Restriction Map of ALG7/YBR243C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ALG7/YBR243C on chromosome II from coordinates 706793 to 705447.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.24543

EMBOSS_001 FatI |CviAII || NspI AsuI* BsrI || NlaIII DraII TspRI || | MseI Bsp120I \ \\ \ \ \ ATGTTGCGACTTTTTTCACTGGCACTTATCACATGCTTAATCTACTATTCCAAAAATCAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACGCTGAAAAAAGTGACCGTGAATAGTGTACGAATTAGATGATAAGGTTTTTAGTC / / / // / / TspRI BsrI | || MseI HgiJII* | |FatI BseSI | CviAII SduI NlaIII ApaI NspI M L R L F S L A L I T C L I Y Y S K N Q C C D F F H W H L S H A * S T I P K I R V A T F F T G T Y H M L N L L F Q K S G ----:----|----:----|----:----|----:----|----:----|----:----| X N R S K E S A S I V H K I * * E L F * X T A V K K V P V * * M S L R S N W F D H Q S K K * Q C K D C A * D V I G F I L AsuI* BmgT120I |CviJI |NlaIV |HaeIII |BmgT120I || ApaI || SduI || BseSI || HgiJII* || | BceAI || | | BccI || | | | MwoI || | | | | AciI || | | | | |CfrI || | | | | |BisI || | | | | |XmaIII* || | | | | ||BlsI || | | | | |||TauI || | | | | |||CviJI || | | | | |||HaeIII AluI || | | | | ||||SecI* CviJI || | | | | ||||DsaI* Cac8I |SfeI* || | | | | ||||McrI* | CviJI ||SetI \\ \ \ \ \ \\\\\ \ \ \\\ GGCCCATCTGCTCTTGTTGCGGCCGTGGGATTTGGTATAGCAGGCTATTTAGCTACAGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGGTAGACGAGAACAACGCCGGCACCCTAAACCATATCGTCCGATAAATCGATGTCTA /// / / //// / / / / / / / ||| | BccI |||| | DsaI* | CviJI | | SfeI* ||| | MwoI |||| | SecI* Cac8I | CviJI ||| BceAI |||| XmaIII* | AluI ||Bsp120I |||| CfrI SetI ||AsuI* |||HaeIII |BmgT120I |||CviJI |DraII ||McrI* |AsuI* ||BisI BmgT120I ||AciI HaeIII |BlsI NlaIV TauI CviJI G P S A L V A A V G F G I A G Y L A T D A H L L L L R P W D L V * Q A I * L Q I P I C S C C G R G I W Y S R L F S Y R Y ----:----|----:----|----:----|----:----|----:----|----:----| P G D A R T A A T P N P I A P * K A V S P G M Q E Q Q P R P I Q Y L L S N L * L A W R S K N R G H S K T Y C A I * S C I MaeII AflIII |PmaCI |BsaAI || SetI Hin4II* || TaiI | StuI TfiI || |BsiYI* | CviJI BceAI HinfI || || TspDTI | HaeIII |SmlI \ \\ \\ \ \ \ \\ ATGTTGATTCCACGTGTGGGCAAATCCTTCATCAAAATAGGCCTATTCGGTAAGGACTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACTAAGGTGCACACCCGTTTAGGAAGTAGTTTTATCCGGATAAGCCATTCCTGAAC / / // / / / / | | || AflIII | HaeIII BceAI | | || TspDTI | CviJI | | |MaeII | StuI | | BsiYI* Hin4II* | | BsaAI | | PmaCI | TaiI | SetI HinfI TfiI M L I P R V G K S F I K I G L F G K D L C * F H V W A N P S S K * A Y S V R T * V D S T C G Q I L H Q N R P I R * G L E ----:----|----:----|----:----|----:----|----:----|----:----| I N I G R T P L D K M L I P R N P L S K Y T S E V H P C I R * * F L G I R Y P S H Q N W T H A F G E D F Y A * E T L V Q Hpy166II | BssKI | EcoRII | | ScrFI | | BseBI | | |CfrI | | |SetI | | || CviJI MwoI | | || HaeIII | TseI | | || | BetI* | |BisI | | || | |HpaII | |SfeI* | | || | || Bce83I* | ||BlsI | | || | || |EcoP15I BbvI | |||CviRI* | | || | || || Hpy178III* | SetI | |||| PstI \ \ \\ \ \\ \\ \ \ \ \ \\\\ \ AGTAAACCTGGCCGTCCGGTGCTTCCAGAAACAATAGGTGCTATCCCTGCTGCAGTTTAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTTGGACCGGCAGGCCACGAAGGTCTTTGTTATCCACGATAGGGACGACGTCAAATA / // / / / / // / / / / / /// / | || | | | | || | | SetI | MwoI ||| SfeI* | || | | | | || | Hpy178III* BbvI ||CviRI* | || | | | | || EcoP15I ||TseI | || | | | | |BetI* |BisI | || | | | | HpaII BlsI | || | | | Bce83I* PstI | || | | CfrI | || | EcoRII | || | HaeIII | || | BssKI | || | CviJI | || BseBI | || ScrFI | |SetI | Hpy166II SmlI S K P G R P V L P E T I G A I P A A V Y V N L A V R C F Q K Q * V L S L L Q F I * T W P S G A S R N N R C Y P C C S L F ----:----|----:----|----:----|----:----|----:----|----:----| L L G P R G T S G S V I P A I G A A T * S Y V Q G D P A E L F L L H * G Q Q L K T F R A T R H K W F C Y T S D R S C N I Eco57I TspDTI TspDTI Hin4II* Eco57MI BtgZI \ \ \ \ \ TTATTTGTAATGTTCATTTACATTCCCTTCATTTTCTACAAGTATATGGTCATAACCACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AATAAACATTACAAGTAAATGTAAGGGAAGTAAAAGATGTTCATATACCAGTATTGGTGA / / / / TspDTI TspDTI | Eco57MI | Eco57I Hin4II* L F V M F I Y I P F I F Y K Y M V I T T Y L * C S F T F P S F S T S I W S * P L I C N V H L H S L H F L Q V Y G H N H F ----:----|----:----|----:----|----:----|----:----|----:----| K N T I N M * M G K M K * L Y I T M V V N I Q L T * K C E R * K R C T Y P * L W * K Y H E N V N G E N E V L I H D Y G S SetI | TsoI | AsuI* | |NlaIV | |BmgT120I | ||CviJI | ||HaeIII | ||| Hpy178III* | ||| |NruI | ||| |MslI | ||| |FnuDII* | ||| || BccI | ||| || | DdeI | ||| || | | BsmAI | ||| || | | | TspRI | ||| || | | | BtgZI | ||| || | | | | BspCNI | ||| || | | | | |BseMII | ||| || | | | | || Tsp4CI* | ||| || | | | | || | MboII | ||| || | | | | || | | ApoI | ||| || | | | | || | | TspEI | ||| || | | | | || | | EcoRI SspI \ \\\ \\ \ \ \ \ \\ \ \ \ \ TCAGGTGGGGGCCATCGCGATGTCTCAGTGGTTGAAGATAACGGTATGAATTCTAATATT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCCACCCCCGGTAGCGCTACAGAGTCACCAACTTCTATTGCCATACTTAAGATTATAA / / /// // / / / / // / / / // / | | ||| || | | | | || | MboII | || TspDTI | | ||| || | | | | || Tsp4CI* | |SspI | | ||| || | | | | |BseMII | Hin4I | | ||| || | | | | |BtgZI | Hin4I | | ||| || | | | | BspCNI EcoRI | | ||| || | | | BsmAI TspEI | | ||| || | | DdeI ApoI | | ||| || | TspRI | | ||| || BccI | | ||| |Hpy178III* | | ||| FnuDII* | | ||| MslI | | ||| NruI | | ||AsuI* | | |BmgT120I | | |HaeIII | | |CviJI | | NlaIV | TsoI BtgZI SetI S G G G H R D V S V V E D N G M N S N I Q V G A I A M S Q W L K I T V * I L I F R W G P S R C L S G * R * R Y E F * Y F ----:----|----:----|----:----|----:----|----:----|----:----| E P P P W R S T E T T S S L P I F E L I K L H P G D R H R L P Q L Y R Y S N * Y * T P A M A I D * H N F I V T H I R I N Hin4I Hin4I TspDTI Hin6I | FatI |GlaI Csp6I | BspHI |Hin4I |RsaI | |CviAII |Hin4I || AsuI* | |Hpy178III* |Eco47III || AvaII | || NlaIII Hpy188I ||HhaI || Tsp4CI* | || | MnlI | SspI |||HaeII BsiYI* || |BmgT120I \ \\ \ \ \ \ \\\\ \ \\ \\ TTTCCTCATGATAAACTATCTGAATATTTGAGCGCTATCCTATGCTTGGAAAGTACGGTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGAGTACTATTTGATAGACTTATAAACTCGCGATAGGATACGAACCTTTCATGCCAG / // / / / / //// / /// // | || MnlI | | | |||Hin6I BsiYI* ||| |AvaII | |BspHI | | | ||Eco47III ||| |AsuI* | |FatI | | | ||GlaI ||| BmgT120I | Hpy178III* | | | |HhaI ||Tsp4CI* | CviAII | | | HaeII |Csp6I NlaIII | | Hin4I RsaI | | Hin4I | SspI Hpy188I F P H D K L S E Y L S A I L C L E S T V F L M I N Y L N I * A L S Y A W K V R S S S * * T I * I F E R Y P M L G K Y G P ----:----|----:----|----:----|----:----|----:----|----:----| K G * S L S D S Y K L A I R H K S L V T K E E H Y V I Q I N S R * G I S P F Y P K R M I F * R F I Q A S D * A Q F T R D BsmAI MaeII | SetI | TaiI | |FalI FokI MnlI MmeI | |FalI |Cac8I \ \ \ \\ \\ CTCTTGGGTATCGCTGATGATTTATTTGATTTACGTTGGAGACATAAGTTTTTCTTGCCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAACCCATAGCGACTACTAAATAAACTAAATGCAACCTCTGTATTCAAAAAGAACGGA / / / / / // MnlI MmeI | | BsmAI |BsrDI | MaeII Cac8I TaiI SetI FalI FalI L L G I A D D L F D L R W R H K F F L P S W V S L M I Y L I Y V G D I S F S C L L G Y R * * F I * F T L E T * V F L A C ----:----|----:----|----:----|----:----|----:----|----:----| R K P I A S S K N S K R Q L C L N K K G G R P Y R Q H N I Q N V N S V Y T K R A E Q T D S I I * K I * T P S M L K E Q R BsrDI | TseI | MwoI | CviRI* | |BisI | ||BlsI | ||FalI MaeIII | ||FalI | FatI | |||CviJI | |CviAII | ||||BseGI | || TatI | ||||| BtsI | || |NspI | ||||| | BccI | || |Csp6I | ||||| | BbvI | || |NlaIII | ||||| | | TspRI | || ||RsaI \ \\\\\ \ \ \ \ \\ \\\ GCCATTGCAGCCATCCCACTGCTAATGGTTTATTATGTGGATTTTGGAGTTACGCATGTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTAACGTCGGTAGGGTGACGATTACCAAATAATACACCTAAAACCTCAATGCGTACAT / / //// / / / // //// | | |||| TspRI | BbvI || |||Csp6I | | |||| BtsI BccI || ||RsaI | | |||CviJI || |FatI | | |||TseI || CviAII | | ||BseGI |NlaIII | | ||BisI |NspI | | |BlsI MaeIII | | CviRI* | FalI | FalI | MwoI FokI A I A A I P L L M V Y Y V D F G V T H V P L Q P S H C * W F I M W I L E L R M Y H C S H P T A N G L L C G F W S Y A C T ----:----|----:----|----:----|----:----|----:----|----:----| A M A A M G S S I T * * T S K P T V C T Q W Q L W G V A L P K N H P N Q L * A H G N C G D W Q * H N I I H I K S N R M Y TspDTI | PfoI | BssKI | | HpaII | | ScrFI | | CauII* | | | TfiI | | | HinfI | | | | FatI | | | | |CviAII SpeI | | | | || NlaIII |MaeI CviJI \ \ \ \ \\ \ \\ \ CTTATTCCCGGATTCATGGAACGCTGGTTGAAAAAGACTAGTGTTGATTTGGGGCTGTGG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GAATAAGGGCCTAAGTACCTTGCGACCAACTTTTTCTGATCACAACTAAACCCCGACACC / /// / // // / TspDTI ||| | |FatI |SpeI CviJI TatI ||| | CviAII MaeI ||| NlaIII ||| HinfI ||| TfiI ||BssKI ||PfoI |HpaII CauII* ScrFI L I P G F M E R W L K K T S V D L G L W L F P D S W N A G * K R L V L I W G C G Y S R I H G T L V E K D * C * F G A V V ----:----|----:----|----:----|----:----|----:----|----:----| S I G P N M S R Q N F F V L T S K P S H V * E R I * P V S T S F S * H Q N P A T K N G S E H F A P Q F L S T N I Q P Q P AlfI AlfI |AarI AlfI |BspMI AlfI ||BseGI |BccI |||XcmI || TaqI ||||BccI || ClaI |||||BssKI || | MwoI |||||EcoRII || | | SfaNI |||||| ScrFI || | | |TspEI FokI |||||| BseBI \\ \ \ \\ \ \\\\\\ \ TATTATGTTTATATGGCATCGATGGCAATTTTTTGCCCCAACTCCATCAACATCCTGGCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATACAAATATACCGTAGCTACCGTTAAAAAACGGGGTTGAGGTAGTTGTAGGACCGT / / / / // / / / / / / // | | | ClaI |TspEI FokI | | | | | |SetI | | | TaqI SfaNI | | | | | EcoRII | | MwoI | | | | | BssKI | BccI | | | | BseBI AlfI | | | | ScrFI AlfI | | | BspMI | | | BccI | | | AarI | | XcmI | BseGI AlfI AlfI Y Y V Y M A S M A I F C P N S I N I L A I M F I W H R W Q F F A P T P S T S W Q L C L Y G I D G N F L P Q L H Q H P G R ----:----|----:----|----:----|----:----|----:----|----:----| Y * T * I A D I A I K Q G L E M L M R A T N H K Y P M S P L K K G W S W * C G P I I N I H C R H C N K A G V G D V D Q C CfrI | BalI | CviJI | HaeIII | | DdeI | | |MwoI | | || BccI SetI | | || Hin6I |CfrI | | || |GlaI SetI || BalI | | || |Eco47III | MseI || CviJI | | || ||HhaI | | MnlI || HaeIII | | || |||HaeII \ \ \ \\ \ \ \ \\ \\\\ GGTGTTAATGGTTTAGAGGTTGGCCAATGTATAGTGTTGGCCATCTTAGCGCTATTGAAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAATTACCAAATCTCCAACCGGTTACATATCACAACCGGTAGAATCGCGATAACTTG // / / / / // //// |MnlI SetI | CfrI | |MwoI |||Hin6I MseI HaeIII | CfrI ||Eco47III CviJI HaeIII ||BccI BalI CviJI ||GlaI BalI |HhaI HaeII DdeI G V N G L E V G Q C I V L A I L A L L N V L M V * R L A N V * C W P S * R Y * T C * W F R G W P M Y S V G H L S A I E R ----:----|----:----|----:----|----:----|----:----|----:----| P T L P K S T P W H I T N A M K A S N F L H * H N L P Q G I Y L T P W R L A I S T N I T * L N A L T Y H Q G D * R * Q V TatI |Csp6I ||RsaI ||| BccI ||| | Hpy178III* ||| | | AsuI* ||| | | |NlaIV ||| | | |BmgT120I ||| | | || CviJI ||| | | || |BsmAI SetI ||| | | ||CviJI || MlyI HinfI | AciI ||| | |TaqI ||HaeIII || PleI | TsoI | | NspBII* \\\ \ \\ \\\ \\ \ \ \ \ \ \ GATTTGCTGTACTTCTCGATGGGGCCATTAGCCACAAGAGACTCCCATAGGTTTTCCGCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAACGACATGAAGAGCTACCCCGGTAATCGGTGTTCTCTGAGGGTATCCAAAAGGCGA //// // /// / /// / / / |||| |TaqI ||AsuI* | ||BsmAI | SetI NspBII* |||| | || | |PleI HinfI AciI |||| | || | MlyI TsoI |||| | || CviJI |||| | |BmgT120I |||| | |HaeIII |||| | |CviJI |||| | NlaIV |||| Hpy178III* |||BccI ||TatI |Csp6I RsaI D L L Y F S M G P L A T R D S H R F S A I C C T S R W G H * P Q E T P I G F P L F A V L L D G A I S H K R L P * V F R C ----:----|----:----|----:----|----:----|----:----|----:----| S K S Y K E I P G N A V L S E W L N E A R N A T S R S P A M L W L L S G Y T K R I Q Q V E R H P W * G C S V G M P K G S TfiI HinfI StyI | CspCI SecI* | | AsuI* | Hin6I | | |CviJI | |GlaI | | |HaeIII | ||HhaI | | |BmgT120I BsiYI* | ||BciVI | | || AciI TaqII |BsiYI* | |||HaeII | | || Cac8I \ \\ \ \\\\ \ \ \\ \ GTTTTGATTATCCCATTTTTGGGTGTATCCTTGGCGCTATGGAAATGGAATCGTTGGCCC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAACTAATAGGGTAAAAACCCACATAGGAACCGCGATACCTTTACCTTAGCAACCGGG / // //// / / /// TaqII |BsiYI* |||Hin6I | HinfI ||AsuI* BsiYI* ||BciVI | TfiI ||Cac8I ||GlaI CspCI |BmgT120I |HhaI HaeIII SecI* CviJI HaeII StyI V L I I P F L G V S L A L W K W N R W P F * L S H F W V Y P W R Y G N G I V G P F D Y P I F G C I L G A M E M E S L A R ----:----|----:----|----:----|----:----|----:----|----:----| T K I I G N K P T D K A S H F H F R Q G Q K S * G M K P H I R P A I S I S D N A N Q N D W K Q T Y G Q R * P F P I T P G FauI Tsp4CI* | XcmI | | TspRI CspCI \ \ \ \ GCCACAGTGTTTGTGGGAGATACATATTGTTATTTCGCTGGAATGGTATTCGCAGTCGTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGTCACAAACACCCTCTATGTATAACAATAAAGCGACCTTACCATAAGCGTCAGCAA // / / / || | FauI CspCI || | XcmI || Tsp4CI* |TspRI AciI A T V F V G D T Y C Y F A G M V F A V V P Q C L W E I H I V I S L E W Y S Q S L H S V C G R Y I L L F R W N G I R S R W ----:----|----:----|----:----|----:----|----:----|----:----| A V T N T P S V Y Q * K A P I T N A T T R W L T Q P L Y M N N N R Q F P I R L R G C H K H S I C I T I E S S H Y E C D N AccI |BssNAI |Hpy166II || BsrI MseI || | BcgI MnlI || | |BfiI |TspEI || | ||SfaNI TspDTI BcgI || TspDTI \\ \ \\\ \ \ \\ \ GGTATACTGGGTCATTTTTCAAAGACGATGCTTTTGCTATTCATTCCTCAAATCGTTAAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCATATGACCCAGTAAAAAGTTTCTGCTACGAAAACGATAAGTAAGGAGTTTAGCAATTA // / / / / / / / // || | | BfiI SfaNI TspDTI BcgI | |MseI || | BcgI | TspDTI || BsrI MnlI |AccI Hpy166II BssNAI G I L G H F S K T M L L L F I P Q I V N V Y W V I F Q R R C F C Y S F L K S L I Y T G S F F K D D A F A I H S S N R * F ----:----|----:----|----:----|----:----|----:----|----:----| P I S P * K E F V I S K S N M G * I T L Q Y V P D N K L S S A K A I * E E F R * T Y Q T M K * L R H K Q * E N R L D N I FatI |CviAII || NlaIII || | DdeI || | BbvCI || | Bpu10I || | | BslFI || | | | AluI || | | | CviJI || | | | | SetI || | | | | | MnlI || | | | | | | TspEI || | | | | | | | BspCNI || | | | | | | | |BseMII || | | | | | | | || AsuI* || | | | | | | | || AvaII || | | | | | | | || |BmgT120I || | | | | | | | || ||NlaIV || | | | | | | | || ||| BsmAI MaeIII || | | | | | | | || ||| | AvaI BstEII || | | | | | | | || ||| | |BmeT110I | SetI SetI \\ \ \ \ \ \ \ \ \\ \\\ \ \\ \ \ \ TTTATTTATTCATGTCCTCAGCTATTCAAATTGGTCCCCTGCCCGAGACATAGGTTACCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAAATAAGTACAGGAGTCGATAAGTTTAACCAGGGGACGGGCTCTGTATCCAATGGA / / // /// / / // / // / // / / / TspEI | |FatI ||| | | || | |AvaII | |AvaI SetI | BstEII | | ||| | | || | |AsuI* | BmeT110I | MaeIII | | ||| | | || | | BsmAI SetI | | ||| | | || | BmgT120I | | ||| | | || | NlaIV | | ||| | | || TspEI | | ||| | | |BseMII | | ||| | | BspCNI | | ||| | MnlI | | ||| BslFI | | ||CviJI | | ||AluI | | |Bpu10I | | |BbvCI | | |DdeI | | SetI | CviAII NlaIII F I Y S C P Q L F K L V P C P R H R L P L F I H V L S Y S N W S P A R D I G Y L Y L F M S S A I Q I G P L P E T * V T * ----:----|----:----|----:----|----:----|----:----|----:----| K I * E H G * S N L N T G Q G L C L N G N * K N M D E A I * I P G R G S V Y T V K N I * T R L * E F Q D G A R S M P * R ApoI Tsp4CI* Hpy178III* TspEI | MseI | BciVI | MseI | |TspDTI | |BccI MseI AciI \ \ \ \\ \ \\ \ \ AAATTTAATGAAAAAGACGGTTTAATGTATCCATCAAGAGCAAACTTAAAAGAAGAACCG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAATTACTTTTTCTGCCAAATTACATAGGTAGTTCTCGTTTGAATTTTCTTCTTGGC / / / / / / / / / | MseI | | MseI | BccI MseI AciI TspEI | TspDTI Hpy178III* ApoI Tsp4CI* BciVI K F N E K D G L M Y P S R A N L K E E P N L M K K T V * C I H Q E Q T * K K N R I * * K R R F N V S I K S K L K R R T A ----:----|----:----|----:----|----:----|----:----|----:----| L N L S F S P K I Y G D L A F K F S S G * I * H F L R N L T D M L L L S L L L V F K I F F V T * H I W * S C V * F F F R MseI |AhaIII* || BarI || |MboI BssKI || || DpnI EcoRII || || |BstKTI Tsp4CI* | ScrFI || || ||Hpy178III* | BsmAI | BseBI MboII || || ||| MaeIII | | BarI | |SetI \ \\ \\ \\\ \ \ \ \ \ \\ CCAAAGAGCATTTTTAAACCGATCTTGAAGTTACTATACTGTCTCCATTTGATTGACCTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTCTCGTAAAAATTTGGCTAGAACTTCAATGATATGACAGAGGTAAACTAACTGGAC / /// // / / / / / / / / MboII ||MseI || | | | | | | | BseBI || || | | | | | | | ScrFI || || | | | | | | SetI || || | | | | | BsmAI || || | | | | BarI || || | | | Tsp4CI* || || | | MaeIII || || | Hpy178III* || || MboI || |DpnI || BstKTI |AhaIII* BarI P K S I F K P I L K L L Y C L H L I D L Q R A F L N R S * S Y Y T V S I * L T W K E H F * T D L E V T I L S P F D * P G ----:----|----:----|----:----|----:----|----:----|----:----| G F L M K L G I K F N S Y Q R W K I S R A L S C K * V S R S T V I S D G N S Q G W L A N K F R D Q L * * V T E M Q N V Q MnlI |MaeII || MseI ApoI || SetI TspEI TspDTI SetI || TaiI \ \ \ \\ \ GAATTTGATGAAAATAATGAGATTATTAGCACCTCTAATATGACGTTAATAAACTTGACA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAACTACTTTTATTACTCTAATAATCGTGGAGATTATACTGCAATTATTTGAACTGT / / / / // / / | TspEI TspDTI SetI || | MseI | ApoI || MaeII EcoRII |TaiI BssKI |SetI MnlI E F D E N N E I I S T S N M T L I N L T N L M K I M R L L A P L I * R * * T * H I * * K * * D Y * H L * Y D V N K L D I ----:----|----:----|----:----|----:----|----:----|----:----| S N S S F L S I I L V E L I V N I F K V P I Q H F Y H S * * C R * Y S T L L S S F K I F I I L N N A G R I H R * Y V Q C AsuI* |MnlI |CviJI TspEI |HaeIII |BbvII* Hpy178III* |BmgT120I || MboII | CviRI* MslI || BsiYI* || |CviRI* | |TspEI \ \\ \ \\ \\ \ \\ TTAGTATGGTTTGGCCCTATGAGGGAAGACAAATTGTGCAATACAATCTTGAAGTTGCAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AATCATACCAAACCGGGATACTCCCTTCTGTTTAACACGTTATGTTAGAACTTCAACGTT / //// / // / / / MslI |||| BsiYI* || CviRI* | CviRI* |||AsuI* |BbvII* Hpy178III* ||BmgT120I |MboII |HaeIII TspEI |CviJI MnlI L V W F G P M R E D K L C N T I L K L Q * Y G L A L * G K T N C A I Q S * S C N S M V W P Y E G R Q I V Q Y N L E V A I ----:----|----:----|----:----|----:----|----:----|----:----| N T H N P G I L S S L N H L V I K F N C M L I T Q G * S P L C I T C Y L R S T A * Y P K A R H P F V F Q A I C D Q L Q L BbvII* | SfeI* | | MboII | | | MwoI | | | |Hin6I CfrI CviRI* | | | ||GlaI | BalI | ApoI | | | |||HhaI | CviJI | TspEI CviJI | | | ||||HaeII | HaeIII \ \ \ \ \ \ \\\\\ \ \ TTCTGCATTGGAATTTTGGCTTTACTTGGAAGACACGCTATAGGCGCTATCATCTTTGGC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAGACGTAACCTTAAAACCGAAATGAACCTTCTGTGCGATATCCGCGATAGTAGAAACCG / / / / / ///// / | CviRI* | CviJI | ||||Hin6I HaeIII TspEI TspEI | |||GlaI CviJI ApoI | ||HhaI BalI | |HaeII | SfeI* BbvII* MboII MwoI F C I G I L A L L G R H A I G A I I F G S A L E F W L Y L E D T L * A L S S L A L H W N F G F T W K T R Y R R Y H L W P ----:----|----:----|----:----|----:----|----:----|----:----| N Q M P I K A K S P L C A I P A I M K P I R C Q F K P K V Q F V R * L R * * R Q E A N S N Q S * K S S V S Y A S D D K A Tsp4CI* |Csp6I ||RsaI |||MaeII |||| SetI SetI |||| TaiI \ \\\\ \ CACGACAACCTATGGACAGTACGTTGA 1330 1340 ----:----|----:----|----:-- GTGCTGTTGGATACCTGTCATGCAACT / / / // / CfrI SetI | || MaeII | |Csp6I | RsaI | TaiI | SetI Tsp4CI* H D N L W T V R * T T T Y G Q Y V X R Q P M D S T L X ----:----|----:----|----:-- W S L R H V T R Q G R C G I S L V N V V V * P C Y T S # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AflIII 1 AhaIII* 1 DraI AlfI 2 AluI 2 AluBI ApaI 1 ApoI 4 AcsI,XapI AsuI* 8 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 3 MlsI,MluNI,MscI,Msp20I BarI 1 BbvCI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 8 Bce83I* 1 BpuEI BceAI 2 BcgI 1 BciVI 2 BfuI BetI* 1 BsaWI BfiI 1 BmrI,BmuI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 8 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BseSI 1 BaeGI,BstSLI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI Bsp120I 1 PspOMI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 1 BtgZI 2 BtsI 1 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 5 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CspCI 1 CviAII 5 CviJI 18 CviKI-1 CviRI* 5 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 1 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco47III 2 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI FalI 2 FatI 5 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 4 HaeII 4 BstH2I HaeIII 11 BsnI,BsuRI,BshFI,PhoI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 2 HpyAV Hin6I 4 HinP1I,HspAI HinfI 4 HpaII 2 HapII,BsiSI,MspI Hpy166II 2 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 1 MaeI 1 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 3 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 1 SchI MmeI 1 MnlI 7 MseI 8 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PfoI 1 PleI 1 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PstI 1 RsaI 4 AfaI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 17 SfaNI 2 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 2 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 2 TaqII 1 TatI 2 TauI 1 TfiI 3 PfeI TseI 2 ApeKI TsoI 2 Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 9 TasI,Tsp509I,Sse9I TspRI 4 TscAI XcmI 2 XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AflII AgeI AjuI AloI AlwNI ApaLI AscI Asp718I AsuII AvrII BaeI BamHI BclI BdaI BglI BglII BinI* BmtI BplI BsaBI BsaXI BsePI BseRI BseYI BsgI BsiI* BsmI Bsp1407I BspLU11I* BspMII* BspOI BsrBI BstAPI BstXI BtrI Cfr10I Cfr9I DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FseI FspAI GsaI GsuI HgaI HgiAI* HgiCI* HindII HindIII HpaI HphI Hpy99I KasI KpnI Ksp632I* MauBI MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NsiI OliI PacI PasI PflMI PmeI PpiI PpuMI PshAI PsiI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SwaI Tsp45I TspGWI TspMI TstI Tth111I VspI XbaI XhoI XhoII XmaCI XmaI XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769