Restriction Map of PPS1/YBR276C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

PPS1/YBR276C on chromosome II from coordinates 760043 to 757620.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 MnlI BssKI SexAI EcoRII | ScrFI | BseBI | |SetI | ||DraIII | ||| Hpy166II | ||| | FatI | ||| | CviRI* | ||| | |CviAII | ||| | || MboI | ||| | || |HphI | ||| | || |NlaIII SduI | ||| | || ||DpnI BseSI | ||| | || |||BstKTI SfaNI \ \ \\\ \ \\ \\\\ \ ATGGTTTTGGAAGTGCCCTCAATCACACCTGGTGAACTGCATGATCTTATGCGACTACAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAAAACCTTCACGGGAGTTAGTGTGGACCACTTGACGTACTAGAATACGCTGATGTA / / / / / / / /// / / BseSI | | | | | | ||| MboI SfaNI SduI | | | | | | ||DpnI | | | | | | |BstKTI | | | | | | |FatI | | | | | | CviAII | | | | | | HphI | | | | | CviRI* | | | | | NlaIII | | | | Hpy166II | | | EcoRII | | | SexAI | | | BssKI | | BseBI | | ScrFI | DraIII MnlI SetI M V L E V P S I T P G E L H D L M R L H W F W K C P Q S H L V N C M I L C D Y I G F G S A L N H T W * T A * S Y A T T S ----:----|----:----|----:----|----:----|----:----|----:----| X T K S T G E I V G P S S C S R I R S C X P K P L A R L * V Q H V A H D * A V V H N Q F H G * D C R T F Q M I K H S * M BssKI SecI* EcoRII |PasI |SecI* ||ScrFI ||BseBI ||| CviJI ||| | FatI ||| | SduI ||| | BspHI ||| | HgiJII* Hpy178III* CviJI ||| | |CviAII | CviRI* HaeIII ||| | |Hpy178III* |MslI | BseGI |FokI ||| | || NlaIII \\ \ \ \\ \\\ \ \\ \ CAGGATGCAGAATGGCCTGAATGTAAAAAAATGTTCCCCTGGGCTCATGATATTTCCTTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTACGTCTTACCGGACTTACATTTTTTTACAAGGGGACCCGAGTACTATAAAGGAAA // / / / //// / // || CviRI* | FokI |||| | |BspHI || BseGI HaeIII |||| | |FatI |Hpy178III* CviJI |||| | Hpy178III* MslI |||| | CviAII |||| NlaIII |||CviJI ||EcoRII ||BssKI ||SecI* |HgiJII* |SecI* |PasI |SduI BseBI ScrFI Q D A E W P E C K K M F P W A H D I S F R M Q N G L N V K K C S P G L M I F P L G C R M A * M * K N V P L G S * Y F L W ----:----|----:----|----:----|----:----|----:----|----:----| * S A S H G S H L F I N G Q A * S I E K D P H L I A Q I Y F F T G R P E H Y K R L I C F P R F T F F H E G P S M I N G K MnlI | CviRI* HindII | | AlfI Hpy166II | | AlfI SfaNI Hpy188I TspEI \ \ \ \ \ \ \ GGTCAACCACCCGATTTTCCTCATTCTCTTGCAATAGTCAAATCGCAATCAGATGCTAAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGTTGGTGGGCTAAAAGGAGTAAGAGAACGTTATCAGTTTAGCGTTAGTCTACGATTG / / // / / Hpy166II | |AlfI | Hpy188I HindII | |AlfI SfaNI | CviRI* MnlI G Q P P D F P H S L A I V K S Q S D A N V N H P I F L I L L Q * S N R N Q M L T S T T R F S S F S C N S Q I A I R C * Q ----:----|----:----|----:----|----:----|----:----|----:----| P * G G S K G * E R A I T L D C D S A L Q D V V R N E E N E Q L L * I A I L H * T L W G I K R M R K C Y D F R L * I S V BsrI Hin6I | PfoI |GlaI | BssKI |AlfI | EcoRII |AlfI Hpy178III* | | ScrFI ||HhaI TspEI |TaqI MboII EcoRV | | BseBI \\\ \ \\ \ \ \ \ \ AATTCTGCGCTTTTGCGTAATTCTCTCGAAGTGAATGATATCTTCCAGTCCTGGAAAGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGACGCGAAAACGCATTAAGAGAGCTTCACTTACTATAGAAGGTCAGGACCTTTCAA / //// / // / / / / / / | |||Hin6I | || MboII | BsrI | | TspDTI | ||GlaI | |TaqI EcoRV | EcoRII | |HhaI | Hpy178III* | BssKI | AlfI TspEI | PfoI | AlfI BseBI TspEI ScrFI N S A L L R N S L E V N D I F Q S W K V I L R F C V I L S K * M I S S S P G K F F C A F A * F S R S E * Y L P V L E S S ----:----|----:----|----:----|----:----|----:----|----:----| L E A S K R L E R S T F S I K W D Q F T C N Q A K A Y N E R L S H Y R G T R S L I R R K Q T I R E F H I I D E L G P F N BsrI | XmnI | |TfiI TspDTI MnlI SetI | |HinfI \ \ \ \ \\ CGCACTTCCTTTCATAGAGAGGGCGATACCTGTGAAACTGGAAATGATTCTAATGGTTTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GCGTGAAGGAAAGTATCTCTCCCGCTATGGACACTTTGACCTTTACTAAGATTACCAAAA / / / / / MnlI SetI BsrI | HinfI | TfiI XmnI R T S F H R E G D T C E T G N D S N G F A L P F I E R A I P V K L E M I L M V F H F L S * R G R Y L * N W K * F * W F S ----:----|----:----|----:----|----:----|----:----|----:----| R V E K * L S P S V Q S V P F S E L P K E C K R E Y L P R Y R H F Q F H N * H N A S G K M S L A I G T F S S I I R I T K MfeI Hpy188I TspEI \ \ CAATATCCCAATAACACAAAGGAACTTTTGAACTTGCTAAAGTTTCAGATACGACAATTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATAGGGTTATTGTGTTTCCTTGAAAACTTGAACGATTTCAAAGTCTATGCTGTTAAC / / Hpy188I TspEI MfeI Q Y P N N T K E L L N L L K F Q I R Q L N I P I T Q R N F * T C * S F R Y D N W I S Q * H K G T F E L A K V S D T T I G ----:----|----:----|----:----|----:----|----:----|----:----| * Y G L L V F S S K F K S F N * I R C N E I D W Y C L P V K S S A L T E S V V I L I G I V C L F K Q V Q * L K L Y S L Q BseGI TseI TspEI | BbvI |BisI MaeIII | CviRI* | | FokI ||BlsI Tsp45I \ \ \ \ \ \\\ \ GAATTGCAAGTGGATGATGTTGCTTTGGAAAACGCTGCTACTTATTGTCACAATCATAGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACGTTCACCTACTACAACGAAACCTTTTGCGACGATGAATAACAGTGTTAGTATCG // / / / /// / |CviRI* BseGI | FokI ||TseI Tsp45I TspEI BbvI |BisI MaeIII BlsI E L Q V D D V A L E N A A T Y C H N H S N C K W M M L L W K T L L L I V T I I A I A S G * C C F G K R C Y L L S Q S * H ----:----|----:----|----:----|----:----|----:----|----:----| S N C T S S T A K S F A A V * Q * L * L P I A L P H H Q K P F R Q * K N D C D Y F Q L H I I N S Q F V S S S I T V I M A Hpy188I | BinI* | | MboI | | XhoII | | | DpnI | | | |BstKTI SetI | | | || BsiI* | XbaI | | | || | Hpy166II | |MaeI | | | || | | MnlI MseI | |Hpy178III* \ \ \ \\ \ \ \ \ \ \\ ATTTTACCATTTCTGAAAGTAGATCCTCGTGGACTATCATTAGAACTTAAAAGGTATTCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAATGGTAAAGACTTTCATCTAGGAGCACCTGATAGTAATCTTGAATTTTCCATAAGA / / // / // / / / | | || | || MnlI | SetI | | || | |Hpy166II MseI | | || | BsiI* | | || XhoII | | || MboI | | |DpnI | | BstKTI | BinI* Hpy188I I L P F L K V D P R G L S L E L K R Y S F Y H F * K * I L V D Y H * N L K G I L F T I S E S R S S W T I I R T * K V F * ----:----|----:----|----:----|----:----|----:----|----:----| M K G N R F T S G R P S D N S S L L Y E C K V M E S L L D E H V I M L V * F T N N * W K Q F Y I R T S * * * F K F P I R AcyI MaeII |ZraI |TspGWI || SetI || TaiI || AatII || Hin4II* SetI || | MnlI \ \\ \ \ AGAAACAAGGTTGGGTCTAATACCACGCTAAAACGGAGTGGGCAGGACGTCTGGGGAAGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTGTTCCAACCCAGATTATGGTGCGATTTTGCCTCACCCGTCCTGCAGACCCCTTCC // / / // / |XbaI SetI | || MnlI Hpy178III* | |Hin4II* MaeI | |MaeII | |AcyI | ZraI TspGWI AatII TaiI SetI R N K V G S N T T L K R S G Q D V W G R E T R L G L I P R * N G V G R T S G E G K Q G W V * Y H A K T E W A G R L G K E ----:----|----:----|----:----|----:----|----:----|----:----| L F L T P D L V V S F R L P C S T Q P L * F C P Q T * Y W A L V S H A P R R P F S V L N P R I G R * F P T P L V D P S P SetI | Hin4II* SetI | | Hpy188I |CviRI* | | | SetI || BspMI | | | |TaqI || | BsrDI \ \ \ \\ \\ \ \ AGAGGTCTATTCCGAAGGTTCGACCTGCAATGTGCCAAGATGATAGAAATGGTTGATAAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCCAGATAAGGCTTCCAAGCTGGACGTTACACGGTTCTACTATCTTTACCAACTATTA / / / / / / / / SetI | | SetI TaqI | | BspMI | Hpy188I SetI | BsrDI Hin4II* CviRI* R G L F R R F D L Q C A K M I E M V D N E V Y S E G S T C N V P R * * K W L I I R S I P K V R P A M C Q D D R N G * * Y ----:----|----:----|----:----|----:----|----:----|----:----| L P R N R L N S R C H A L I I S I T S L S L D I G F T R G A I H W S S L F P Q Y S T * E S P E V Q L T G L H Y F H N I I AlfI AlfI Hin6I AciI BsrI MslI |GlaI FnuDII* | TseI | TspRI ||HhaI | AlfI | |BisI | | BbvI TfiI |||HaeII TspEI | AlfI | ||BlsI | | |CviRI* HinfI ||||Cac8I \ \ \ \ \\\ \ \ \\ \ \\\\\ ATAGTAATTTATTGTTCGCGGACTGGTGGCAGCACTGATATGCAAACAGAATCAGCGCCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TATCATTAAATAACAAGCGCCTGACCACCGTCGTGACTATACGTTTGTCTTAGTCGCGGT / /// / /// / / / ////// / TspEI ||AciI BsrI ||TseI MslI | BbvI |||||| Cac8I |AlfI |BisI CviRI* |||||Hin6I |AlfI TspRI ||||GlaI FnuDII* BlsI |||HhaI ||HaeII |AlfI |AlfI HinfI TfiI I V I Y C S R T G G S T D M Q T E S A P * * F I V R G L V A A L I C K Q N Q R Q S N L L F A D W W Q H * Y A N R I S A S ----:----|----:----|----:----|----:----|----:----|----:----| I T I * Q E R V P P L V S I C V S D A G Y L L K N N A S Q H C C Q Y A F L I L A Y Y N I T R P S T A A S I H L C F * R W MfeI Cac8I TspEI MboI | MnlI | TatI BglII | |SduI | Bsp1407I XhoII | |HgiAI* | |Csp6I | DpnI | || BsiI* TspEI | ||RsaI CviRI* | |BstKTI \ \\ \ \ \ \\\ \ \ \\ GCGTGCTCACACGAGGGAAATTGCCCCAATTGTACAACCCTTGCACTACTTTTACAGATC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGCACGAGTGTGCTCCCTTTAACGGGGTTAACATGTTGGGAACGTGATGAAAATGTCTAG / / / / / /// / // / | MnlI BsiI* TspEI | ||| CviRI* || XhoII HgiAI* | ||Bsp1407I || BglII Cac8I | ||TatI || MboI SduI | |Csp6I |DpnI | RsaI BstKTI TspEI MfeI A C S H E G N C P N C T T L A L L L Q I R A H T R E I A P I V Q P L H Y F Y R S V L T R G K L P Q L Y N P C T T F T D L ----:----|----:----|----:----|----:----|----:----|----:----| A H E C S P F Q G L Q V V R A S S K C I L T S V R P F N G W N Y L G Q V V K V S R A * V L S I A G I T C G K C * K * L D MboI | DpnI | |BstKTI TfiI MseI MnlI | || BinI* HinfI \ \ \ \\ \ \ TGTTTAATGTTTGTTCAAAAGGGTTATGTAGGGAGTGGAGGATCGCTTTACAAGACGAAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAATTACAAACAAGTTTTCCCAATACATCCCTCACCTCCTAGCGAAATGTTCTGCTTA / / // / / / MseI MnlI || MboI BinI* HinfI |DpnI TfiI BstKTI C L M F V Q K G Y V G S G G S L Y K T N V * C L F K R V M * G V E D R F T R R I F N V C S K G L C R E W R I A L Q D E S ----:----|----:----|----:----|----:----|----:----|----:----| Q K I N T * F P * T P L P P D S * L V F R N L T Q E F P N H L S H L I A K C S S T * H K N L L T I Y P T S S R K V L R I Hpy188I Csp6I |ApoI |RsaI CviRI* |TspEI SetI MnlI ||Hpy166II \ \\ \ \ \\\ CTTTTTATTTGCACTTATCAGAATTTCAATACAGATATACCTCAAACTTTGATTGGTACA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAAATAAACGTGAATAGTCTTAAAGTTATGTCTATATGGAGTTTGAAACTAACCATGT / / / / / /// CviRI* | TspEI SetI MnlI ||SetI | ApoI |Hpy166II Hpy188I |Csp6I RsaI L F I C T Y Q N F N T D I P Q T L I G T F L F A L I R I S I Q I Y L K L * L V H F Y L H L S E F Q Y R Y T S N F D W Y T ----:----|----:----|----:----|----:----|----:----|----:----| R K I Q V * * F K L V S I G * V K I P V D K * K C K D S N * Y L Y V E F K S Q Y K K N A S I L I E I C I Y R L S Q N T C MaeIII ApoI Tsp45I ApoI TspEI | MaeI SetI TspEI Hpy178III* | HphI | |SetI \ \ \ \ \ \ \\ CCTTTATTAGACAACGAATTTTTCAAGAATAATACTCCCTTGAATTTATGTTCGTCACCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAATAATCTGTTGCTTAAAAAGTTCTTATTATGAGGGAACTTAAATACAAGCAGTGGA / / / / / TspEI Hpy178III* TspEI | Tsp45I ApoI ApoI | MaeIII HphI | DraIII SetI P L L D N E F F K N N T P L N L C S S P L Y * T T N F S R I I L P * I Y V R H L F I R Q R I F Q E * Y S L E F M F V T * ----:----|----:----|----:----|----:----|----:----|----:----| G K N S L S N K L F L V G K F K H E D G V K I L C R I K * S Y Y E R S N I N T V R * * V V F K E L I I S G Q I * T R * R AclI MaeII | SetI Eco57I DraIII | TaiI Eco57MI \ \ \ \ AGTGAAATAGTGTGTTTCAATAACGTTGATAAGAATATGGTTTTGTGCGAGAAGTTAGAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTTTATCACACAAAGTTATTGCAACTATTCTTATACCAAAACACGCTCTTCAATCTC / / / / MaeI | MaeII Eco57MI | AclI Eco57I TaiI SetI S E I V C F N N V D K N M V L C E K L E V K * C V S I T L I R I W F C A R S * S * N S V F Q * R * * E Y G F V R E V R V ----:----|----:----|----:----|----:----|----:----|----:----| L S I T H K L L T S L F I T K H S F N S * H F L T N * Y R Q Y S Y P K T R S T L T F Y H T E I V N I L I H N Q A L L * L AluI AluI CviJI CviJI | SetI AciI | SetI | | MnlI | MaeIII \ \ \ \ \ \ \ TTGAATAAGCTGACTTCAGCTACACGATTGGAGGAAACAGGGTTGATTTGCGGTAACACC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTATTCGACTGAAGTCGATGTGCTAACCTCCTTTGTCCCAACTAAACGCCATTGTGG / / / / / / / | CviJI | | MnlI AciI MaeIII | AluI | CviJI TspRI SetI | AluI SetI L N K L T S A T R L E E T G L I C G N T * I S * L Q L H D W R K Q G * F A V T P E * A D F S Y T I G G N R V D L R * H H ----:----|----:----|----:----|----:----|----:----|----:----| N F L S V E A V R N S S V P N I Q P L V T S Y A S K L * V I P P F L T S K R Y C Q I L Q S * S C S Q L F C P Q N A T V G Tsp4CI* PflMI |Ksp632I* BsiYI* TspEI || TaqI |TspRI TspEI | MseI Hpy188I || AsuII \\ \ \ \ \ \\ \ ACTGATTGGCATAATTATCAAATAATTAAAAAAAACAATATATCTCTGACCCACCGTTTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTAACCGTATTAATAGTTTATTAATTTTTTTTGTTATATAGAGACTGGGTGGCAAAG / / // / / / BsiYI* TspEI |MseI Hpy188I | Ksp632I* PflMI TspEI Tsp4CI* T D W H N Y Q I I K K N N I S L T H R F L I G I I I K * L K K T I Y L * P T V S * L A * L S N N * K K Q Y I S D P P F R ----:----|----:----|----:----|----:----|----:----|----:----| V S Q C L * * I I L F F L I D R V W R K W Q N A Y N D F L * F F C Y I E S G G N S I P M I I L Y N F F V I Y R Q G V T E ApoI TspEI | MseI BsmAI MboII | |AhaIII* |TspEI Hpy188I \ \ \\ \\ \ GAAGAGAATACAAGCATAGTAAATTTAAAGTCTCTAAATTATGATACGGACAATCCGACA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTCTTATGTTCGTATCATTTAAATTTCAGAGATTTAATACTATGCCTGTTAGGCTGT / / /// // / // AsuII MboII ||MseI |TspEI | |SetI TaqI |AhaIII* BsmAI | TspGWI TspEI Hpy188I ApoI E E N T S I V N L K S L N Y D T D N P T K R I Q A * * I * S L * I M I R T I R Q R E Y K H S K F K V S K L * Y G Q S D N ----:----|----:----|----:----|----:----|----:----|----:----| S S F V L M T F K F D R F * S V S L G V R L S Y L C L L N L T E L N H Y P C D S F L I C A Y Y I * L R * I I I R V I R C TspEI | MboI | BclI TspGWI Tsp4CI* | | DpnI | SetI MnlI | MmeI MnlI SetI | | |BstKTI \ \ \ \ \ \ \ \ \ \\ ACCTCCATTTCTCAACTGTATAACATACCGAATACAAAAGAGGTGTGGAAATTGATCATA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGGTAAAGAGTTGACATATTGTATGGCTTATGTTTTCTCCACACCTTTAACTAGTAT / // / / /// / MnlI |MmeI MnlI SetI ||| BclI Tsp4CI* ||| MboI ||DpnI |BstKTI TspEI T S I S Q L Y N I P N T K E V W K L I I P P F L N C I T Y R I Q K R C G N * S * L H F S T V * H T E Y K R G V E I D H K ----:----|----:----|----:----|----:----|----:----|----:----| V E M E * S Y L M G F V F S T H F N I M L R W K E V T Y C V S Y L L P T S I S * G G N R L Q I V Y R I C F L H P F Q D Y XbaI |MaeI Csp6I |Hpy178III* |RsaI Hpy99I || MboI ||MaeII |MseI || BglII ||| BceAI ||HpaI || XhoII ||| |SetI ||HindII || | DpnI ||| |TaiI ||Hpy166II Hpy188I || | |BstKTI \\\ \\ \\\ \ \\ \ \\ AAATGTACGTCAAACTCGCAAATGCCGTCGTTAACGAAAATCCGAACATATCTAGATCTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACATGCAGTTTGAGCGTTTACGGCAGCAATTGCTTTTAGGCTTGTATAGATCTAGAA // / / / // / /// / || | BceAI Hpy99I |MseI Hpy188I ||| XhoII || MaeII Hpy166II ||| BglII |Csp6I HindII ||| MboI RsaI HpaI ||Hin4I TaiI ||Hin4I SetI ||DpnI |BstKTI |XbaI Hpy178III* MaeI K C T S N S Q M P S L T K I R T Y L D L N V R Q T R K C R R * R K S E H I * I F M Y V K L A N A V V N E N P N I S R S F ----:----|----:----|----:----|----:----|----:----|----:----| F H V D F E C I G D N V F I R V Y R S R L I Y T L S A F A T T L S F G F M D L D F T R * V R L H R R * R F D S C I * I K Hin4I EcoNI Hin4I |DdeI | SfaNI Hin4I |SauI* | | HgaI Hin4I CviRI* ||BsiYI* \ \ \ \ \ \\\ TTATTAGACGATGATGCGTCAAAATCACAAGAGCATTTGCATTTGACTTTCCCTGCCTCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATCTGCTACTACGCAGTTTTAGTGTTCTCGTAAACGTAAACTGAAAGGGACGGAGT / / / / / / // | HgaI Hin4I CviRI* | | |SauI* SfaNI Hin4I | | |DdeI | | SetI | EcoNI BsiYI* L L D D D A S K S Q E H L H L T F P A S Y * T M M R Q N H K S I C I * L S L P Q I R R * C V K I T R A F A F D F P C L R ----:----|----:----|----:----|----:----|----:----|----:----| K N S S S A D F D C S C K C K V K G A E K I L R H H T L I V L A N A N S K G Q R * * V I I R * F * L L M Q M Q S E R G * SetI | MnlI | | BspCNI | | |BseMII ApoI | | ||SetI MseI TspEI \ \ \\\ \ \ GGTAGTATAGGTTTGGGGAACTTAAACATTCAGTCTGTGGAAATTCTTTTGAATGTTTGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CCATCATATCCAAACCCCTTGAATTTGTAAGTCAGACACCTTTAAGAAAACTTACAAACA / // / / | |BseMII MseI TspEI | BspCNI ApoI | SetI MnlI G S I G L G N L N I Q S V E I L L N V C V V * V W G T * T F S L W K F F * M F V * Y R F G E L K H S V C G N S F E C L L ----:----|----:----|----:----|----:----|----:----|----:----| P L I P K P F K F M * D T S I R K F T Q L Y Y L N P S S L C E T Q P F E K S H K T T Y T Q P V * V N L R H F N K Q I N T PsrI MaeII | SetI BciVI | TaiI MseI |Hpy178III* | |FatI | PsrI || TspEI | ||CviAII | SspI || | TspDTI | ||| NlaIII \ \ \\ \ \ \ \\\ \ TATTTAATATTTCAAGTATCCCAAGTTCAAGAATTATTGACGTTCATGTATTGCGAAGAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAATTATAAAGTTCATAGGGTTCAAGTTCTTAATAACTGCAAGTACATAACGCTTCTG / / / / // / / / / // | | SspI | || | | | | |FatI | MseI | || | | | | CviAII PsrI | || | | | NlaIII | || | | MaeII | || | TaiI | || | SetI | || TspEI | || PsrI | |TspDTI | Hpy178III* BciVI Y L I F Q V S Q V Q E L L T F M Y C E D I * Y F K Y P K F K N Y * R S C I A K T F N I S S I P S S R I I D V H V L R R R ----:----|----:----|----:----|----:----|----:----|----:----| * K I N * T D W T * S N N V N M Y Q S S N N L I E L I G L E L I I S T * T N R L I * Y K L Y G L N L F * Q R E H I A F V TspGWI | MseI MaeII | | SspI |TspGWI AluI | | | FalI BbvII* || SetI CviJI | | | FalI | MboII || TaiI MseI | SetI | | | | MaeIII \ \ \\ \ \ \ \ \ \ \ \ \ GGATATACAGAAACGTCATTATTATTAACAGCTTATATTATATTCCACTTTAATATTCCG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CCTATATGTCTTTGCAGTAATAATAATTGTCGAATATAATATAAGGTGAAATTATAAGGC / / / / / / / // / | | MaeII | | CviJI | || SspI | TspGWI | | AluI | |MseI | TaiI | SetI | FalI | SetI MseI | FalI BbvII* TspGWI MboII G Y T E T S L L L T A Y I I F H F N I P D I Q K R H Y Y * Q L I L Y S T L I F R I Y R N V I I I N S L Y Y I P L * Y S V ----:----|----:----|----:----|----:----|----:----|----:----| P Y V S V D N N N V A * I I N W K L I G R I Y L F T M I I L L K Y * I G S * Y E S I C F R * * * * C S I N Y E V K I N R Hin4I | FokI | MnlI | | BinI* | | |HgaI | | || MboI | | || BamHI | | || XhoII | | || | DpnI | | || | NlaIV | | || | |BstKTI | | || | ||BseGI | | || | ||| FalI | | || | ||| FalI Hpy188I | | || | ||| BinI* | BccI | | || | ||| | BccI Hin4I | | CviRI* \ \ \\ \ \\\ \ \ \ \ \ \ TTACAAGACGCTCTTTTGAGGATCCATCCAAGACCATTTTTCCTTTTTCCATCAGACTTG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTCTGCGAGAAAACTCCTAGGTAGGTTCTGGTAAAAAGGAAAAAGGTAGTCTGAAC / / // //// / / / / / / | MnlI || |||| | | Hin4I | | CviRI* MaeIII || |||| | BccI | BccI Hin4I || |||| BinI* Hpy188I || |||XhoII || |||BamHI || |||MboI || ||FalI || ||FalI || |NlaIV || |BseGI || |DpnI || BstKTI || HgaI |BinI* FokI L Q D A L L R I H P R P F F L F P S D L Y K T L F * G S I Q D H F S F F H Q T C T R R S F E D P S K T I F P F S I R L A ----:----|----:----|----:----|----:----|----:----|----:----| N C S A R K L I W G L G N K R K G D S K T V L R E K S S G D L V M K G K E M L S * L V S K Q P D M W S W K E K K W * V Q ApoI CviJI FauI TspEI HaeIII |SetI AciI AciI BsiYI* \ \ \\ \ \ \ CAAATTTTAGGCCATTTACAACCTGTCCTGCGGGAGTTTAGTCCGCAGAATGGAAGTAAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAAAATCCGGTAAATGTTGGACAGGACGCCCTCAAATCAGGCGTCTTACCTTCATTA / / / / / // | HaeIII SetI FauI AciI |BsiYI* | CviJI AciI TspEI ApoI Q I L G H L Q P V L R E F S P Q N G S N K F * A I Y N L S C G S L V R R M E V I N F R P F T T C P A G V * S A E W K * S ----:----|----:----|----:----|----:----|----:----|----:----| C I K P W K C G T R R S N L G C F P L L A F K L G N V V Q G A P T * D A S H F Y L N * A M * L R D Q P L K T R L I S T I HindIII | AluI | CviJI | | SetI CviRI* | | |Eco57I | EcoT22I | | |Eco57MI | | ApoI | | || TspEI TspEI | | TspEI | | || | MboII \ \ \ \ \ \ \\ \ \ CTAAAATTATATGCCAATGCATTGAAATTTAGGGATAAAAGCTTTCAATTACACATTTCT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTTAATATACGGTTACGTAACTTTAAATCCCTATTTTCGAAAGTTAATGTGTAAAGA / / / / / /// // TspEI | CviRI* TspEI | ||| |TspEI EcoT22I ApoI | ||| MboII | ||HindIII | |Eco57MI | |Eco57I | CviJI | AluI SetI L K L Y A N A L K F R D K S F Q L H I S * N Y M P M H * N L G I K A F N Y T F L K I I C Q C I E I * G * K L S I T H F F ----:----|----:----|----:----|----:----|----:----|----:----| R F N Y A L A N F N L S L L K * N C M E D L I I H W H M S I * P Y F S E I V C K * F * I G I C Q F K P I F A K L * V N R SmlI Hpy178III* | MboII | |HinfI | |TspDTI | || MnlI | || |TspEI | || || PleI Hpy188I | || || |MlyI | AluI | || || || MseI | CviJI TfiI | || || || |TspEI | | SetI HinfI | || || || |Hin4II* \ \ \ \ \ \\ \\ \\ \\ TCAGAGCTTTTTAGTAGCATATTTTTTATGAAGATTCCTCTTGAGTCTAATTTCGTTAAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCTCGAAAAATCATCGTATAAAAAATACTTCTAAGGAGAACTCAGATTAAAGCAATTA / / / / // / / / / // | | CviJI | || | HinfI | | |Bce83I* | | AluI | || | MnlI | | MseI | SetI | || SmlI | Hin4II* Hpy188I | || TspEI | || PleI | || MlyI | |Hpy178III* | TspDTI | MboII HinfI TfiI S E L F S S I F F M K I P L E S N F V N Q S F L V A Y F L * R F L L S L I S L I R A F * * H I F Y E D S S * V * F R * F ----:----|----:----|----:----|----:----|----:----|----:----| E S S K L L M N K I F I G R S D L K T L K L A K * Y C I K * S S E E Q T * N R * * L K K T A Y K K H L N R K L R I E N I Bce83I* | FokI | | AsuI* | | DraII | | Bsp120I | | |AsuI* | | |BmgT120I | | ||CviJI | | ||NlaIV BinI* | | ||HaeIII | MboI | | ||BmgT120I | BamHI | | ||| BtsI | XhoII | | ||| ApaI | |Hin4I | | ||| SduI | |Hin4I | | ||| BseSI | ||DpnI | | ||| HgiJII* | ||NlaIV | | ||| | Hin4I | |||BstKTI | | ||| | Hin4I | ||||BssKI | | ||| | |BseGI | ||||SecI* | | ||| | ||TspRI | ||||EcoRII | | ||| | ||| PfoI | ||||| ScrFI | | ||| | ||| BssKI | ||||| BseBI | | ||| | ||| | HpaII | ||||| | MboI | | ||| | ||| | ScrFI MaeII | ||||| | BinI* | | ||| | ||| | CauII* |MaeIII | ||||| | | DpnI | | ||| | ||| | | TfiI |Tsp45I | ||||| | | |FatI | | ||| | ||| | | BccI || SetI | ||||| | | |BstKTI | | ||| | ||| | | HinfI || TaiI | ||||| | | ||CviAII \ \ \\\ \ \\\ \ \ \ \\ \ \ \\\\\ \ \ \\\ TTGAAGGGCCCACTGCCATCCCGGATTCTACGTCACTTGTATTTGGGATCCCTGGATCAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCCCGGGTGACGGTAGGGCCTAAGATGCAGTGAACATAAACCCTAGGGACCTAGTA / ///// / //// / / / / / // / ////// / | ||||| BseGI |||| | | | | | || | |||||| CviAII | ||||Bsp120I |||| | | | | | || | |||||MboI | ||||AsuI* |||| | | | | | || | ||||NlaIII | ||||Hin4I |||| | | | | | || | |||DpnI | ||||Hin4I |||| | | | | | || | ||EcoRII | |||BmgT120I |||| | | | | | || | ||BstKTI | |||DraII |||| | | | | | || | ||BinI* | |||AsuI* |||| | | | | | || | ||BssKI | ||BmgT120I |||| | | | | | || | |SecI* | ||HaeIII |||| | | | | | || | BseBI | ||NlaIV |||| | | | | | || | ScrFI | ||CviJI |||| | | | | | || XhoII | ||TspRI |||| | | | | | || BamHI | ||BtsI |||| | | | | | || MboI | |FokI |||| | | | | | |NlaIV | HgiJII* |||| | | | | | |DpnI | BseSI |||| | | | | | BstKTI | SduI |||| | | | | Hin4I | ApaI |||| | | | | Hin4I TspEI |||| | | | | BinI* |||| | | | Tsp45I |||| | | | MaeIII |||| | | MaeII |||| | TaiI |||| | SetI |||| HinfI |||| TfiI |||BccI ||BssKI ||PfoI |HpaII CauII* ScrFI L K G P L P S R I L R H L Y L G S L D H * R A H C H P G F Y V T C I W D P W I M E G P T A I P D S T S L V F G I P G S C ----:----|----:----|----:----|----:----|----:----|----:----| K F P G S G D R I R R * K Y K P D R S * N S P G V A M G S E V D S T N P I G P D Q L A W Q W G P N * T V Q I Q S G Q I M CviRI* SmlI MaeI NlaIII AflII |BsmAI |BinI* |MseI || TspEI TspDTI \\ \\ \\ \ \ GCACAAAATCCTGCCTTACTTAAGTCTCTAGGAATTACGCATATAGTTTCTGTCGGTGAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGTTTTAGGACGGAATGAATTCAGAGATCCTTAATGCGTATATCAAAGACAGCCACTT / / // / / / / | BinI* |AflII | | TspEI TspDTI CviRI* |SmlI | BsmAI FatI MseI MaeI A Q N P A L L K S L G I T H I V S V G E H K I L P Y L S L * E L R I * F L S V K T K S C L T * V S R N Y A Y S F C R * S ----:----|----:----|----:----|----:----|----:----|----:----| A C F G A K S L D R P I V C I T E T P S H V F D Q R V * T E L F * A Y L K Q R H C L I R G * K L R * S N R M Y N R D T F FatI HphI |CviAII CviJI DraIII || NlaIII FokI TspEI BseGI HaeIII | CviRI* \\ \ \ \ \ \ \ \ GTTGTTTCATGGACATTGAATAAGGATAAAATTGCTCATCCTGTAAGGCCACATCGTGCA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAAAGTACCTGTAACTTATTCCTATTTTAACGAGTAGGACATTCCGGTGTAGCACGT // // / // / / / || |FatI FokI |BseGI | | CviRI* || CviAII TspEI | DraIII |NlaIII HaeIII HphI CviJI V V S W T L N K D K I A H P V R P H R A L F H G H * I R I K L L I L * G H I V Q C F M D I E * G * N C S S C K A T S C N ----:----|----:----|----:----|----:----|----:----|----:----| T T E H V N F L S L I A * G T L G C R A L Q K M S M S Y P Y F Q E D Q L A V D H N N * P C Q I L I F N S M R Y P W M T C CviRI* | SetI | | TspDTI | | | FatI | | | AflIII | | | BspLU11I* | | | |CviAII | | | || NspI BspMI | | | || NlaIII BaeI \ \ \ \ \\ \ \ ATAACTATGACGAATACCAATGAAGTTGCAGGTAATACTACATGTAATAAAAGCAGAAAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TATTGATACTGCTTATGGTTACTTCAACGTCCATTATGATGTACATTATTTTCGTCTTTA / // / / // / | || TspDTI | |BspLU11I* BaeI | |SetI | |AflIII | CviRI* | |FatI BspMI | CviAII NlaIII NspI I T M T N T N E V A G N T T C N K S R N * L * R I P M K L Q V I L H V I K A E I N Y D E Y Q * S C R * Y Y M * * K Q K * ----:----|----:----|----:----|----:----|----:----|----:----| I V I V F V L S T A P L V V H L L L L F L L * S S Y W H L Q L Y Y * M Y Y F C F Y S H R I G I F N C T I S C T I F A S I TseI |BisI ||BlsI ||| MaeII AluI ||| | SetI CviJI ||| | TaiI ApoI | SetI Tsp4CI* BaeI ||| | | BbvI TspEI \ \ \ \ \\\ \ \ \ \ AGAGCTGATACTGTGGTCAGCGATAAGCAAGAAAATGGCAGCAACGTAGTAATAAGTGAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGACTATGACACCAGTCGCTATTCGTTCTTTTACCGTCGTTGCATCATTATTCACTT / / / / /// / / / | CviJI Tsp4CI* BaeI ||| | MaeII BbvI | AluI ||| TaiI SetI ||| SetI ||TseI |BisI BlsI R A D T V V S D K Q E N G S N V V I S E E L I L W S A I S K K M A A T * * * V K S * Y C G Q R * A R K W Q Q R S N K * K ----:----|----:----|----:----|----:----|----:----|----:----| L A S V T T L S L C S F P L L T T I L S Y L Q Y Q P * R Y A L F H C C R L L L H S S I S H D A I L L F I A A V Y Y Y T F BinI* |Hin4I |Hin4I Hpy178III* XbaI || MboI | ApoI MboI |MaeI || XhoII | TspEI | DpnI |Hpy178III* || | DpnI | |Hin4I | |TaqI || FalI || | |BstKTI | |Hin4I | |BstKTI || FalI || | ||AciI BceAI \ \\ \ \\ \\ \ \\ \ \\\ \ AATTCTGGATTTCAAATTTGCCAGATCGAAAATCTAGATGACAACGGCAAAGATCCGCTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGACCTAAAGTTTAAACGGTCTAGCTTTTAGATCTACTGTTGCCGTTTCTAGGCGAA / / / / // // // / / // / / | | Hin4I TspEI || |TaqI |XbaI | | || | AciI | | Hin4I ApoI || MboI | | | || XhoII | Hpy178III* |DpnI | | | || MboI TspEI BstKTI | | | |DpnI ApoI | | | BstKTI | | BinI* | Hin4I | Hin4I Hpy178III* MaeI FalI FalI N S G F Q I C Q I E N L D D N G K D P L I L D F K F A R S K I * M T T A K I R F F W I S N L P D R K S R * Q R Q R S A F ----:----|----:----|----:----|----:----|----:----|----:----| F E P N * I Q W I S F R S S L P L S G S F N Q I E F K G S R F D L H C R C L D A I R S K L N A L D F I * I V V A F I R K Hpy188I | AloI | PpiI FalI | BsaXI FalI TspEI | | MnlI MmeI \ \ \ \ \ \ TTCCACCAAATAGACAAAGTTTTGGATTTTATTAGCAATTCCGAAGCAACAGGAGGGAAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTGGTTTATCTGTTTCAAAACCTAAAATAATCGTTAAGGCTTCGTTGTCCTCCCTTT / / /// / / BceAI FalI ||| MnlI MmeI FalI ||Hpy188I ||BsaXI |TspEI PpiI AloI F H Q I D K V L D F I S N S E A T G G K S T K * T K F W I L L A I P K Q Q E G K P P N R Q S F G F Y * Q F R S N R R E S ----:----|----:----|----:----|----:----|----:----|----:----| K W W I S L T K S K I L L E S A V P P F K G G F L C L K P N * * C N R L L L L S E V L Y V F N Q I K N A I G F C C S P F Hpy188I | Hpy178III* | |BsmAI | ||MboI | ||PleI | ||BglII CviRI* | ||XhoII | GsuI | |||MlyI AluI | Eco57MI | ||||DpnI CviJI | | BsaXI | |||||BstKTI | SetI | | | AloI | |||||| CviRI* | |GsuI | | | PpiI |HinfI |||||| | Tsp4CI* | |Eco57MI \ \ \ \ \\ \\\\\\ \ \ \ \\ GTTCTGGTGCATTGTATGGTCGGAGTCTCCAGATCTGCAACAGTTTGTATAGCTGAATGT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGACCACGTAACATACCAGCCTCAGAGGTCTAGACGTTGTCAAACATATCGACTTACA /// / / ///// / / / // ||BsaXI | | ||||| | Tsp4CI* | |Eco57MI ||PpiI | | ||||| CviRI* | |GsuI ||AloI | | ||||XhoII | CviJI |Eco57MI | | ||||BglII | AluI |GsuI | | ||||MboI SetI CviRI* | | |||BsmAI | | ||DpnI | | |BstKTI | | |PleI | | |MlyI | | Hpy178III* | HinfI Hpy188I V L V H C M V G V S R S A T V C I A E C F W C I V W S E S P D L Q Q F V * L N V S G A L Y G R S L Q I C N S L Y S * M Y ----:----|----:----|----:----|----:----|----:----|----:----| T R T C Q I T P T E L D A V T Q I A S H L E P A N Y P R L R W I Q L L K Y L Q I N Q H M T H D S D G S R C C N T Y S F T EcoRV | BsrI | | MaeIII | | Tsp45I | | | TspRI | | | |BssKI | | | |EcoRII | | | || ScrFI MnlI | | | || BseBI | Csp6I CviJI | | | || |SetI MnlI | |RsaI | MseI \ \ \ \\ \\ \ \ \\ \ \ ATGAGATATCTCCAGTGTGACCTGGCAAGTGCGTATTTGTTTGTGAGGGTACGGAGGCTT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCTATAGAGGTCACACTGGACCGTTCACGCATAAACAAACACTCCCATGCCTCCGAA / / / / / / / / // / | TspRI | | | EcoRII MnlI | |Csp6I CviJI | BsrI | | | BssKI | RsaI EcoRV | | BseBI MnlI | | ScrFI | Tsp45I | MaeIII SetI M R Y L Q C D L A S A Y L F V R V R R L * D I S S V T W Q V R I C L * G Y G G L E I S P V * P G K C V F V C E G T E A * ----:----|----:----|----:----|----:----|----:----|----:----| I L Y R W H S R A L A Y K N T L T R L S Y S I D G T H G P L H T N T Q S P V S A H S I E L T V Q C T R I Q K H P Y P P K AluI CviJI Ecl136II | SetI | SduI | SacI | HgiAI* | HgiJII* | | SapI | | Ksp632I* TspGWI MboII MboII | | | BcgI \ \ \ \ \ \ \ AATGTTATCATTCAACCAAACTTGTTCTTCGTATATGAGCTCTTCAAATGGTGGAAAAAG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAATAGTAAGTTGGTTTGAACAAGAAGCATATACTCGAGAAGTTTACCACCTTTTTC / / / / / / / / | TspGWI MboII | | | | Ksp632I* MseI | | | | SapI | | | BcgI | | Ecl136II | | CviJI | | AluI | HgiJII* | HgiAI* | SacI | SduI | SetI MboII N V I I Q P N L F F V Y E L F K W W K K M L S F N Q T C S S Y M S S S N G G K S C Y H S T K L V L R I * A L Q M V E K A ----:----|----:----|----:----|----:----|----:----|----:----| L T I M * G F K N K T Y S S K L H H F F * H * * E V L S T R R I H A R * I T S F I N D N L W V Q E E Y I L E E F P P F L SfeI* Hpy178III* | BseMII DdeI |NruI | |BspCNI BbvCI PsiI |FnuDII* BcgI | || MnlI Bpu10I \ \\ \ \ \\ \ \ CATTATAATCGCGAAAAAGACAAAACTATGGATTGGCACATCATCTGTAGGGGTATCGCT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GTAATATTAGCGCTTTTTCTGTTTTGATACCTAACCGTGTAGTAGACATCCCCATAGCGA / // / // / PsiI || BcgI || MnlI |Hpy178III* |BspCNI FnuDII* |SfeI* NruI BseMII H Y N R E K D K T M D W H I I C R G I A I I I A K K T K L W I G T S S V G V S L L * S R K R Q N Y G L A H H L * G Y R * ----:----|----:----|----:----|----:----|----:----|----:----| C * L R S F S L V I S Q C M M Q L P I A A N Y D R F L C F * P N A C * R Y P Y R M I I A F F V F S H I P V D D T P T D S TatI |Csp6I ||RsaI |||Hpy166II |||| FatI MseI |||| |CviAII SetI |||| || NlaIII \ \\\\ \\ \ GAGGTTAATATGAAGTACACATGA 2410 2420 ----:----|----:----|---- CTCCAATTATACTTCATGTGTACT // / //// // || MseI |||| |FatI |Bpu10I |||| CviAII |BbvCI |||NlaIII |DdeI ||TatI SetI |Hpy166II |Csp6I RsaI E V N M K Y T * R L I * S T H X G * Y E V H M X ----:----|----:----|---- S T L I F Y V H Q P * Y S T C M L N I H L V C S # Enzymes that cut Frequency Isoschizomers AatII 1 AciI 5 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AhaIII* 1 DraI AlfI 4 AloI 1 AluI 8 AluBI ApaI 1 ApoI 9 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BaeI 1 BamHI 2 BbvCI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BceAI 2 BcgI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BglII 3 BinI* 8 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 2 Bpu10I 1 BsaXI 1 BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 2 BseSI 2 BaeGI,BstSLI BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI Bsp120I 1 PspOMI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 2 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstKTI 12 BtsI 1 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 5 CviQI,RsaNI CviAII 7 CviJI 14 CviKI-1 CviRI* 16 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 12 MalI DraII 1 EcoO109I DraIII 3 AdeI Ecl136II 1 EcoICRI Eco57I 2 AcuI Eco57MI 4 EcoNI 1 BstENI,XagI EcoRII 5 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 4 FatI 7 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 2 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 3 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 7 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 12 Hpy188III Hpy188I 12 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 6 MboI 12 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 2 MunI MlyI 2 SchI MmeI 2 MnlI 18 MseI 13 Tru1I,Tru9I MslI 2 RseI,SmiMI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspI 1 BstNSI,XceI PasI 1 PflMI 1 BasI,AccB7I,Van91I PfoI 2 PleI 2 PpsI PpiI 1 PsiI 1 AanI PsrI 1 RsaI 5 AfaI SacI 1 Psp124BI,SstI SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 33 SexAI 1 MabI SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 2 TaiI 7 TaqI 4 TatI 2 TfiI 5 PfeI TseI 3 ApeKI Tsp45I 4 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 28 TasI,Tsp509I,Sse9I TspGWI 5 TspRI 4 TscAI XbaI 3 XhoII 7 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AccI AgeI AjuI AlwNI ApaLI AscI Asp718I AvaI AvaII AvrII BalI BarI BdaI BetI* BfiI BglI BmeT110I BmtI BplI BsaAI BsaBI BsePI BseRI BseYI BsgI BslFI BsmFI BsmI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI Cfr10I Cfr9I CfrI ClaI CspCI DinI DrdI DsaI* Eam1105I EciI Eco31I Eco47III EcoP15I EcoRI EgeI EheI Esp3I EspI* FaqI FseI FspAI GsaI HgiCI* KasI KpnI MauBI McrI* MluI MroNI MstI* MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NspBII* OliI PacI PmaCI PmeI PpuMI PshAI PspXI PstI PvuI PvuII RsrII SacII SalI SanDI ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TauI TsoI TspMI TstI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769