGAAGATTTTTCTGTTTTATGAGGATGGCGTTGTCAAGACCTACAAATTGT / / / / / / AciI | | | | MseI | | | BseGI | | Hpy178III* | Tsp4CI* AciI G E G A S K K T K Y S Y R N S S G C L T G R V L L K R Q N T P T A T V L D V * Q G G C F * K D K I L L P Q Q F W M F N K ----:----|----:----|----:----|----:----|----:----|----:----| P S P A E L F V F Y E * R L L E P H K V R P P H K * F S L I S R G C C N Q I N L P L T S R F L C F V G V A V T R S T * C BsmAI BsrDI |FatI | CfrI |NcoI | | BalI |StyI | | CviJI |SecI* | | HaeIII |DsaI* | | |FatI ||CviAII | | ||CviAII FokI ||| NlaIII SetI | | ||| NlaIII \ \\\ \ \ \ \ \\\ \ AAGAAAAAGACCCATGGAGACAAAGAAAGGTTGAGCAATGACAATGGCCATGCTGATTTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTTCTGGGTACCTCTGTTTCTTTCCAACTCGTTACTGTTACCGGTACGACTAAAA / / // / / /// // FokI | |DsaI* SetI BsrDI ||| |FatI | |SecI* ||| CviAII | |StyI ||CfrI | |NcoI |NlaIII | |FatI HaeIII | CviAII CviJI | BsmAI BalI NlaIII K K K T H G D K E R L S N D N G H A D F R K R P M E T K K G * A M T M A M L I L E K D P W R Q R K V E Q * Q W P C * F C ----:----|----:----|----:----|----:----|----:----|----:----| F F F V W P S L S L N L L S L P W A S K L S F S G H L C L F T S C H C H G H Q N L F L G M S V F F P Q A I V I A M S I K CviRI* MaeIII MnlI | Hin4II* |TspDTI | MboII | |MslI || SetI | Hpy178III* \ \\ \\ \ \ \ GTTTGTTCTAAAAGTTGTTGCACTAAAATGAAGGATTGTGCTGTTACCTCAACTATTTCT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CAAACAAGATTTTCAACAACGTGATTTTACTTCCTAACACGACAATGGAGTTGATAAAGA / / / / / / / / | | MslI | | MaeIII | MboII | Hin4II* | SetI MnlI CviRI* TspDTI V C S K S C C T K M K D C A V T S T I S F V L K V V A L K * R I V L L P Q L F L L F * K L L H * N E G L C C Y L N Y F W ----:----|----:----|----:----|----:----|----:----|----:----| T Q E L L Q Q V L I F S Q A T V E V I E Q K N * F N N C * F S P N H Q * R L * K N T R F T T A S F H L I T S N G * S N R TaqI | Ksp632I* Hpy178III* NlaIV Hin4I | | ApoI | TfiI | MfeI |MseI | | TspEI | HinfI | TspEI ||MnlI \ \ \ \ \ \ \ \\\ GGACACTCTTCGAGTGAAATTTCAAGAATCGTATCAATGGAACCAATTGAAAATCATCTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGTGAGAAGCTCACTTTAAAGTTCTTAGCATAGTTACCTTGGTTAACTTTTAGTAGAA / / / / / / / / / / Hpy178III* | | | | HinfI NlaIV | Hin4I MnlI | | | | TfiI TspEI | | | Hpy178III* MfeI | | TspEI | | ApoI | Ksp632I* TaqI G H S S S E I S R I V S M E P I E N H L D T L R V K F Q E S Y Q W N Q L K I I L T L F E * N F K N R I N G T N * K S S * ----:----|----:----|----:----|----:----|----:----|----:----| P C E E L S I E L I T D I S G I S F * R Q V S K S H F K L F R I L P V L Q F D D S V R R T F N * S D Y * H F W N F I M K SmlI Hpy178III* | MboI | XhoII | | DpnI | | |BstKTI | | || AgeI | | || BetI* | | || Cfr10I | | || |HpaII | | || ||BinI* | | || |||Acc65I | | || |||HgiCI* | | || ||||Csp6I | | || |||||RsaI | | || |||||NlaIV | | || ||||||Bce83I* | | || |||||||KpnI | | || |||||||| Hin4I | | || |||||||| | SduI | | || |||||||| | HgiAI* DdeI Hpy178III* \ \ \\ \\\\\\\\ \ \ \ \ AATCTTGAGGCAGGATCTACCGGTACCGAGCACATTGTTCTTAGTGTTTCAGGAATGTCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGAACTCCGTCCTAGATGGCCATGGCTCGTGTAACAAGAATCACAAAGTCCTTACAGG / / / // / ///// / / / MseI | SmlI || | ||||| HgiAI* DdeI Hpy178III* | || | ||||| SduI | || | ||||HgiCI* | || | ||||Acc65I | || | |||Hin4I | || | |||Csp6I | || | ||NlaIV | || | ||RsaI | || | |Bce83I* | || | |Cfr10I | || | |BetI* | || | |AgeI | || | BinI* | || | HpaII | || | KpnI | || XhoII | || MboI | |DpnI | BstKTI Hpy178III* N L E A G S T G T E H I V L S V S G M S I L R Q D L P V P S T L F L V F Q E C P S * G R I Y R Y R A H C S * C F R N V L ----:----|----:----|----:----|----:----|----:----|----:----| L R S A P D V P V S C M T R L T E P I D * D Q P L I * R Y R A C Q E * H K L F T I K L C S R G T G L V N N K T N * S H G BsePI Hin6I |GlaI ||HhaI ||Hin6I ||Cac8I TatI BsrI SmlI ||FnuDII* |Csp6I | TfiI AflII |||GlaI Hpy166II ||RsaI | HinfI |MseI ||||HhaI | Tsp4CI* \\\ \ \ \\ \\\\\ \ \ TGTACTGGTTGTGAATCAAAACTTAAGAAATCATTTGGCGCGCTCAAATGTGTTCACGGT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ACATGACCAACACTTAGTTTTGAATTCTTTAGTAAACCGCGCGAGTTTACACAAGTGCCA /// / / // ///// / / ||| BsrI HinfI |AflII ||||BsePI | Tsp4CI* ||TatI TfiI |SmlI ||||Hin6I Hpy166II |Csp6I MseI |||GlaI RsaI ||FnuDII* ||Hin6I ||Cac8I ||HhaI |GlaI HhaI C T G C E S K L K K S F G A L K C V H G V L V V N Q N L R N H L A R S N V F T V Y W L * I K T * E I I W R A Q M C S R F ----:----|----:----|----:----|----:----|----:----|----:----| Q V P Q S D F S L F D N P A S L H T * P R Y Q N H I L V * S I M Q R A * I H E R T S T T F * F K L F * K A R E F T N V T Hpy178III* | MboI | XhoII | | DpnI | | |BstKTI Cac8I | | || DdeI | AluI | | || BinI* BsrI | CviJI | | || Bpu10I | BbvII* | | SetI | | || | MboI | | MseI | | |ApoI | | || | XhoII | | | MboII | | |TspEI | | || | | DpnI | | | | SspI | | || MseI | | || | | |BstKTI \ \ \ \ \ \ \ \\ \ \ \ \\ \ \ \\ TTGAAGACCAGTTTAATATTATCGCAAGCTGAATTTAATCTGGATCTTGCTCAGGGATCT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCTGGTCAAATTATAATAGCGTTCGACTTAAATTAGACCTAGAACGAGTCCCTAGA / // / / / / / /// / / / // / BsrI || SspI | CviJI | MseI ||| | | | || XhoII |MseI | AluI TspEI ||| | | | || MboI BbvII* Cac8I ApoI ||| | | | |DpnI MboII SetI ||| | | | BstKTI ||| | | Bpu10I ||| | | DdeI ||| | BinI* ||| XhoII ||| MboI ||DpnI |BstKTI Hpy178III* L K T S L I L S Q A E F N L D L A Q G S * R P V * Y Y R K L N L I W I L L R D L E D Q F N I I A S * I * S G S C S G I C ----:----|----:----|----:----|----:----|----:----|----:----| K F V L K I N D C A S N L R S R A * P D N S S W N L I I A L Q I * D P D Q E P I Q L G T * Y * R L S F K I Q I K S L S R ApoI TspEI EcoRI | Bce83I* | | Hin4I BinI* | | Hin4I BspCNI FokI | | Csp6I |BseMII BseGI | SmlI | | |RsaI \\ \ \ \ \ \ \\ GTCAAGGATGTTATCAAGCACTTGAGCAAAACTACTGAATTCAAGTACGAACAGATTTCA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTCCTACAATAGTTCGTGAACTCGTTTTGATGACTTAAGTTCATGCTTGTCTAAAGT // / / / / // // || BinI* BseGI | SmlI || |Csp6I |BseMII FokI || RsaI BspCNI |EcoRI |TspEI |ApoI Bce83I* Hin4I Hin4I V K D V I K H L S K T T E F K Y E Q I S S R M L S S T * A K L L N S S T N R F Q Q G C Y Q A L E Q N Y * I Q V R T D F K ----:----|----:----|----:----|----:----|----:----|----:----| T L S T I L C K L L V V S N L Y S C I E Q * P H * * A S S C F * Q I * T R V S K D L I N D L V Q A F S S F E L V F L N * TseI BbvI FatI SfeI* CviRI* | MnlI |CviAII | Hin4I |BisI | | MseI || NlaIII | Hin4I ||BlsI | | VspI \\ \ \ \ \\\ \ \ \ AATCATGGTTCAACTATAGATGTTGTTGTTCCTTATGCAGCAAAAGATTTTATTAATGAG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTACCAAGTTGATATCTACAACAACAAGGAATACGTCGTTTTCTAAAATAATTACTC / // / / //// / / / | |FatI Hin4I SfeI* |||TseI | | VspI | | Hin4I ||BisI | | MseI | CviAII |BlsI | BbvI NlaIII CviRI* MnlI N H G S T I D V V V P Y A A K D F I N E I M V Q L * M L L F L M Q Q K I L L M R S W F N Y R C C C S L C S K R F Y * * G ----:----|----:----|----:----|----:----|----:----|----:----| F * P E V I S T T T G * A A F S K I L S L D H N L * L H Q Q E K H L L L N * * H I M T * S Y I N N N R I C C F I K N I L CfrI DraIII AluI | BalI | SetI CviJI | CviJI | MaeIII | SetI | HaeIII | Tsp45I | | TspEI \ \ \ \ \ \ \ GAATGGCCACAAGGTGTCACAGAGCTGAAAATTGTTGAGAGAAATATCATTCGTATTTAC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACCGGTGTTCCACAGTGTCTCGACTTTTAACAACTCTCTTTATAGTAAGCATAAATG / / // / / / / | | |SetI | | CviJI TspEI | | DraIII | | AluI | CfrI | SetI HaeIII Tsp45I CviJI MaeIII BalI E W P Q G V T E L K I V E R N I I R I Y N G H K V S Q S * K L L R E I S F V F T M A T R C H R A E N C * E K Y H S Y L L ----:----|----:----|----:----|----:----|----:----|----:----| S H G C P T V S S F I T S L F I M R I * P I A V L H * L A S F Q Q S F Y * E Y K F P W L T D C L Q F N N L S I D N T N V MboI BglII XhoII SetI | DpnI BseGI | Hin4I | |BstKTI Hin4I | | HgiCI* | || Hin4II* | Cac8I | | | SetI | || |TstI | |TspDTI | | | NlaIV | || || BccI | || FokI \ \ \ \ \ \\ \\ \ \ \\ \ TTTGACCCAAAGGTTATAGGTGCCAGAGATCTTGTCAATGAAGGATGGAGCGTGCCTGTT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTGGGTTTCCAATATCCACGGTCTCTAGAACAGTTACTTCCTACCTCGCACGGACAA / / / / / //// / / / / // / | | | | | |||| | BccI | | |Cac8I FokI | | | | | |||| Hin4II* | | TspDTI | | | | | |||XhoII | BseGI | | | | | |||BglII Hin4I | | | | | |||MboI | | | | | ||TstI | | | | | |DpnI | | | | | BstKTI | | | | HgiCI* | | | NlaIV | | SetI | Hin4I SetI F D P K V I G A R D L V N E G W S V P V L T Q R L * V P E I L S M K D G A C L L * P K G Y R C Q R S C Q * R M E R A C * ----:----|----:----|----:----|----:----|----:----|----:----| K S G F T I P A L S R T L S P H L T G T S Q G L P * L H W L D Q * H L I S R A Q K V W L N Y T G S I K D I F S P A H R N MslI |Hin4II* MmeI TstI ||BstXI | BsgI |FokI BseGI |||BcgI | |BbvI \\ \ \\\\ \ \\ AGTATTGCTCCATTCAGTTGTCATCCAACCATTGAAGTGGGAAGGAAGCATTTAGTTCGT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TCATAACGAGGTAAGTCAACAGTAGGTTGGTAACTTCACCCTTCCTTCGTAAATCAAGCA / / / / // / / / TstI FokI BseGI | |BcgI | BsgI BbvI | Hin4II* MmeI | MslI BstXI S I A P F S C H P T I E V G R K H L V R V L L H S V V I Q P L K W E G S I * F V Y C S I Q L S S N H * S G K E A F S S C ----:----|----:----|----:----|----:----|----:----|----:----| L I A G N L Q * G V M S T P L F C K T R * Y Q E M * N D D L W Q L P F S A N L E T N S W E T T M W G N F H S P L M * N T SspI |BinI* || MboI || | DpnI TseI || | |BstKTI CviJI || | ||Hpy178III* |BisI || | ||| TfiI ||BlsI || | ||| HinfI |||CviRI* || | ||| | BccI |||| BcgI || | ||| | |BsiI* |||| | AciI || | ||| | || Hpy178III* |||| | McrI* || | ||| | || | CviJI \\\\ \ \ \\ \ \\\ \ \\ \ \ GTAGGCTGCACGACCGCTTTATCCATAATATTGACGATCCCGATTCTCGTGATGGCTTGG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CATCCGACGTGCTGGCGAAATAGGTATTATAACTGCTAGGGCTAAGAGCACTACCGAACC ///// / / / / // / / // / / / ||||| | AciI | | || | | || | | HgiJII* ||||| McrI* | | || | | || | | SduI ||||BcgI | | || | | || | CviJI |||CviRI* | | || | | || Hpy178III* |||TseI | | || | | || BsiI* ||BisI | | || | | |BccI |BlsI | | || | | HinfI CviJI | | || | | TfiI | | || | Hpy178III* | | || MboI | | |DpnI | | BstKTI | BinI* SspI V G C T T A L S I I L T I P I L V M A W * A A R P L Y P * Y * R S R F S * W L G R L H D R F I H N I D D P D S R D G L G ----:----|----:----|----:----|----:----|----:----|----:----| T P Q V V A K D M I N V I G I R T I A Q H L S C S R K I W L I S S G S E R S P K Y A A R G S * G Y Y Q R D R N E H H S P CviJI |NlaIV ||SduI ||HgiJII* ||| AluI ||| CviJI ||| | SetI NheI ||| | | Hpy178III* |MaeI ||| | | | ApoI AciI ||Cac8I ||| | | | TspEI HgaI | FnuDII* ||| BmtI \\\ \ \ \ \ \ \ \ \\\ \ GCTCCACAGCTTCGTGAAAAAATTTCCACTATCTCCGCGTCAATGGTGCTAGCAACTATT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGTGTCGAAGCACTTTTTTAAAGGTGATAGAGGCGCAGTTACCACGATCGTTGATAA // / / / / / / / /// || | CviJI | TspEI HgaI FnuDII* | ||NheI || | AluI | ApoI AciI | |MaeI || SetI Hpy178III* | Cac8I |NlaIV BmtI CviJI A P Q L R E K I S T I S A S M V L A T I L H S F V K K F P L S P R Q W C * Q L L S T A S * K N F H Y L R V N G A S N Y Y ----:----|----:----|----:----|----:----|----:----|----:----| A G C S R S F I E V I E A D I T S A V I P E V A E H F F K W * R R T L P A L L * S W L K T F F N G S D G R * H H * C S N CviRI* MboII | AsuI* | BssKI | AvaII | EcoRII | |BmgT120I | | ScrFI TspEI | || Tsp4CI* MseI Ksp632I* | | BseBI \ \ \\ \ \ \ \ \ \ ATTCAATTTGTTATTGCAGGACCGTTTTACTTAAATGCCTTGAAGAGTTTGATATTTTCC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTAAACAATAACGTCCTGGCAAAATGAATTTACGGAACTTCTCAAACTATAAAAGG / / // / / / TspEI | |Tsp4CI* MseI Ksp632I* MboII | |AvaII | |AsuI* | BmgT120I CviRI* I Q F V I A G P F Y L N A L K S L I F S F N L L L Q D R F T * M P * R V * Y F P S I C Y C R T V L L K C L E E F D I F Q ----:----|----:----|----:----|----:----|----:----|----:----| I * N T I A P G N * K F A K F L K I N E * E I Q * Q L V T K S L H R S S N S I K N L K N N C S R K V * I G Q L T Q Y K G MaeI | Hin6I | |GlaI | |Eco47III MboI | ||TseI XhoII | ||HhaI | DpnI | |||BisI | |BstKTI BbvI | |||HaeII CviJI MslI | || BinI* |MseI | ||||BlsI TaqI \ \ \ \\ \ \\ \ \\\\\ \ AGGCTCATTGAAATGGATCTACTAATAGTTTTAAGCACTAGCGCTGCCTACATATTTTCG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGAGTAACTTTACCTAGATGATTATCAAAATTCGTGATCGCGACGGATGTATAAAAGC / / / // / / // /////// / | EcoRII MslI || | BinI* |BbvI ||||||TseI TaqI | BssKI || XhoII MseI |||||BisI | CviJI || MboI ||||BlsI BseBI |DpnI |||Hin6I ScrFI BstKTI ||Eco47III ||GlaI |HhaI HaeII MaeI R L I E M D L L I V L S T S A A Y I F S G S L K W I Y * * F * A L A L P T Y F R A H * N G S T N S F K H * R C L H I F D ----:----|----:----|----:----|----:----|----:----|----:----| L S M S I S R S I T K L V L A A * M N E W A * Q F P D V L L K L C * R Q R C I K P E N F H I * * Y N * A S A S G V Y K R MmeI AcyI HgaI TspGWI \ \ \ \ ATTGTATCATTTGGATATTTCGTTGTTGGACGCCCGTTATCTACGGAGCAGTTTTTTGAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TAACATAGTAAACCTATAAAGCAACAACCTGCGGGCAATAGATGCCTCGTCAAAAAACTT / / / / MmeI AcyI HgaI TspGWI I V S F G Y F V V G R P L S T E Q F F E L Y H L D I S L L D A R Y L R S S F L K C I I W I F R C W T P V I Y G A V F * N ----:----|----:----|----:----|----:----|----:----|----:----| I T D N P Y K T T P R G N D V S C N K S S Q I M Q I N R Q Q V G T I * P A T K Q N Y * K S I E N N S A R * R R L L K K F Hpy166II | MaeI | | AluI AluI FatI | | CviJI CviJI |CviAII | | |MaeI | SetI MaeIII || NlaIII | | ||SetI \ \ \ \\ \ \ \ \\\ ACCAGCTCTTTGCTTGTAACTCTCATCATGGTTGGTCGCTTTGTGAGTGAACTAGCTAGA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTCGAGAAACGAACATTGAGAGTAGTACCAACCAGCGAAACACTCACTTGATCGATCT / / / / // / /// / | CviJI | | |FatI | ||| MaeI | AluI | | CviAII | ||CviJI SetI | NlaIII | ||AluI MaeIII | |MaeI | SetI Hpy166II T S S L L V T L I M V G R F V S E L A R P A L C L * L S S W L V A L * V N * L D Q L F A C N S H H G W S L C E * T S * T ----:----|----:----|----:----|----:----|----:----|----:----| V L E K S T V R M M T P R K T L S S A L F W S K A Q L E * * P Q D S Q S H V L * G A R Q K Y S E D H N T A K H T F * S S MboII | StuI Csp6I | CviJI |RsaI | HaeIII ||MaeII | | MwoI ||| SetI | | | Ksp632I* CviJI ||| TaiI | | | | MnlI \ \\\ \ \ \ \ \ \ CATAGGGCTGTAAAGTCAATATCAGTACGTTCCTTACAGGCCTCTTCTGCTATTCTGGTG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GTATCCCGACATTTCAGTTATAGTCATGCAAGGAATGTCCGGAGAAGACGATAAGACCAC / // / / / / // CviJI || | MboII | MwoI |Ksp632I* || MaeII HaeIII MnlI |Csp6I CviJI RsaI StuI TaiI SetI H R A V K S I S V R S L Q A S S A I L V I G L * S Q Y Q Y V P Y R P L L L F W W * G C K V N I S T F L T G L F C Y S G G ----:----|----:----|----:----|----:----|----:----|----:----| C L A T F D I D T R E K C A E E A I R T V Y P Q L T L I L V N R V P R K Q * E P M P S Y L * Y * Y T G * L G R R S N Q H TspEI | MseI Esp3I | VspI BsmAI | | SspI | BsrI | | | TspGWI MseI \ \ \ \ \ \ \ GATAAAACTGGTAAAGAGACGGAAATTAATATTAGACTTCTCCAATATGGCGATATTTTT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTTGACCATTTCTCTGCCTTTAATTATAATCTGAAGAGGTTATACCGCTATAAAAA / / // / / | BsmAI || | TspGWI | Esp3I || SspI BsrI |VspI |MseI TspEI D K T G K E T E I N I R L L Q Y G D I F I K L V K R R K L I L D F S N M A I F L * N W * R D G N * Y * T S P I W R Y F * ----:----|----:----|----:----|----:----|----:----|----:----| S L V P L S V S I L I L S R W Y P S I K P Y F Q Y L S P F * Y * V E G I H R Y K I F S T F L R F N I N S K E L I A I N K SetI |TfiI |HinfI || Hpy178III* || | TfiI Tsp4CI* || | HinfI PflMI | MboII SetI || | | BccI BsiYI* | BbvII* Hpy188I \ \\ \ \ \ \ \ \ \ AAGGTTTTACCTGATTCAAGAATCCCAACTGATGGAACAGTCATTTCTGGGTCTTCTGAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCAAAATGGACTAAGTTCTTAGGGTTGACTACCTTGTCAGTAAAGACCCAGAAGACTT / / / / / / / / / / / MseI SetI | | | | BsiYI* | | BbvII* Hpy188I SetI | | | | PflMI | MboII | | | BccI Tsp4CI* | | HinfI | | TfiI | Hpy178III* HinfI TfiI K V L P D S R I P T D G T V I S G S S E R F Y L I Q E S Q L M E Q S F L G L L K G F T * F K N P N * W N S H F W V F * S ----:----|----:----|----:----|----:----|----:----|----:----| L T K G S E L I G V S P V T M E P D E S * P K V Q N L F G L Q H F L * K Q T K Q L N * R I * S D W S I S C D N R P R R F SalI |TaqI |AccI ||HindII ||Hpy166II ||| Hpy99I ||| | MseI ||| | | Eco57I ||| | | Eco57MI ||| | | | BslFI ||| | | | | SetI ||| | | | | |TfiI BsrI MfeI ||| | | | | |HinfI HphI Hpy178III* TspEI \\\ \ \ \ \ \\ \ \ \ GTCGACGAAGCGTTAATCACAGGTGAATCTATGCCAGTCCCGAAAAAGTGTCAATCAATT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCTGCTTCGCAATTAGTGTCCACTTAGATACGGTCAGGGCTTTTTCACAGTTAGTTAA //// / / / / // / / |||SalI | SetI | | |HphI Hpy178III* TspEI ||AccI Eco57MI | | BsrI MfeI ||TaqI Eco57I | HinfI |Hpy166II MseI | TfiI |HindII BslFI Hpy99I V D E A L I T G E S M P V P K K C Q S I S T K R * S Q V N L C Q S R K S V N Q L R R S V N H R * I Y A S P E K V S I N C ----:----|----:----|----:----|----:----|----:----|----:----| T S S A N I V P S D I G T G F F H * D I L R R L T L * L H I * A L G S F T D I L D V F R * D C T F R H W D R F L T L * N AluI CviJI |DdeI |EspI* ||SetI ||| MwoI ||| |Cac8I ||| |HindIII ||| || AluI ||| || CviJI ||| || | SetI CviRI* HphI ||| || | |BssKI | MboI | Csp6I ||| || | |EcoRII | | DpnI | |RsaI ||| || | ||SecI* | | |BstKTI | |BsrI BseMII ||| || | |||ScrFI | | || BinI* | |TspRI |BspCNI ||| || | |||BseBI \ \ \\ \ \ \\ \\ \\\ \\ \ \\\\ GTTGTTGCAGGATCGGTGAATGGCACTGGTACTTTGTTTGTGAAGCTGAGCAAGCTTCCA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAACGTCCTAGCCACTTACCGTGACCATGAAACAAACACTTCGACTCGTTCGAAGGT / // / / / / / // // / / // / / / / | || MboI | | | | || |BspCNI | | || | | | BseBI | |DpnI | | | | || BseMII | | || | | | ScrFI | BstKTI | | | | |Csp6I | | || | | HindIII CviRI* | | | | RsaI | | || | CviJI | | | BsrI | | || | AluI | | HphI | | || Cac8I | TspRI | | || SetI BinI* | | |EspI* | | |DdeI | | MwoI | CviJI | AluI SetI V V A G S V N G T G T L F V K L S K L P L L Q D R * M A L V L C L * S * A S F Q C C R I G E W H W Y F V C E A E Q A S R ----:----|----:----|----:----|----:----|----:----|----:----| T T A P D T F P V P V K N T F S L L S G Q Q Q L I P S H C Q Y K T Q S A S C A E N N C S R H I A S T S Q K H L Q A L K W TspEI | MseI | |CspCI | || DdeI CspCI BccI | || TspDTI | Csp6I |CviJI | || | BinI* | |RsaI || XcmI TsoI | || | CviJI \ \\ \\ \ \ \ \\ \ \ GGGAACAATACTATTAGTACCATAGCCACGATGGTTGATGAAGCAAAATTAACTAAGCCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTTGTTATGATAATCATGGTATCGGTGCTACCAACTACTTCGTTTTAATTGATTCGGT / / // // / / // /// EcoRII | |Csp6I |XcmI TsoI | || ||BinI* BssKI | RsaI CviJI | || |CviJI SecI* CspCI BccI | || DdeI | |TspDTI | |MseI | TspEI CspCI G N N T I S T I A T M V D E A K L T K P G T I L L V P * P R W L M K Q N * L S Q E Q Y Y * Y H S H D G * * S K I N * A K ----:----|----:----|----:----|----:----|----:----|----:----| P F L V I L V M A V I T S S A F N V L G L S C Y * * Y W L W S P Q H L L I L * A P V I S N T G Y G R H N I F C F * S L W MboI XhoII TfiI | DpnI TspEI HinfI | |BstKTI | CviRI* | HphI \ \\ \ \ \ \ AAGATCCAAAATATCGCTGATAAAATTGCAAGTTATTTCGTGCCAACTATCATTGGAATC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGGTTTTATAGCGACTATTTTAACGTTCAATAAAGCACGGTTGATAGTAACCTTAG // / // / / || XhoII |CviRI* | HinfI || MboI TspEI | TfiI |DpnI | HphI BstKTI TspRI K I Q N I A D K I A S Y F V P T I I G I R S K I S L I K L Q V I S C Q L S L E S D P K Y R * * N C K L F R A N Y H W N H ----:----|----:----|----:----|----:----|----:----|----:----| F I W F I A S L I A L * K T G V I M P I L S G F Y R Q Y F Q L N N R A L * * Q F L D L I D S I F N C T I E H W S D N S D Tsp4CI* | TspRI BceAI | MaeIII | SfaNI | Tsp45I TstI | | AciI | | MmeI | AciI TfiI | | |TstI | | |SetI | TspGWI HinfI | | ||BsrBI \ \ \\ \ \ \ \ \ \\\ ACTGTCGTCACCTTTTGCGTTTGGATAGCGGTTGGAATCCGTGTGGAAAAGCAATCCCGC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TGACAGCAGTGGAAAACGCAAACCTATCGCCAACCTTAGGCACACCTTTTCGTTAGGGCG / /// / / / / // // | ||Tsp45I TstI | AciI HinfI || |BsrBI | ||MaeIII TspGWI TfiI || |AciI | |MmeI || SfaNI | SetI |BceAI Tsp4CI* TstI T V V T F C V W I A V G I R V E K Q S R L S S P F A F G * R L E S V W K S N P A C R H L L R L D S G W N P C G K A I P L ----:----|----:----|----:----|----:----|----:----|----:----| V T T V K Q T Q I A T P I R T S F C D R * Q R * R K R K S L P Q F G H P F A I G S D D G K A N P Y R N S D T H F L L G A Tsp4CI* |Csp6I Hpy188I CviJI ||RsaI |FauI TspEI HaeIII ||BslFI \\ \ \ \\\ TCCGATGCCGTAATTCAGGCCATTATATATGCCATTACGGTACTTATCGTTTCGTGTCCC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCTACGGCATTAAGTCCGGTAATATATACGGTAATGCCATGAATAGCAAAGCACAGGG / / / / / // / / | FauI | HaeIII | || BslFI AloI Hpy188I | CviJI | |Csp6I TspEI | RsaI Tsp4CI* S D A V I Q A I I Y A I T V L I V S C P P M P * F R P L Y M P L R Y L S F R V P R C R N S G H Y I C H Y G T Y R F V S L ----:----|----:----|----:----|----:----|----:----|----:----| E S A T I * A M I Y A M V T S I T E H G S R H R L E P W * I H W * P V * R K T D G I G Y N L G N Y I G N R Y K D N R T G TseI Hpy99I AloI |BisI | HgaI |Hin4I BceAI | | BbvI ||BlsI |AloI | | |CviRI* AcyI |||MnlI \\ \ \ \\ \ \\\\ TGCGTGATTGGACTTGCCGTTCCTATCGTATTTGTTATTGCAAGTGGCGTCGCTGCGAAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| ACGCACTAACCTGAACGGCAAGGATAGCATAAACAATAACGTTCACCGCAGCGACGCTTT / / // / /// /// BceAI AloI || | ||| ||TseI || | ||| |BisI || | ||| |MnlI || | ||| BlsI || | ||AcyI || | |Hin4I || | Hpy99I || BbvI |HgaI CviRI* C V I G L A V P I V F V I A S G V A A K A * L D L P F L S Y L L L Q V A S L R K R D W T C R S Y R I C Y C K W R R C E K ----:----|----:----|----:----|----:----|----:----|----:----| Q T I P S A T G I T N T I A L P T A A F R R S Q V Q R E * R I Q * Q L H R R Q S A H N S K G N R D Y K N N C T A D S R F EcoP15I | FatI | MboII | BbvII* | |CviAII | || NspI MboII Hin4I | || NlaIII \ \ \ \\ \ AGAGGGGTAATCTTCAAATCAGCAGAGAGTATAGAAGTTGCTCACAACACTTCGCATGTT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCCCCATTAGAAGTTTAGTCGTCTCTCATATCTTCAACGAGTGTTGTGAAGCGTACAA / / /// // MboII Hin4I ||| |BbvII* ||| |FatI ||| CviAII ||NlaIII ||NspI |MboII EcoP15I R G V I F K S A E S I E V A H N T S H V E G * S S N Q Q R V * K L L T T L R M L R G N L Q I S R E Y R S C S Q H F A C C ----:----|----:----|----:----|----:----|----:----|----:----| L P T I K L D A S L I S T A * L V E C T F L P L R * I L L S Y L L Q E C C K A H S P Y D E F * C L T Y F N S V V S R M N SfeI* |Tsp4CI* || TatI || |Csp6I Acc65I || ||RsaI HgiCI* || ||Eco57I |Csp6I || ||Eco57MI ||RsaI || |||FatI ||NlaIV || ||||CviAII ||| FalI || ||||| FalI ||| FalI || ||||| FalI ||| KpnI || ||||| NlaIII TaqI ||| | Hin4II* || ||||| | Tsp4CI* \ \\\ \ \ \\ \\\\\ \ \ GTCTTCGATAAAACGGGTACCCTAACTGAAGGAAAACTTACTGTAGTACATGAAACTGTT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAAGCTATTTTGCCCATGGGATTGACTTCCTTTTGAATGACATCATGTACTTTGACAA / // //// / / /// // / TaqI || |||Hin4II* | | ||| || Tsp4CI* || ||HgiCI* | | ||| |FatI || ||Acc65I | | ||| CviAII || |Csp6I | | ||TatI || NlaIV | | |NlaIII || RsaI | | |Csp6I |KpnI | | FalI FalI | | FalI FalI | | RsaI | Eco57MI | Eco57I | SfeI* Tsp4CI* V F D K T G T L T E G K L T V V H E T V S S I K R V P * L K E N L L * Y M K L L L R * N G Y P N * R K T Y C S T * N C * ----:----|----:----|----:----|----:----|----:----|----:----| T K S L V P V R V S P F S V T T C S V T Q R R Y F P Y G L Q L F V * Q L V H F Q D E I F R T G * S F S F K S Y Y M F S N TspDTI |MboI || DpnI || |BstKTI || || TspEI MseI || || |HphI Hin4II* TstI BfiI \\ \\ \\ \ \ \ AGGGGTGATCGTCATAATTCTCAATCTTTGTTGCTTGGATTAACTGAAGGAATAAAACAC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCCACTAGCAGTATTAAGAGTTAGAAACAACGAACCTAATTGACTTCCTTATTTTGTG / // / / / / / / / / | || MboI | TspEI | | TstI BfiI BsrI | |DpnI HphI | MseI | BstKTI Hin4II* TspDTI R G D R H N S Q S L L L G L T E G I K H G V I V I I L N L C C L D * L K E * N T G * S S * F S I F V A W I N * R N K T P ----:----|----:----|----:----|----:----|----:----|----:----| L P S R * L E * D K N S P N V S P I F C * P H D D Y N E I K T A Q I L Q L F L V P T I T M I R L R Q Q K S * S F S Y F V BsrI | Eco57I | Eco57MI | |FokI | || FatI | || NcoI | || StyI | || SecI* | || DsaI* | || |CviAII | || || NlaIII | || || | TaqII | || || | | BseGI | || || | | | TstI SfaNI SetI \ \\ \\ \ \ \ \ \ \ CCAGTTTCCATGGCAATAGCATCCTATCTCAAAGAAAAAGGTGTTTCTGCTCAAAATGTT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAAAGGTACCGTTATCGTAGGATAGAGTTTCTTTTTCCACAAAGACGAGTTTTACAA / / /// // / / | | ||| |BseGI SfaNI SetI | | ||| TstI | | ||TaqII | | ||DsaI* | | ||SecI* | | ||StyI | | ||NcoI | | ||FatI | | |CviAII | | FokI | NlaIII Eco57MI Eco57I P V S M A I A S Y L K E K G V S A Q N V Q F P W Q * H P I S K K K V F L L K M F S F H G N S I L S Q R K R C F C S K C F ----:----|----:----|----:----|----:----|----:----|----:----| G T E M A I A D * R L S F P T E A * F T G L K W P L L M R D * L F L H K Q E F H W N G H C Y C G I E F F F T N R S L I N AluI CviJI | SetI | MaeIII | Tsp45I | | FauI | | | BsrI | | | | AciI | | | | |Hin4II* MaeIII \ \ \ \ \\ \ TCTAATACAAAAGCTGTGACTGGTAAGCGGGTAGAAGGAACATCATACTCTGGTTTGAAG 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTATGTTTTCGACACTGACCATTCGCCCATCTTCCTTGTAGTATGAGACCAAACTTC / / / / / / / | CviJI | BsrI | AciI MnlI | AluI | FauI Hin4II* SetI Tsp45I MaeIII S N T K A V T G K R V E G T S Y S G L K L I Q K L * L V S G * K E H H T L V * S * Y K S C D W * A G R R N I I L W F E V ----:----|----:----|----:----|----:----|----:----|----:----| E L V F A T V P L R T S P V D Y E P K F K * Y L L Q S Q Y A P L L F M M S Q N S R I C F S H S T L P Y F S C * V R T Q L BinI* |MslI || MboI || | DpnI || | |BstKTI || | ||Hpy178III* || | ||| MaeII || | ||| | SetI || | ||| | TaiI || | ||| | |TaqI MnlI Tsp4CI* CviJI || | ||| | |AsuII CviJI \ \ \ \\ \ \\\ \ \\ \ TTACAAGGAGGGAACTGTCGTTGGCTTGGTCATAACAATGATCCTGACGTTCGAAAAGCC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTCCTCCCTTGACAGCAACCGAACCAGTATTGTTACTAGGACTGCAAGCTTTTCGG / / / / // / // / / / MaeIII Tsp4CI* CviJI | || | || | | CviJI | || | || | AsuII | || | || | TaqI | || | || MaeII | || | |TaiI | || | |SetI | || | Hpy178III* | || MboI | |DpnI | BstKTI BinI* MslI L Q G G N C R W L G H N N D P D V R K A Y K E G T V V G L V I T M I L T F E K P T R R E L S L A W S * Q * S * R S K S P ----:----|----:----|----:----|----:----|----:----|----:----| N C P P F Q R Q S P * L L S G S T R F A T V L L S S D N A Q D Y C H D Q R E F L * L S P V T T P K T M V I I R V N S F G MaeIII Tsp45I | BtsI | | AlwNI | | |SfeI* | | || CviRI* | | || | PstI | | || | TspRI | | || | | MwoI | | || | | BstAPI MseI | | || | | | MnlI \ \ \ \\ \ \ \ \ CTTGAACAAGGATATTCTGTATTCTGTTTTAGTGTTAATGGTTCAGTCACTGCAGTTTAT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTGTTCCTATAAGACATAAGACAAAATCACAATTACCAAGTCAGTGACGTCAAATA / // / / // / MseI || | | || EcoT22I || | | || MnlI || | | |BstAPI || | | |MwoI || | | SfeI* || | CviRI* || Tsp45I || MaeIII || PstI |AlwNI TspRI BtsI L E Q G Y S V F C F S V N G S V T A V Y L N K D I L Y S V L V L M V Q S L Q F M * T R I F C I L F * C * W F S H C S L C ----:----|----:----|----:----|----:----|----:----|----:----| R S C P Y E T N Q K L T L P E T V A T * G Q V L I N Q I R N * H * H N L * Q L K K F L S I R Y E T K T N I T * D S C N I CviRI* | EcoT22I | | HinfI MaeIII | |MlyI | SfaNI BsmAI |Hin4I | |PleI | |Hin4I AlwNI | MseI || MnlI \ \\ \ \\ \ \ \ \\ \ GCATTAGAGGACTCTTTACGGGCAGATGCTGTCTCCACTATTAACTTGTTACGCCAAAGA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAATCTCCTGAGAAATGCCCGTCTACGACAGAGGTGATAATTGAACAATGCGGTTTCT / // / / / / / / // | |PleI | HinfI SfaNI AlwNI | Hin4I |MaeIII | MlyI Hin4I | MseI MnlI CviRI* BsmAI A L E D S L R A D A V S T I N L L R Q R H * R T L Y G Q M L S P L L T C Y A K E I R G L F T G R C C L H Y * L V T P K R ----:----|----:----|----:----|----:----|----:----|----:----| A N S S E K R A S A T E V I L K N R W L H M L P S K V P L H Q R W * * S T V G F C * L V R * P C I S D G S N V Q * A L S TseI NlaIV |BisI BceAI |FokI ||BlsI | BccI BseGI |CviJI |||CviJI \ \ \ \\ \\\\ GGGATTTCACTACACATTTTATCAGGGGATGACGATGGAGCCGTTCGTTCTATGGCAGCC 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTAAAGTGATGTGTAAAATAGTCCCCTACTGCTACCTCGGCAAGCAAGATACCGTCGG / / / // / /// | | BseGI || FokI ||CviJI | BccI |CviJI ||TseI BceAI NlaIV |BisI BlsI G I S L H I L S G D D D G A V R S M A A G F H Y T F Y Q G M T M E P F V L W Q P D F T T H F I R G * R W S R S F Y G S P ----:----|----:----|----:----|----:----|----:----|----:----| P I E S C M K D P S S S P A T R E I A A L S K V V C K I L P H R H L R E N * P L P N * * V N * * P I V I S G N T R H C G MwoI BstAPI |SfeI* AluI |Cac8I BbvI CviJI || CviRI* |TspEI | SetI SspI || | PstI \\ \ \ \ \\ \ \ CGTCTTGGAATTGAAAGCTCCAATATTCGTTCTCACGCAACGCCTGCAGAAAAGAGTGAA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGAACCTTAACTTTCGAGGTTATAAGCAAGAGTGCGTTGCGGACGTCTTTTCTCACTT // / / / / / / / || | CviJI SspI | | | SfeI* || | AluI | | CviRI* || SetI | Cac8I |TspEI | PstI BbvI BstAPI MwoI R L G I E S S N I R S H A T P A E K S E V L E L K A P I F V L T Q R L Q K R V N S W N * K L Q Y S F S R N A C R K E * I ----:----|----:----|----:----|----:----|----:----|----:----| R R P I S L E L I R E * A V G A S F L S G D Q F Q F S W Y E N E R L A Q L F S H T K S N F A G I N T R V C R R C F L T F AgeI TspEI BetI* Hin4II* | MboII Cfr10I MseI | TaqI | | MboII |HpaII \ \ \ \ \ \ \\ TATATTAAGGATATTGTCGAAGGAAGAAATTGCGATAGTTCTTCGCAGTCAAAAAGACCG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAATTCCTATAACAGCTTCCTTCTTTAACGCTATCAAGAAGCGTCAGTTTTTCTGGC / / / / / / MseI | TaqI | MboII HpaII Hin4II* TspEI MboII Y I K D I V E G R N C D S S S Q S K R P I L R I L S K E E I A I V L R S Q K D R Y * G Y C R R K K L R * F F A V K K T G ----:----|----:----|----:----|----:----|----:----|----:----| Y I L S I T S P L F Q S L E E C D F L G I Y * P Y Q R L F F N R Y N K A T L F V I N L I N D F S S I A I T R R L * F S R HphI | Bce83I* | | Hpy99I | | |MfeI | | |TspEI | | |TspGWI AciI | | || MlyI | MaeIII | | || PleI HinfI Hin4I | Tsp45I | | || |HgaI | SmlI | TspDTI \ \ \ \ \\ \\ \ \ \ \ GTTGTTGTTTTTTGCGGTGACGGAACAAACGACGCAATTGGTTTGACTCAAGCAACGATT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAACAAAAAACGCCACTGCCTTGTTTGCTGCGTTAACCAAACTGAGTTCGTTGCTAA / / / / // / // / / / / Cfr10I AciI | | || | |PleI | | | TspDTI BetI* | | || | TspEI | | SmlI AgeI | | || | MfeI | HinfI | | || | MlyI | Hin4I | | || TspGWI HgaI | | |Bce83I* | | Hpy99I | HphI Tsp45I MaeIII V V V F C G D G T N D A I G L T Q A T I L L F F A V T E Q T T Q L V * L K Q R L C C F L R * R N K R R N W F D S S N D W ----:----|----:----|----:----|----:----|----:----|----:----| T T T K Q P S P V F S A I P K V * A V I P Q Q K K R H R F L R R L Q N S E L L S N N N K A T V S C V V C N T Q S L C R N NheI AluI CviJI |MaeI |MwoI ||SetI ||Cac8I ||| TseI ||| AluI ||| BmtI MnlI ||| CviJI | MslI Hin4I ||| |BisI | | EcoP15I | BbvI ||| ||BlsI | | | MnlI | | SetI ||| ||SetI MseI \ \ \ \ \ \ \ \\\ \\\ \ GGAGTTCATATCAATGAGGGAAGTGAGGTTGCCAAGCTAGCTGCTGATGTAGTTATGTTA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCAAGTATAGTTACTCCCTTCACTCCAACGGTTCGATCGACGACTACATCAATACAAT / / / / / / / / / ////// / | | | | | SetI | | | |||||TseI MseI | | | | Hin4I | | | ||||BisI | | | MnlI | | | |||BlsI | | EcoP15I | | | ||CviJI | MslI | | | ||NheI MnlI | | | ||AluI | | | |MaeI | | | Cac8I | | | SetI | | CviJI | | AluI | | BmtI | MwoI | SetI BbvI G V H I N E G S E V A K L A A D V V M L E F I S M R E V R L P S * L L M * L C * S S Y Q * G K * G C Q A S C * C S Y V K ----:----|----:----|----:----|----:----|----:----|----:----| P T * I L S P L S T A L S A A S T T I N Q L E Y * H P F H P Q W A L Q Q H L * T S N M D I L S T L N G L * S S I Y N H * CviJI HaeIII |FatI AluI ||CviAII CviJI ||| NlaIII CviJI | SetI SspI Tsp4CI* ||| | BsiYI* \ \ \ \ \ \\\ \ \ AAGCCAAAGCTCAACAATATTTTGACTATGATAACTGTAAGTCAAAAGGCCATGTTTAGG 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGGTTTCGAGTTGTTATAAAACTGATACTATTGACATTCAGTTTTCCGGTACAAATCC / / / / / // // | | CviJI SspI Tsp4CI* || |FatI | | AluI || BsiYI* | SetI || CviAII CviJI |NlaIII HaeIII CviJI K P K L N N I L T M I T V S Q K A M F R S Q S S T I F * L * * L * V K R P C L G A K A Q Q Y F D Y D N C K S K G H V * G ----:----|----:----|----:----|----:----|----:----|----:----| F G F S L L I K V I I V T L * F A M N L L A L A * C Y K S * S L Q L D F P W T * L W L E V I N Q S H Y S Y T L L G H K P BsiYI* |AciI ||BisI TspEI |||BlsI | ApoI ||||TauI | TspEI ||||CviJI \ \ \\\\\ GTCAAATTGAATTTCTTATGGAGTTTTACTTACAACTTATTTGCTATCCTTTTGGCGGCT 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTTAACTTAAAGAATACCTCAAAATGAATGTTGAATAAACGATAGGAAAACCGCCGA / / / //// | TspEI | |||CviJI | ApoI | |||MwoI TspEI | ||BisI | ||AciI | |BlsI | TauI BsiYI* V K L N F L W S F T Y N L F A I L L A A S N * I S Y G V L L T T Y L L S F W R L Q I E F L M E F Y L Q L I C Y P F G G W ----:----|----:----|----:----|----:----|----:----|----:----| T L N F K K H L K V * L K N A I R K A A P * I S N R I S N * K C S I Q * G K P P D F Q I E * P T K S V V * K S D K Q R S MwoI HgiCI* | NlaIV | | TspDTI | | | HindII SpeI | | | Hpy166II FauI AciI |MaeI \ \ \ \ \ \ \\ GGTGCCTTTGTTGACTTTCATATTCCACCAGAGTATGCGGGTTTAGGGGAACTAGTTAGT 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGGAAACAACTGAAAGTATAAGGTGGTCTCATACGCCCAAATCCCCTTGATCAATCA / / / / / // | HgiCI* Hpy166II FauI AciI |SpeI | TspDTI HindII MaeI NlaIV G A F V D F H I P P E Y A G L G E L V S V P L L T F I F H Q S M R V * G N * L V C L C * L S Y S T R V C G F R G T S * Y ----:----|----:----|----:----|----:----|----:----|----:----| P A K T S K * I G G S Y A P K P S S T L Q H R Q Q S E Y E V L T H P N L P V L * T G K N V K M N W W L I R T * P F * N T BciVI |BarI AluI |TspEI CviJI CviRI* || MnlI | SetI | BarI \\ \ \ \ \ \ ATCCTCCCTGTAATTTTTGTAGCTATACTTCTGCGTTATGCAAAGATTTAG 3610 3620 3630 3640 3650 ----:----|----:----|----:----|----:----|----:----|- TAGGAGGGACATTAAAAACATCGATATGAAGACGCAATACGTTTCTAAATC / / / / / / / / | | | | | CviJI | CviRI* | | | | | AluI BarI | | | | SetI | | | TspEI | | MnlI | BciVI BarI I L P V I F V A I L L R Y A K I * S S L * F L * L Y F C V M Q R F X P P C N F C S Y T S A L C K D L X ----:----|----:----|----:----|----:----|----:----|- I R G T I K T A I S R R * A F I * Y G G Q L K Q L * V E A N H L S K D E R Y N K Y S Y K Q T I C L N L # Enzymes that cut Frequency Isoschizomers Acc65I 3 Asp718I AccI 2 FblI,XmiI AciI 12 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AgeI 3 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AloI 1 AluI 19 AluBI AlwNI 2 CaiI ApoI 7 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 11 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 9 Bce83I* 4 BpuEI BceAI 3 BcgI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 4 BsaWI BfiI 1 BmrI,BmuI BglI 1 BglII 1 BinI* 9 AlwI,BspPI,AclWI BisI 13 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 13 BmgT120I 2 BmtI 2 BspOI Bpu10I 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 8 BstF5I,BtsCI BseMII 7 BsePI 1 BssHII,PauI BseRI 2 BseYI 2 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 9 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 6 BspHI 1 CciI,PagI,RcaI BsrBI 2 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 9 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 2 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 12 BstXI 1 BtgZI 2 BtsI 1 Cac8I 8 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 14 CviQI,RsaNI CspCI 1 CviAII 12 CviJI 43 CviKI-1 CviRI* 18 HpyCH4V DdeI 10 BstDEI,HpyF3I DpnI 12 MalI DraIII 1 AdeI DsaI* 2 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 6 AcuI Eco57MI 6 EcoP15I 2 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoT22I 2 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 12 FauI 4 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 8 GlaI 3 GsaI 2 HaeII 1 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 4 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 5 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 11 Hin4II* 9 HpyAV Hin6I 3 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 16 HpaII 5 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 16 Hpy188III Hpy188I 3 Hpy99I 3 KpnI 3 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 7 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 14 MboI 12 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 13 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 4 MunI MlyI 3 SchI MmeI 5 MnlI 18 MseI 19 Tru1I,Tru9I MslI 9 RseI,SmiMI MwoI 8 HpyF10VI,BstMWI NcoI 2 Bsp19I NheI 2 AsuNHI NlaIII 12 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 2 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 3 PpsI PstI 2 PvuII 2 RsaI 14 AfaI SalI 1 SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 39 SfaNI 9 LweI SfeI* 4 BstSFI,SfcI,BfmI SmlI 5 SmoI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI SspI 5 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 8 TaqII 1 TatI 4 TauI 2 TfiI 13 PfeI TseI 11 ApeKI TsoI 1 Tsp45I 7 NmuCI Tsp4CI* 13 HpyCH4III,TaaI,Bst4CI TspDTI 12 TspEI 26 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 5 TscAI TstI 3 VspI 2 PshBI,AseI XbaI 1 XcmI 1 XhoII 7 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflIII AjuI AlfI ApaI ApaLI AscI AvaI AvrII BaeI BamHI BbvCI BdaI BmeT110I BplI BsaAI BsaBI BsaXI BseSI BsmI Bsp120I BspLU11I* BspMI BspMII* BssNAI Bst1107I BstZ17I BtrI CauII* Cfr9I ClaI DinI DraII DrdI Eam1105I EciI Ecl136II EcoICRI EcoNI EcoRV EgeI EheI FseI FspAI GsuI HpaI KasI MauBI MluI MroNI MstI* NaeI NarI NdeI NgoMIV NmeAIII NotI NruI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SanDI SapI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SplI* SrfI Sse232I* Sse8387I SwaI TspMI Tth111I XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769