Restriction Map of CDC28/YBR160W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CDC28/YBR160W on chromosome II from coordinates 560078 to 560974.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.25047

Csp6I |RsaI |SetI AciI ||Bce83I* BsrBI TspEI ||| HphI | TspEI |HphI SmlI Hin4II* ||| | Tsp4CI* \ \ \\ \ \ \\\ \ \ ATGAGCGGTGAATTAGCAAATTACAAAAGACTTGAGAAAGTCGGTGAAGGTACATACGGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGCCACTTAATCGTTTAATGTTTTCTGAACTCTTTCAGCCACTTCCATGTATGCCA / / / / / / / / /// / / | AciI | | TspEI | Hin4II* | ||| | Tsp4CI* BsrBI | HphI SmlI | ||| HphI TspEI | ||Csp6I | |RsaI | Bce83I* SetI M S G E L A N Y K R L E K V G E G T Y G * A V N * Q I T K D L R K S V K V H T V E R * I S K L Q K T * E S R * R Y I R C ----:----|----:----|----:----|----:----|----:----|----:----| X L P S N A F * L L S S F T P S P V Y P X S R H I L L N C F V Q S L R H L Y M R H A T F * C I V F S K L F D T F T C V T BssKI EcoRII | ScrFI | BseBI | |CfrI | |SetI | || BalI | || CviJI | || EcoNI | || HaeIII | || |StyI SmlI | || |SecI* AflII | || ||BsiYI* PsiI |MseI | || ||| SetI \ \\ \ \\ \\\ \ GTTGTTTATAAAGCGTTAGACTTAAGACCTGGCCAAGGTCAAAGAGTAGTCGCATTGAAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAAATATTTCGCAATCTGAATTCTGGACCGGTTCCAGTTTCTCATCAGCGTAACTTC / /// ////// / PsiI ||| |||||| SecI* ||| |||||| StyI ||| |||||SetI ||| ||||CfrI ||| |||EcoNI ||| ||EcoRII ||| ||HaeIII ||| ||BssKI ||| ||CviJI ||| ||BalI ||| |BsiYI* ||| BseBI ||| ScrFI ||SetI |AflII |SmlI MseI V V Y K A L D L R P G Q G Q R V V A L K L F I K R * T * D L A K V K E * S H * R C L * S V R L K T W P R S K S S R I E E ----:----|----:----|----:----|----:----|----:----|----:----| T T * L A N S K L G P W P * L T T A N F H Q K Y L T L S L V Q G L D F L L R M S N N I F R * V * S R A L T L S Y D C Q L BbvII* | BfiI | | MboII | | | BsrI | | | | TatI | | | | |Csp6I MboII | | | | ||RsaI Hpy188I |MaeI MnlI | | | | ||| CviJI | BccI Hin4II* \\ \ \ \ \ \ \\\ \ \ \ \ AAAATAAGACTAGAGAGTGAAGACGAGGGTGTTCCCAGTACAGCCATCAGAGAAATCTCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTATTCTGATCTCTCACTTCTGCTCCCACAAGGGTCATGTCGGTAGTCTCTTTAGAGT / / / / / / /// / / / / | MaeI MnlI | | BsrI ||| | | BccI Hin4II* MboII | BbvII* ||| | Hpy188I | MboII ||| CviJI BfiI ||TatI |Csp6I RsaI K I R L E S E D E G V P S T A I R E I S K * D * R V K T R V F P V Q P S E K S H N K T R E * R R G C S Q Y S H Q R N L I ----:----|----:----|----:----|----:----|----:----|----:----| F I L S S L S S S P T G L V A M L S I E S F L V L S H L R P H E W Y L W * L F R F Y S * L T F V L T N G T C G D S F D * SfaNI | Hpy166II TspEI | | MslI | MseI SspI Hpy188I | | |Hpy188I \ \ \ \ \ \ \\ TTATTGAAGGAATTAAAAGACGATAATATTGTCAGATTATACGATATTGTTCACTCTGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACTTCCTTAATTTTCTGCTATTATAACAGTCTAATATGCTATAACAAGTGAGACTA // / / // / |MseI SspI Hpy188I || Hpy188I TspEI || MslI |SfaNI Hpy166II L L K E L K D D N I V R L Y D I V H S D Y * R N * K T I I L S D Y T I L F T L M I E G I K R R * Y C Q I I R Y C S L * C ----:----|----:----|----:----|----:----|----:----|----:----| N N F S N F S S L I T L N Y S I T * E S M I S P I L L R Y Y Q * I I R Y Q E S Q * Q L F * F V I I N D S * V I N N V R I TaqI | BsiYI* | | AsuI* | | AvaII AluI | | |MnlI CviJI | | |BmgT120I CviRI* | SetI | | || SetI MnlI \ \ \ \ \ \\ \ \ GCACACAAGCTATATCTTGTTTTTGAGTTCCTCGATTTGGACCTGAAAAGATATATGGAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGTGTTCGATATAGAACAAAAACTCAAGGAGCTAAACCTGGACTTTTCTATATACCTC / / / // //// / | | CviJI |TaqI |||AvaII MnlI | | AluI | |||AsuI* | SetI | ||BmgT120I CviRI* | |SetI | MnlI BsiYI* A H K L Y L V F E F L D L D L K R Y M E H T S Y I L F L S S S I W T * K D I W R T Q A I S C F * V P R F G P E K I Y G G ----:----|----:----|----:----|----:----|----:----|----:----| A C L S Y R T K S N R S K S R F L Y I S H V C A I D Q K Q T G R N P G S F I Y P C V L * I K N K L E E I Q V Q F S I H L AsuI* AvaII AluI |BmgT120I CviJI MseI || Tsp4CI* | SetI | SfaNI CviRI* \\ \ \ \ \ \ \ GGTATTCCAAAGGACCAACCGTTAGGAGCTGATATTGTTAAGAAGTTTATGATGCAACTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAAGGTTTCCTGGTTGGCAATCCTCGACTATAACAATTCTTCAAATACTACGTTGAA // / / / / / / || | | CviJI MseI SfaNI CviRI* || | | AluI || | SetI || Tsp4CI* |AvaII |AsuI* BmgT120I G I P K D Q P L G A D I V K K F M M Q L V F Q R T N R * E L I L L R S L * C N F Y S K G P T V R S * Y C * E V Y D A T L ----:----|----:----|----:----|----:----|----:----|----:----| P I G F S W G N P A S I T L F N I I C S P Y E L P G V T L L Q Y Q * S T * S A V T N W L V L R * S S I N N L L K H H L K CviRI* | Hpy178III* | | SfaNI | | |MseI | | ||AhaIII* CviRI* Tsp4CI* | | ||| AciI \ \ \ \ \\\ \ TGTAAGGGTATTGCATACTGCCACTCACACCGTATTCTGCATCGTGATTTAAAACCGCAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ACATTCCCATAACGTATGACGGTGAGTGTGGCATAAGACGTAGCACTAAATTTTGGCGTC / / / / /// / CviRI* Tsp4CI* | | ||| AciI | | ||SfaNI | | |MseI | | AhaIII* | Hpy178III* CviRI* C K G I A Y C H S H R I L H R D L K P Q V R V L H T A T H T V F C I V I * N R R * G Y C I L P L T P Y S A S * F K T A E ----:----|----:----|----:----|----:----|----:----|----:----| Q L P I A Y Q W E C R I R C R S K F G C K Y P Y Q M S G S V G Y E A D H N L V A T L T N C V A V * V T N Q M T I * F R L CviJI |DdeI |EspI* ||HphI ||| Hin6I ||| |GlaI ||| ||HhaI BsaBI ||| ||FnuDII* MseI |TfiI ||| ||| Cac8I | BccI |HinfI MaeI SetI ||| ||| | TspGWI \ \ \\ \ \ \\\ \\\ \ \ AACTTATTGATTAACAAAGATGGGAATCTAAAACTAGGTGATTTTGGCTTAGCGCGTGCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAATAACTAATTGTTTCTACCCTTAGATTTTGATCCACTAAAACCGAATCGCGCACGA // / / // // //// // |BccI | HinfI |MaeI || |||| |TspGWI MseI | TfiI SetI || |||| Cac8I BsaBI || |||FnuDII* || |||Hin6I || ||GlaI || |HhaI || EspI* || DdeI |HphI CviJI N L L I N K D G N L K L G D F G L A R A T Y * L T K M G I * N * V I L A * R V L L I D * Q R W E S K T R * F W L S A C F ----:----|----:----|----:----|----:----|----:----|----:----| F K N I L L S P F R F S P S K P K A R A S S I S * C L H S D L V L H N Q S L A H V * Q N V F I P I * F * T I K A * R T S MnlI |AluI |CviJI |Ecl136II || SetI || SduI || SacI || BetI* FatI || HgiAI* |CviAII || BspMII* AluI || NlaIII || HgiJII* CviJI || |TspEI || |HpaII | SetI || || MaeIII TspDTI || |Hpy178III* \ \ \\ \\ \ \ \\ \\ TTTGGTGTTCCGTTGAGAGCTTACACACATGAAATTGTTACTCTATGGTATAGAGCTCCG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCACAAGGCAACTCTCGAATGTGTGTACTTTAACAATGAGATACCATATCTCGAGGC / / / // / // / / // | CviJI | |FatI | |TspDTI | | |Hpy178III* | AluI | | | MaeIII | | |HpaII SetI | | TspEI | | TaqII | CviAII | Ecl136II NlaIII | CviJI | AluI HgiJII* HgiAI* SacI SduI SetI MnlI F G V P L R A Y T H E I V T L W Y R A P L V F R * E L T H M K L L L Y G I E L R W C S V E S L H T * N C Y S M V * S S G ----:----|----:----|----:----|----:----|----:----|----:----| K P T G N L A * V C S I T V R H Y L A G K Q H E T S L K C V H F Q * E I T Y L E K T N R Q S S V C M F N N S * P I S S R FatI TatI |CviAII |Csp6I || AsuI* ||RsaI || AvaII |||Hin4I || NlaIII |||Hin4I || |BmgT120I TaqII |||| SetI || || CviJI | SetI BsrI BfiI |||| | TaqI || || | BccI \ \ \ \ \\\\ \ \ \\ \\ \ \ GAGGTATTACTGGGTGGAAAACAATATAGTACAGGTGTCGATACATGGTCCATCGGCTGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCATAATGACCCACCTTTTGTTATATCATGTCCACAGCTATGTACCAGGTAGCCGACA / / / / /// / / // // / // BspMII* BsrI BfiI | ||TatI | | || |AvaII | |BccI BetI* | ||SetI | | || |AsuI* | Hin4I SetI | |Csp6I | | || | | Hin4I | RsaI | | || | CviJI Hin4I | | || BmgT120I Hin4I | | |FatI | | CviAII | NlaIII TaqI E V L L G G K Q Y S T G V D T W S I G C R Y Y W V E N N I V Q V S I H G P S A V G I T G W K T I * Y R C R Y M V H R L Y ----:----|----:----|----:----|----:----|----:----|----:----| S T N S P P F C Y L V P T S V H D M P Q P P I V P H F V I Y Y L H R Y M T W R S L Y * Q T S F L I T C T D I C P G D A T MboI | DpnI | |TaqI | |ClaI | |BstKTI MaeIII | ||MboI | Eco57I | ||| DpnI Hin4I | Eco57MI BdaI | ||| |BstKTI Hin4I | | MboII BdaI TspRI | ||| || Hpy188I \ \ \ \ \ \ \ \\\ \\ \ ATATTTGCCGAAATGTGTAACAGGAAACCAATCTTCAGTGGCGATAGTGAGATCGATCAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TATAAACGGCTTTACACATTGTCCTTTGGTTAGAAGTCACCGCTATCACTCTAGCTAGTC / / / / / // /// / | | MboII | BdaI || ||| Hpy188I | MaeIII | BdaI || ||| MboI Eco57MI TspRI || ||DpnI Eco57I || |BstKTI || |ClaI || |TaqI || MboI |DpnI BstKTI I F A E M C N R K P I F S G D S E I D Q Y L P K C V T G N Q S S V A I V R S I R I C R N V * Q E T N L Q W R * * D R S D ----:----|----:----|----:----|----:----|----:----|----:----| I N A S I H L L F G I K L P S L S I S * Y I Q R F T Y C S V L R * H R Y H S R D Y K G F H T V P F W D E T A I T L D I L AluI CviJI | SetI | | CfrI | | | BalI Hpy178III* | | | CviJI | BdaI | | | HaeIII AccI | BdaI Hpy188I | | | | TspDTI |Hpy166II \ \ \ \ \ \ \ \ \\ ATTTTCAAGATATTCAGAGTATTGGGAACGCCGAATGAAGCTATATGGCCAGATATTGTC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAGTTCTATAAGTCTCATAACCCTTGCGGCTTACTTCGATATACCGGTCTATAACAG // / / / / / / |BdaI Hpy188I | CviJI | CfrI Hpy166II |BdaI | AluI TspDTI Hpy178III* SetI HaeIII CviJI BalI I F K I F R V L G T P N E A I W P D I V F S R Y S E Y W E R R M K L Y G Q I L S F Q D I Q S I G N A E * S Y M A R Y C L ----:----|----:----|----:----|----:----|----:----|----:----| I K L I N L T N P V G F S A I H G S I T S K * S I * L I P F A S H L * I A L Y Q N E L Y E S Y Q S R R I F S Y P W I N D Hin6I CviJI |GlaI | HindIII ||HhaI | | AluI ||MnlI FalI | | CviJI |||FalI Acc65I FalI | | | SetI |||FalI SetI HgiCI* \ \ \ \ \ \\\\ \ \ TACTTGCCTGATTTCAAGCCAAGCTTTCCTCAATGGCGCAGAAAAGACCTATCACAAGTG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAACGGACTAAAGTTCGGTTCGAAAGGAGTTACCGCGTCTTTTCTGGATAGTGTTCAC // / / / / / /// / / |FalI | | | HindIII | ||Hin6I SetI KpnI |FalI | | CviJI | |MnlI AccI | | AluI | |GlaI | SetI | HhaI CviJI FalI FalI Y L P D F K P S F P Q W R R K D L S Q V T C L I S S Q A F L N G A E K T Y H K W L A * F Q A K L S S M A Q K R P I T S G ----:----|----:----|----:----|----:----|----:----|----:----| * K G S K L G L K G * H R L F S R D C T R S A Q N * A L S E E I A C F L G I V L V Q R I E L W A K R L P A S F V * * L H Csp6I |RsaI |NlaIV || KpnI || | BinI* || | | XbaI || | | |MaeI || | | |Hpy178III* || | | || MboI || | | || XhoII || | | || | MmeI || | | || | DpnI || | | || | |BstKTI || | | || | || AciI FnuDII* || | | || | || FnuDII* BseRI | MnlI \\ \ \ \\ \ \\ \ \ \ \ GTACCAAGTCTAGATCCACGCGGTATTGATTTGTTGGACAAACTCCTCGCGTATGACCCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CATGGTTCAGATCTAGGTGCGCCATAACTAAACAACCTGTTTGAGGAGCGCATACTGGGA /// / /// / / / / / / ||| | ||| | | AciI BseRI | MnlI ||| | ||| | FnuDII* FnuDII* ||| | ||| XhoII ||| | ||| MboI ||| | ||DpnI ||| | |BstKTI ||| | |XbaI ||| | Hpy178III* ||| | MaeI ||| | MmeI ||| BinI* ||HgiCI* ||Acc65I |Csp6I NlaIV RsaI V P S L D P R G I D L L D K L L A Y D P Y Q V * I H A V L I C W T N S S R M T L T K S R S T R Y * F V G Q T P R V * P Y ----:----|----:----|----:----|----:----|----:----|----:----| T G L R S G R P I S K N S L S R A Y S G P V L D L D V R Y Q N T P C V G R T H G Y W T * I W A T N I Q Q V F E E R I V R Hin4I Hin6I |SapI |GlaI |Ksp632I* ||FokI ||HhaI |||HaeII |||| MwoI |||| | TseI |||| | |BisI |||| | ||BlsI |||| | |||CviJI |||| | ||||BseGI MseI |||| | ||||| MboII Hin4I | BetI* |||| | ||||| | BccI | TfiI | |HpaII |||| | ||||| | BbvI | HinfI \ \\ \\\\ \ \\\\\ \ \ \ \ ATTAACCGGATTAGCGCCAGAAGAGCAGCCATCCACCCCTACTTCCAAGAATCATAA 850 860 870 880 890 ----:----|----:----|----:----|----:----|----:----|----:-- TAATTGGCCTAATCGCGGTCTTCTCGTCGGTAGGTGGGGATGAAGGTTCTTAGTATT / // //// /// /// / / / / | || |||| ||FokI ||| MboII | Hin4I HinfI | || |||| |MwoI ||CviJI | BbvI TfiI | || |||| | ||TseI BccI | || |||| | |BseGI | || |||| | |BisI | || |||| | BlsI | || |||| Ksp632I* | || |||| SapI | || |||Hin6I | || ||GlaI | || |HhaI | || HaeII | |BetI* | |Hin4I | HpaII MseI I N R I S A R R A A I H P Y F Q E S * L T G L A P E E Q P S T P T S K N H X * P D * R Q K S S H P P L L P R I I X ----:----|----:----|----:----|----:----|----:----|----:-- I L R I L A L L A A M W G * K W S D Y * * G S * R W F L L W G G R S G L I M N V P N A G S S C G D V G V E L F * L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 1 DraI AluI 6 AluBI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 1 BpuEI BdaI 2 BetI* 2 BsaWI BfiI 2 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 3 BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseRI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 3 Cac8I 1 BstC8I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 2 CviJI 13 CviKI-1 CviRI* 4 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 3 MalI Ecl136II 1 EcoICRI Eco57I 1 AcuI Eco57MI 1 EcoNI 1 BstENI,XagI EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 2 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 3 HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 2 HpyAV Hin6I 3 HinP1I,HspAI HindIII 1 HinfI 2 HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 5 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeIII 2 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MmeI 1 MnlI 6 MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PsiI 1 AanI RsaI 4 AfaI SacI 1 Psp124BI,SstI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 14 SfaNI 3 LweI SmlI 2 SmoI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaqI 3 TaqII 1 TatI 2 TfiI 2 PfeI TseI 1 ApeKI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI XbaI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI AsuII AvaI AvrII BaeI BamHI BarI BbvCI BceAI BcgI BciVI BclI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaXI BseMII BsePI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspOI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Eco31I Eco47III EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I FaqI FauI FseI FspAI GsaI GsuI HgaI HindII HpaI Hpy99I KasI MaeII MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacII SalI SanDI SauI* ScaI SchI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaiI TauI TsoI Tsp45I TspMI TstI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769