Restriction Map of DPB3/YBR278W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DPB3/YBR278W on chromosome II from coordinates 760294 to 760899.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.22131

MmeI DdeI MseI |SetI \ \ \\ ATGTCCAACTTAGTTAAAGAAAAAGCACCTGTCTTTCCTATATCTAAAGTAAAGAAGATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGTTGAATCAATTTCTTTTTCGTGGACAGAAAGGATATAGATTTCATTTCTTCTAA / / // | MseI |MmeI DdeI SetI M S N L V K E K A P V F P I S K V K K I C P T * L K K K H L S F L Y L K * R R L V Q L S * R K S T C L S Y I * S K E D C ----:----|----:----|----:----|----:----|----:----|----:----| X D L K T L S F A G T K G I D L T F F I X T W S L * L F L V Q R E * I * L L S S H G V * N F F F C R D K R Y R F Y L L N MaeII EcoP15I |BsaAI | AluI AciI |SnaBI | CviJI McrI* || SetI | | SetI | BsmI || TaiI | | | MwoI | |BseMII MboII || TspEI | | | | BbvI | ||BspCNI \ \\ \ \ \ \ \ \ \ \\\ GCCAAATGCGACCCCGAATACGTAATTACATCTAATGTAGCTATATCAGCGACCGCATTC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTTACGCTGGGGCTTATGCATTAATGTAGATTACATCGATATAGTCGCTGGCGTAAG / / // / / / / / ///// / MboII | || TspEI | | | MwoI ||||| BstAPI | |MaeII | | CviJI ||||| MwoI | SnaBI | | AluI ||||BspCNI | BsaAI | SetI ||||AciI TaiI EcoP15I |||BseMII SetI ||BsmI |BbvI McrI* A K C D P E Y V I T S N V A I S A T A F P N A T P N T * L H L M * L Y Q R P H S Q M R P R I R N Y I * C S Y I S D R I R ----:----|----:----|----:----|----:----|----:----|----:----| A L H S G S Y T I V D L T A I D A V A N Q W I R G R I R L * M * H L * I L S R M G F A V G F V Y N C R I Y S Y * R G C E TseI TatI MwoI Bsp1407I BstAPI |Csp6I TaqI |BisI ||RsaI | Hpy99I ApoI ||BlsI ||| TfiI | | TfiI MboII TspEI ||| DdeI ||| HinfI | | HinfI | DdeI EcoRI \\\ \ \\\ \ \ \ \ \ \ \ GCTGCTGAGTTATTTGTACAGAATCTCGTCGAAGAATCGCTGGTCTTAGCACAACTGAAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGACTCAATAAACATGTCTTAGAGCAGCTTCTTAGCGACCAGAATCGTGTTGACTTA /// / /// / / / / / / ||| DdeI ||| | | TaqI | MboII DdeI ||TseI ||| | Hpy99I HinfI |BisI ||| HinfI TfiI BlsI ||| TfiI ||Bsp1407I ||TatI |Csp6I RsaI A A E L F V Q N L V E E S L V L A Q L N L L S Y L Y R I S S K N R W S * H N * I C * V I C T E S R R R I A G L S T T E F ----:----|----:----|----:----|----:----|----:----|----:----| A A S N N T C F R T S S D S T K A C S F R Q Q T I Q V S D R R L I A P R L V V S S S L * K Y L I E D F F R Q D * C L Q I MseI | CviJI | | ApoI TaqI | | TspEI TaqI AsuII CviJI | | | SfeI* | MboII \ \ \ \ \ \ \ \ TCGAAAGGAAAGACAAGCCTACGATTAAGCCTAAATTCTATAGAAGAATGTGTCGAAAAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTTCCTTTCTGTTCGGATGCTAATTCGGATTTAAGATATCTTCTTACACAGCTTTTT / / / / / / / // | AsuII CviJI | CviJI | SfeI* |TaqI | TaqI MseI TspEI MboII EcoRI ApoI TspEI ApoI S K G K T S L R L S L N S I E E C V E K R K E R Q A Y D * A * I L * K N V S K K E R K D K P T I K P K F Y R R M C R K K ----:----|----:----|----:----|----:----|----:----|----:----| E F P F V L R R N L R F E I S S H T S F N S L F S L G V I L G L N * L L I H R F R F S L C A * S * A * I R Y F F T D F F MnlI Hin6I SfaNI |GlaI |SetI |MboII || XbaI ||HhaI || |MaeI BseGI ||| MboII TspEI || |Hpy178III* | MseI FokI ||| | TaqI \ \\ \\ \ \ \ \\\ \ \ AGAGATAATTTCAGGTTTCTAGAGGATGCCATTAAACAACTGAAGAAGAATAGCGCACTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTATTAAAGTCCAAAGATCTCCTACGGTAATTTGTTGACTTCTTCTTATCGCGTGAG / / / / // / / / //// / | | MnlI | |XbaI BseGI MseI FokI |||| Eco57MI | SetI | Hpy178III* |||| Eco57I TspEI | MaeI |||MboII SfaNI ||Hin6I |GlaI MboII HhaI R D N F R F L E D A I K Q L K K N S A L E I I S G F * R M P L N N * R R I A H S R * F Q V S R G C H * T T E E E * R T R ----:----|----:----|----:----|----:----|----:----|----:----| L S L K L N R S S A M L C S F F F L A S F L Y N * T E L P H W * V V S S S Y R V S I I E P K * L I G N F L Q L L I A C E MboII | FatI | |CviAII | || NspI | || CviRI* | || NlaIII | || | BssKI | || | |HpaII | || | ||ScrFI | || | ||CauII* | || | ||| Hpy188I | || | ||| | MnlI | || | ||| | MboI | || | ||| | | DpnI | || | ||| | | |BstKTI | || | ||| | | ||Hpy178III* | || | ||| | | ||| BcgI Eco57I | || | ||| | | ||| | SetI Eco57MI MmeI | || | ||| | | ||| | | SapI Ksp632I* BcgI | || | ||| | | ||| | | Ksp632I* \ \ \ \\ \ \\\ \ \ \\\ \ \ \ GACAAGAAGAGAGAACTAAACATGCAACCGGGTCGGAGCGATCAAGAGGTTGTTATAGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTCTTCTCTCTTGATTTGTACGTTGGCCCAGCCTCGCTAGTTCTCCAACAATATCTT / / / / / // / / / / // / // / | | BcgI | | || | | | | || | |SetI Ksp632I* | | MmeI | | || | | | | || | Hpy178III* SapI | Ksp632I* | | || | | | | || | BcgI TaqI | | || | | | | || MboI | | || | | | | |DpnI | | || | | | | BstKTI | | || | | | MnlI | | || | | Hpy188I | | || | BssKI | | || CauII* | | || HpaII | | || ScrFI | | |CviRI* | | |FatI | | CviAII | NlaIII | NspI MboII D K K R E L N M Q P G R S D Q E V V I E T R R E N * T C N R V G A I K R L L * K Q E E R T K H A T G S E R S R G C Y R R ----:----|----:----|----:----|----:----|----:----|----:----| S L F L S S F M C G P R L S * S T T I S R C S S L V L C A V P D S R D L P Q * L V L L S F * V H L R T P A I L L N N Y F Hin4I CviJI Hin4I | TspEI | MnlI | | MnlI | |MboII | | MwoI | || MboII | | |MboII | || | MboII | | || FatI | || | |BbvII* | | || CviRI* | || | || MboII | | || |CviAII | || | || |SetI | | || || BccI | || | || || MboII | | || || NlaIII MnlI | || | || || |BarI | | || || |MslI BseGI FokI | || | || || ||Hpy188I \ \ \\ \\ \\ \ \ \ \\ \ \\ \\ \\\ GAGCCTGAATTGCATGAGGATGATGGTGTAGAGGAAGAAGAAGAAGAAGACGAGGTATCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGACTTAACGTACTCCTACTACCACATCTCCTTCTTCTTCTTCTTCTGCTCCATAGG / / // // /// // / // / // / / / | | || || ||MslI |MnlI Hin4I || | || | | Hpy188I | | || || ||BccI BseGI Hin4I || | || | BbvII* | | || || |FatI FokI || | || | MboII | | || || CviAII || | || MboII | | || |CviRI* || | || BarI | | || |NlaIII || | |SetI | | || TspEI || | MboII | | |MboII || MboII | | MnlI |MboII | MwoI MnlI CviJI E P E L H E D D G V E E E E E E D E V S S L N C M R M M V * R K K K K K T R Y P A * I A * G * W C R G R R R R R R G I R ----:----|----:----|----:----|----:----|----:----|----:----| S G S N C S S S P T S S S S S S S S T D L A Q I A H P H H H L P L L L L L R P I L R F Q M L I I T Y L F F F F F V L Y G CviJI Hin4I Hin4I |MboII ||SduI ||HgiJII* ||| Csp6I ||| MboII ||| |FalI XmnI MboI ||| |FalI | BarI |FalI SapI ||| |RsaI | | Hpy178III* |FalI Ksp632I* ||| ||Hpy166II | | | MboII ||DpnI | BciVI ||| |||MboII | | | |TspDTI |||BstKTI \ \ \\\ \\\\ \ \ \ \\ \\\\ GAAGAAGAAGAGCCCGTACACAATGAAGAACTTCTTGATGATAGTAAAGATCAACAAAAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTCTTCTCGGGCATGTGTTACTTCTTGAAGAACTACTATCATTTCTAGTTGTTTTA / / / / / // / / / / // / | | | | | || | XmnI | FalI || MboI | | | | | || BarI | FalI |DpnI | | | | | |Hpy166II Hpy178III* BstKTI | | | | | |MboII TspDTI | | | | | |Csp6I MboII | | | | | RsaI | | | | MboII | | | MboII | | | CviJI | | | FalI | | | FalI | | HgiJII* | | SduI | Hin4I | Hin4I Ksp632I* BciVI SapI E E E E P V H N E E L L D D S K D Q Q N K K K S P Y T M K N F L M I V K I N K M R R R A R T Q * R T S * * * * R S T K * ----:----|----:----|----:----|----:----|----:----|----:----| S S S S G T C L S S S R S S L L S * C F R L L L A R V C H L V E Q H Y Y L D V F F F F L G Y V I F F K K I I T F I L L I BtsI TspRI | Cac8I Hin6I | HindIII TaqI FnuDII* | | AluI |Hpy178III* |GlaI | | CviJI || TfiI ||HhaI | | | SetI || HinfI |||XcmI | | | Cac8I || | BsrI AciI MaeI \\\\ \ \ \ \ \\ \ \ \ \ GATAAATCCACGCGCAGTGTGGCAAGCTTGCTGTCGAGATTCCAGTATAAATCCGCACTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTAGGTGCGCGTCACACCGTTCGAACGACAGCTCTAAGGTCATATTTAGGCGTGAT /// / / / / // // / / ||| BtsI | | HindIII || |HinfI AciI MaeI ||Hin6I | | Cac8I || |TfiI ||XcmI | CviJI || BsrI |GlaI | AluI |Hpy178III* FnuDII* Cac8I TaqI TspRI SetI HhaI D K S T R S V A S L L S R F Q Y K S A L I N P R A V W Q A C C R D S S I N P H * * I H A Q C G K L A V E I P V * I R T R ----:----|----:----|----:----|----:----|----:----|----:----| S L D V R L T A L K S D L N W Y L D A S H Y I W A C H P L S A T S I G T Y I R V I F G R A T H C A Q Q R S E L I F G C * MlyI PleI Hpy188I BinI* MaeII |MboII Ksp632I* HindII | MboI | SetI || Hpy188I | EcoRV Hpy166II | | DpnI | TaiI || |HinfI | | TaqI | MmeI | | |BstKTI \ \ \\ \\ \ \ \ \ \ \ \ \\ GACGTAGGAGAACACTCCGACTCTTCTGATATCGAAGTTGACCATACGAAAAGCACCGAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCATCCTCTTGTGAGGCTGAGAAGACTATAGCTTCAACTGGTATGCTTTTCGTGGCTA / / // / / / / / / / // | MaeII || | | | | TaqI Hpy166II | |DpnI TaiI || | | | Ksp632I* HindII | BstKTI SetI || | | | EcoRV MmeI BinI* || | | Hpy188I || | HinfI || Hpy188I |PleI MboII MlyI D V G E H S D S S D I E V D H T K S T D T * E N T P T L L I S K L T I R K A P I R R R T L R L F * Y R S * P Y E K H R S ----:----|----:----|----:----|----:----|----:----|----:----| S T P S C E S E E S I S T S W V F L V S L R L L V S R S K Q Y R L Q G Y S F C R V Y S F V G V R R I D F N V M R F A G I DdeI \ CCTTAG ----:- GGAATC / / | DdeI MboI P * L X L X ----:- G * D K R L # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AluI 2 AluBI ApoI 2 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 BcgI 1 BciVI 1 BfuI BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BsaAI 1 BstBAI,Ppu21I BseGI 2 BstF5I,BtsCI BseMII 1 BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 1 BstKTI 3 BtsI 1 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 2 CviQI,RsaNI CviAII 2 CviJI 6 CviKI-1 CviRI* 2 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 3 MalI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRI 1 EcoRV 1 Eco32I FalI 2 FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 2 HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 4 HpaII 1 HapII,BsiSI,MspI Hpy166II 2 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 4 Hpy99I 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 17 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 1 SchI MmeI 3 MnlI 5 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NspI 1 BstNSI,XceI PleI 1 PpsI RsaI 2 AfaI SapI 2 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SetI 8 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SnaBI 1 Eco105I,BstSNI TaiI 2 TaqI 6 TatI 1 TfiI 3 PfeI TseI 1 ApeKI TspDTI 1 TspEI 5 TasI,Tsp509I,Sse9I TspRI 1 TscAI XbaI 1 XcmI 1 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII AvrII BaeI BalI BamHI BbvCI Bce83I* BceAI BclI BdaI BetI* BfiI BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaBI BsaXI BseBI BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI Bsp120I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I Bst2UI BstEII BstNI BstOI BstXI BstZ17I BtgZI BtrI Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRII EcoT22I EgeI EheI Esp3I EspI* FaqI FauI FseI FspAI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* Hin4II* HpaI HphI KasI KpnI MaeIII MauBI MfeI MluI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TauI TsoI Tsp45I Tsp4CI* TspGWI TspMI TstI Tth111I VspI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769