Restriction Map of IFA38/YBR159W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

IFA38/YBR159W on chromosome II from coordinates 558685 to 559728.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.14157

CviRI* | MnlI | AluI | CviJI | | SetI | | | Hpy178III* | | | | BseYI | | | | CviJI | | | | | GsaI SetI \ \ \ \ \ \ \ ATGACTTTTATGCAACAGCTTCAAGAGGCTGGGGAAAGATTTAGGTGTATCAATGGTCTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGAAAATACGTTGTCGAAGTTCTCCGACCCCTTTCTAAATCCACATAGTTACCAGAA / /// / / / / | ||CviJI | | BseYI SetI | ||AluI | CviJI | |MnlI | GsaI | SetI Hpy178III* CviRI* M T F M Q Q L Q E A G E R F R C I N G L * L L C N S F K R L G K D L G V S M V F D F Y A T A S R G W G K I * V Y Q W S F ----:----|----:----|----:----|----:----|----:----|----:----| X V K I C C S * S A P S L N L H I L P R X S K * A V A E L P Q P F I * T Y * H D H S K H L L K L L S P F S K P T D I T K TatI Bsp1407I |Csp6I ||RsaI ||| AclI ||| MaeII ||| | SetI CviJI MseI ||| | TaiI DdeI \ \ \\\ \ \ \ TTATGGGTTGTTTTTGGGCTTGGTGTCTTAAAATGTACAACGTTATCACTTAGATTTTTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AATACCCAACAAAAACCCGAACCACAGAATTTTACATGTTGCAATAGTGAATCTAAAAAT / / //// / / / CviJI MseI |||| MaeII DdeI SetI |||| AclI |||TaiI |||SetI ||Bsp1407I ||TatI |Csp6I RsaI L W V V F G L G V L K C T T L S L R F L Y G L F L G L V S * N V Q R Y H L D F * M G C F W A W C L K M Y N V I T * I F S ----:----|----:----|----:----|----:----|----:----|----:----| K H T T K P S P T K F H V V N D S L N K K I P Q K Q A Q H R L I Y L T I V * I K * P N N K P K T D * F T C R * * K S K * AluI MboI CviJI | DpnI TspEI | SetI | |BstKTI | TaqI EcoP15I \ \ \ \\ \ \ \ GCTCTTATTTTTGATCTTTTTTTACTACCAGCAGTCAATTTCGACAAGTATGGTGCTAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGAATAAAAACTAGAAAAAAATGATGGTCGTCAGTTAAAGCTGTTCATACCACGATTT / // / / / CviJI || MboI | TaqI AluI |DpnI TspEI BstKTI A L I F D L F L L P A V N F D K Y G A K L L F L I F F Y Y Q Q S I S T S M V L K S Y F * S F F T T S S Q F R Q V W C * N ----:----|----:----|----:----|----:----|----:----|----:----| A R I K S R K K S G A T L K S L Y P A L L E * K Q D K K V V L L * N R C T H H * S K N K I K K * * W C D I E V L I T S F BsrI TspRI |CviRI* || MaeIII || Tsp45I ApoI BsrI Tsp4CI* || | Tsp4CI* TspEI MaeI \ \ \\ \ \ \ \ ACTGGTAAATACTGTGCTATCACTGGTGCAAGTGACGGTATTGGTAAAGAATTTGCTAGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGACCATTTATGACACGATAGTGACCACGTTCACTGCCATAACCATTTCTTAAACGATCT / / / / / / / / / | BsrI | TspRI | CviRI* Tsp4CI* | MaeI EcoP15I Tsp4CI* BsrI Tsp45I TspEI MaeIII ApoI T G K Y C A I T G A S D G I G K E F A R L V N T V L S L V Q V T V L V K N L L D W * I L C Y H W C K * R Y W * R I C * T ----:----|----:----|----:----|----:----|----:----|----:----| V P L Y Q A I V P A L S P I P L S N A L F Q Y I S H * * Q H L H R Y Q Y L I Q * S T F V T S D S T C T V T N T F F K S S MboI | DpnI | |BstKTI | ||AvaI | ||XhoI | ||SmlI MaeII | ||Hpy178III* | SetI | |||TaqI | TaiI | |||BmeT110I MnlI | | CviJI | ||||Hpy178III* |TspEI \ \ \ \ \\\\\ \\ CAAATGGCGAAACGTGGCTTCAACTTGGTATTGATCTCGAGAACGCAATCTAAATTGGAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTACCGCTTTGCACCGAAGTTGAACCATAACTAGAGCTCTTGCGTTAGATTTAACCTC / / / // / /// / / | | CviJI || | ||| MnlI TspEI | MaeII || | ||Hpy178III* TaiI || | ||SmlI SetI || | ||XhoI || | ||AvaI || | |BmeT110I || | |TaqI || | Hpy178III* || MboI |DpnI BstKTI Q M A K R G F N L V L I S R T Q S K L E K W R N V A S T W Y * S R E R N L N W R N G E T W L Q L G I D L E N A I * I G G ----:----|----:----|----:----|----:----|----:----|----:----| C I A F R P K L K T N I E L V C D L N S V F P S V H S * S P I S R S F A I * I P L H R F T A E V Q Y Q D R S R L R F Q L MboI | DpnI | |BstKTI | || BsaBI | || | FatI TfiI | || | |MboII HinfI | || | |CviAII | MaeI BsrDI CviJI MaeI | || | || NlaIII | | CviJI |MnlI \ \ \ \\ \ \\ \ \ \ \ \\ GCTTTACAAAAAGAACTAGAAGATCAACATCATGTCGTTGTAAAGATTCTAGCCATTGAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAATGTTTTTCTTGATCTTCTAGTTGTAGTACAGCAACATTTCTAAGATCGGTAACTG / / // // / // / // // / CviJI | || || | |FatI | || || MnlI | || || | CviAII | || |BsrDI | || || NlaIII | || Hin4I | || || MboII | || Hin4I | || |BsaBI | |CviJI | || MboI | MaeI | |DpnI HinfI | BstKTI TfiI MaeI A L Q K E L E D Q H H V V V K I L A I D L Y K K N * K I N I M S L * R F * P L T F T K R T R R S T S C R C K D S S H * H ----:----|----:----|----:----|----:----|----:----|----:----| A K C F S S S S * C * T T T F I R A M S P K V F L V L L D V D H R Q L S E L W Q S * L F F * F I L M M D N Y L N * G N V Hin6I TfiI |GlaI Hin4I HinfI |MstI* Hin4I | Hin4I TspEI ||HhaI | AciI TfiI | Hin4I |TspDTI ||| MaeIII | | TsoI HinfI | | MseI || MmeI ||| |HphI \ \ \ \ \ \ \ \\ \ \\\ \\ ATTGCGGAGGATAAAGAATCCAACTATGAATCCATTAAGGAATTGTGTGCGCAGTTACCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGCCTCCTATTTCTTAGGTTGATACTTAGGTAATTCCTTAACACACGCGTCAATGGT / / / / / / / / / /// / / | AciI HinfI | HinfI | | | | ||| HphI MaeIII TsoI TfiI | TfiI | | | | ||Hin6I Hin4I | | | | |MstI* Hin4I | | | | |GlaI | | | | HhaI | | | TspEI | | MmeI | TspDTI MseI I A E D K E S N Y E S I K E L C A Q L P L R R I K N P T M N P L R N C V R S Y Q C G G * R I Q L * I H * G I V C A V T N ----:----|----:----|----:----|----:----|----:----|----:----| M A S S L S D L * S D M L S N H A C N G C Q P P Y L I W S H I W * P I T H A T V N R L I F F G V I F G N L F Q T R L * W Tsp4CI* Ksp632I* \ \ ATCACCGTTTTGGTCAATAATGTTGGTCAATCACACTCCATTCCTGTTCCATTTTTGGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGGCAAAACCAGTTATTACAACCAGTTAGTGTGAGGTAAGGACAAGGTAAAAACCTT / Tsp4CI* I T V L V N N V G Q S H S I P V P F L E S P F W S I M L V N H T P F L F H F W K H R F G Q * C W S I T L H S C S I F G N ----:----|----:----|----:----|----:----|----:----|----:----| I V T K T L L T P * D C E M G T G N K S L * R K P * Y H Q D I V S W E Q E M K P D G N Q D I I N T L * V G N R N W K Q F AluI CviJI |DdeI MseI |MboII VspI Hin4II* ||SetI SspI BtsI TspRI |TspEI \ \\\ \ \ \ \\ ACAGAAGAGAAGGAGCTTAGAAATATTATCACTATCAATAACACTGCTACATTATTAATT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTTCTCTTCCTCGAATCTTTATAATAGTGATAGTTATTGTGACGATGTAATAATTAA / / / / / / / / Ksp632I* | | DdeI SspI TspRI | TspEI Hin4II* | MboII BtsI VspI | CviJI MseI | AluI SetI T E E K E L R N I I T I N N T A T L L I Q K R R S L E I L S L S I T L L H Y * L R R E G A * K Y Y H Y Q * H C Y I I N Y ----:----|----:----|----:----|----:----|----:----|----:----| V S S F S S L F I I V I L L V A V N N I F L L S P A * F Y * * * * Y C Q * M I L C F L L L K S I N D S D I V S S C * * N Tsp4CI* | AluI CspCI | CviJI | BsrDI | CspCI Csp6I | | CviRI* | | SetI |RsaI \ \ \ \ \ \ \\ ACACAAATCATTGCACCAAAGATTGTGGAAACTGTGAAAGCTGAAAACAAGAAGTCGGGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTTTAGTAACGTGGTTTCTAACACCTTTGACACTTTCGACTTTTGTTCTTCAGCCCA / / / / / / / | BsrDI CviRI* | | CviJI RsaI CspCI | | AluI | CspCI | SetI Tsp4CI* T Q I I A P K I V E T V K A E N K K S G H K S L H Q R L W K L * K L K T R S R V T N H C T K D C G N C E S * K Q E V G Y ----:----|----:----|----:----|----:----|----:----|----:----| V C I M A G F I T S V T F A S F L F D P * V F * Q V L S Q P F Q S L Q F C S T P C L D N C W L N H F S H F S F V L L R T MboI | DpnI | |BstKTI | || MseI | || | FatI | || | NcoI | || | StyI | || | SecI* | || | DsaI* | || | |CviAII | || | || NlaIII | || | || | CviJI | || | || | | SduI Hpy188I | || | || | | HgiJII* |TfiI XcmI BsiI* | || | || | | | TsoI |HinfI TsoI | BsiYI* \ \ \\ \ \\ \ \ \ \ \\ \ \ \ ACTCGTGGTTTGATCTTAACCATGGGCTCATTTGGTGGTCTGATTCCCACCCCACTTTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGCACCAAACTAGAATTGGTACCCGAGTAAACCACCAGACTAAGGGTGGGGTGAAAAC / / // / / / // / / / / / // | BsiI* || | | | || | TsoI | | TsoI |BsiYI* Csp6I || | | | || CviJI | HinfI XcmI || | | | |HgiJII* | TfiI || | | | |DsaI* Hpy188I || | | | |SecI* || | | | |StyI || | | | |NcoI || | | | |FatI || | | | |SduI || | | | CviAII || | | NlaIII || | MseI || MboI |DpnI BstKTI T R G L I L T M G S F G G L I P T P L L L V V * S * P W A H L V V * F P P H F W S W F D L N H G L I W W S D S H P T F G ----:----|----:----|----:----|----:----|----:----|----:----| V R P K I K V M P E N P P R I G V G S K Y E H N S R L W P S M Q H D S E W G V K S T T Q D * G H A * K T T Q N G G W K Q BseYI Tsp4CI* CviJI | TspRI | GsaI | |TaqI | | TspEI CviJI | |AsuII XmnI SetI | | | SfaNI \ \ \\ \ \ \ \ \ \ GCTACATACAGTGGTTCGAAATCATTCTTACAAGGTTGGTCTAACTCTTTGGCTGGGGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGTATGTCACCAAGCTTTAGTAAGAATGTTCCAACCAGATTGAGAAACCGACCCCTT / / / / / / / / | | Tsp4CI* | XmnI SetI | BseYI | TspRI AsuII CviJI CviJI TaqI GsaI A T Y S G S K S F L Q G W S N S L A G E L H T V V R N H S Y K V G L T L W L G N Y I Q W F E I I L T R L V * L F G W G I ----:----|----:----|----:----|----:----|----:----|----:----| A V Y L P E F D N K C P Q D L E K A P S P * M C H N S I M R V L N T * S K P Q P S C V T T R F * E * L T P R V R Q S P F MaeIII Tsp45I | MaeI TspEI | | AluI |TspDTI | | CviJI TaqI || MseI | | | TaqI ClaI || VspI | | | SetI \ \\ \ \ \ \ \ TTATCTAAAGATGCTATCGATGTTGAATTAATCATTTCATATTTGGTCACTAGCTCGATG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGATTTCTACGATAGCTACAACTTAATTAGTAAAGTATAAACCAGTGATCGAGCTAC / / / / // //// // | SfaNI ClaI | |VspI |||| |FalI TspEI TaqI | |MseI |||| |FalI | TspEI |||| TaqI TspDTI |||CviJI |||AluI ||MaeI |SetI Tsp45I MaeIII L S K D A I D V E L I I S Y L V T S S M Y L K M L S M L N * S F H I W S L A R C I * R C Y R C * I N H F I F G H * L D V ----:----|----:----|----:----|----:----|----:----|----:----| N D L S A I S T S N I M E Y K T V L E I I I * L H * R H Q I L * K M N P * * S S * R F I S D I N F * D N * I Q D S A R H Hpy188I | MboI | | DpnI | | |BstKTI | | || Hin4I | | || Hin4I | | || | BinI* | | || | |MseI | | || | ||MboII | | || | ||| MboI | | || | ||| | DpnI | | || | ||| | |BstKTI Tsp4CI* FalI | | || | ||| | || FalI | Hin4I FalI | | || | ||| | || FalI | Hin4I \ \ \ \\ \ \\\ \ \\ \ \ \ TCTAAAATCAGAAGATCATCTTTAATGATCCCAAATCCACAACAGTTTGTAAAATCCACT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTTTAGTCTTCTAGTAGAAATTACTAGGGTTTAGGTGTTGTCAAACATTTTAGGTGA / /// / / / // / / / | ||| MboI | | || FalI | Hin4I | ||DpnI | | || FalI | Hin4I | |BstKTI | | || MboI Tsp4CI* | Hin4I | | |DpnI | Hin4I | | BstKTI Hpy188I | MseI MboII BinI* S K I R R S S L M I P N P Q Q F V K S T L K S E D H L * * S Q I H N S L * N P L * N Q K I I F N D P K S T T V C K I H F ----:----|----:----|----:----|----:----|----:----|----:----| D L I L L D D K I I G F G C C N T F D V T * F * F I M K L S G L D V V T Q L I W R F D S S * R * H D W I W L L K Y F G S Bce83I* | TseI | MwoI | AlwNI | BstAPI | |BisI | ||BlsI | |||AciI | ||||BisI | |||||BlsI | ||||||TauI | ||||||HgaI | ||||||CviJI | ||||||| SmlI BsiYI* MseI BbvI | ||||||| | Hpy178III* |BsiYI* \ \ \ \\\\\\\ \ \ \\ TTAAGAAGCGTTGGCAGACGCTGCGGCTCTCAAGAAAGATACGCTACTATGACCCCTTAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCTTCGCAACCGTCTGCGACGCCGAGAGTTCTTTCTATGCGATGATACTGGGGAATG / // / ////// / / // MseI || | |||||| | Hpy178III* |BsiYI* || | |||||| | SmlI BsiYI* || | |||||| HgaI || | |||||CviJI || | ||||BisI || | ||||AciI || | |||BlsI || | ||TseI || | ||TauI || | |BisI || | BlsI || BstAPI || AlwNI || MwoI |Bce83I* BbvI L R S V G R R C G S Q E R Y A T M T P Y * E A L A D A A A L K K D T L L * P L T K K R W Q T L R L S R K I R Y Y D P L L ----:----|----:----|----:----|----:----|----:----|----:----| K L L T P L R Q P E * S L Y A V I V G * K L F R Q C V S R S E L F I R * * S G K * S A N A S A A A R L F S V S S H G R V BsrI Hin6I |GlaI ||HhaI ||| Cac8I ||| |BfiI ||| || DraIII ||| || | BtsI TspEI ||| || | TspRI | BsmAI Hpy166II ||| || | | TspEI | Eco31I SetI | DdeI \\\ \\ \ \ \ \ \ \ \ \ TGGGCGCACGCAGTGTATCAATTTGTAATTACAGAGACCTTTGGCGTTTACTCTAAGATT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCGCGTGCGTCACATAGTTAAACATTAATGTCTCTGGAAACCGCAAATGAGATTCTAA / /// // / / / / / / / | ||| || BtsI TspEI | | SetI | DdeI | ||| |DraIII | Eco31I Hpy166II | ||| Cac8I | BsmAI | ||| TspRI TspEI | ||| BfiI | ||Hin6I | |GlaI | HhaI BsrI W A H A V Y Q F V I T E T F G V Y S K I G R T Q C I N L * L Q R P L A F T L R L G A R S V S I C N Y R D L W R L L * D C ----:----|----:----|----:----|----:----|----:----|----:----| Q A C A T Y * N T I V S V K P T * E L I S P A R L T D I Q L * L S R Q R K S * S P R V C H I L K Y N C L G K A N V R L N MseI |HpaI |HindII |Hpy166II CviJI || MseI Hin4II* |AciI || VspI | Hpy188I CviJI |BisI || |TspEI | |TspEI | MseI ||BlsI \\ \\ \ \\ \ \ \\\ GTTAACTCCATTAATTATTCCTTCCATAAATCTATCAGAATTAGAGCCTTAAAAAAAGCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTGAGGTAATTAATAAGGAAGGTATTTAGATAGTCTTAATCTCGGAATTTTTTTCGG // / / / / / / / /// |MseI | TspEI | | | | MseI ||BisI Hpy166II VspI | | | CviJI |BlsI HindII MseI | | TspEI CviJI HpaI | Hpy188I TauI Hin4II* V N S I N Y S F H K S I R I R A L K K A L T P L I I P S I N L S E L E P * K K P * L H * L F L P * I Y Q N * S L K K S R ----:----|----:----|----:----|----:----|----:----|----:----| T L E M L * E K W L D I L I L A K F F A Q * S W * N N R G Y I * * F * L R L F L N V G N I I G E M F R D S N S G * F F G MseI TauI SetI \ \ GCAAGACAGGTTAAAAAGGAATAG 1030 1040 ----:----|----:----|---- CGTTCTGTCCAATTTTTCCTTATC / / / AciI SetI MseI A R Q V K K E * Q D R L K R N X K T G * K G I X ----:----|----:----|---- A L C T L F S Y R L V P * F P I C S L N F L F L # Enzymes that cut Frequency Isoschizomers AciI 3 BspACI,SsiI AclI 1 Psp1406I AluI 5 AluBI AlwNI 1 CaiI ApoI 1 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BbvI 1 BseXI,BstV1I,Lsp1109I Bce83I* 1 BpuEI BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BsaBI 1 Bse8I,BseJI BseYI 2 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BsrDI 2 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BstAPI 1 BstKTI 6 BtsI 2 Cac8I 1 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CspCI 1 CviAII 2 CviJI 16 CviKI-1 CviRI* 3 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 6 MalI DraIII 1 AdeI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI EcoP15I 1 FalI 2 FatI 2 GlaI 2 GsaI 2 HgaI 1 CseI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 4 HpaI 1 KspAI HphI 1 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 3 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MmeI 1 MnlI 3 MseI 11 Tru1I,Tru9I MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 2 Hin1II,Hsp92II,FaeI RsaI 2 AfaI SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 11 SfaNI 1 LweI SmlI 2 SmoI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 5 TatI 1 TauI 2 TfiI 4 PfeI TseI 1 ApeKI TsoI 3 Tsp45I 2 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 11 TasI,Tsp509I,Sse9I TspRI 4 TscAI VspI 3 PshBI,AseI XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuI* AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI BceAI BcgI BciVI BclI BdaI BetI* BglI BglII BmgT120I BmtI BplI Bpu10I BsaAI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BsgI BslFI BsmFI BsmI Bsp120I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssKI BssNAI Bst1107I Bst2UI BstEII BstF5I BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI CauII* Cfr10I Cfr9I CfrI DinI DraII DrdI Eam1105I EciI Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FauI FnuDII* FokI FseI FspAI GsuI HaeII HaeIII HgiAI* HgiCI* HindIII HpaII Hpy99I KasI KpnI MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MslI MvaI NaeI NarI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TaqII TspGWI TspMI TstI Tth111I XbaI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769