Restriction Map of SLI15/YBR156C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SLI15/YBR156C on chromosome II from coordinates 553200 to 551104.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.27369

EMBOSS_001 BfiI |MwoI || TseI || |BisI BssKI || ||BlsI CviJI || |||AluI EcoRII || |||CviJI | ScrFI || ||||MaeI | BseBI BsrI || |||||SetI BbvI MboII | | CviJI \ \\ \\\\\\ \ \ \ \ \ ATGGACTGGGCAATCAAAGCAGCTAGGAAGAAAACTCAAAGGAAGCCAGGCTCTACCCGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTGACCCGTTAGTTTCGTCGATCCTTCTTTTGAGTTTCCTTCGGTCCGAGATGGGCA / // /// / / / / / / BsrI |BfiI ||| MaeI | MboII | | EcoRII MwoI ||CviJI BbvI | | BssKI ||TseI | | CviJI ||AluI | BseBI |BisI | ScrFI BlsI CviJI SetI M D W A I K A A R K K T Q R K P G S T R W T G Q S K Q L G R K L K G S Q A L P V G L G N Q S S * E E N S K E A R L Y P F ----:----|----:----|----:----|----:----|----:----|----:----| X S Q A I L A A L F F V * L F G P E V R X P S P L * L L * S S F E F S A L S * G H V P C D F C S P L F S L P L W A R G T TaqI | MboI | | DpnI | | |BstKTI | | ||MnlI SfaNI CviRI* Hpy188I \ \ \\\ \ \ \ TCAATCATAGAAACCCTCGATGATCTAAATAATCTAACAACAGATGCACATTCAGAAATA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTAGTATCTTTGGGAGCTACTAGATTTATTAGATTGTTGTCTACGTGTAAGTCTTTAT / //// / / / | |||MboI SfaNI CviRI* Hpy188I | ||MnlI | |DpnI | BstKTI TaqI S I I E T L D D L N N L T T D A H S E I Q S * K P S M I * I I * Q Q M H I Q K * N H R N P R * S K * S N N R C T F R N K ----:----|----:----|----:----|----:----|----:----|----:----| E I M S V R S S R F L R V V S A C E S I N L * L F G R H D L Y D L L L H V N L F * D Y F G E I I * I I * C C I C M * F Y BdaI Csp6I BdaI |RsaI TsoI MseI | Bce83I* SmlI \\ \ \ \ \ \ AATCAACGATTGTACGAAAGTAGTGAATGGTTAAGAAATAATGTTTATATGAATACACTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTTGCTAACATGCTTTCATCACTTACCAATTCTTTATTACAAATATACTTATGTGAG // / / / / || TsoI | | Bce83I* |Csp6I | BdaI RsaI | BdaI MseI N Q R L Y E S S E W L R N N V Y M N T L I N D C T K V V N G * E I M F I * I H S S T I V R K * * M V K K * C L Y E Y T Q ----:----|----:----|----:----|----:----|----:----|----:----| F * R N Y S L L S H N L F L T * I F V S L D V I T R F Y H I T L F Y H K Y S Y V I L S Q V F T T F P * S I I N I H I C E BccI |BdaI |BdaI MseI ||BbvII* |TspEI ||| Ksp632I* ||PleI ||| | MboII |||MlyI ||| | |TspDTI |||MboII TspDTI ||| | || HinfI |||| CviJI \ \\\ \ \\ \ \\\\ \ AAGTATGAAGACAAAAAGATGGAAGAGTCTTTAATTAGCCCCGAAAATACGCATAACAAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATACTTCTGTTTTTCTACCTTCTCAGAAATTAATCGGGGCTTTTATGCGTATTGTTT / / / / / / // / / TspDTI | BccI | | | || | CviJI SmlI BdaI | | | || TspEI BdaI | | | |PleI | | | |MlyI | | | MboII | | | MseI | | HinfI | Ksp632I* TspDTI BbvII* MboII K Y E D K K M E E S L I S P E N T H N K S M K T K R W K S L * L A P K I R I T K V * R Q K D G R V F N * P R K Y A * Q N ----:----|----:----|----:----|----:----|----:----|----:----| L Y S S L F I S S D K I L G S F V C L L * T H L C F S P L T K L * G R F Y A Y C L I F V F L H F L R * N A G F I R M V F TaqI |BseGI ||ApoI SfaNI ||TspEI FokI TspDTI | TspDTI \\\ \ \ \ \ ATGGATGTCGAATTTCCTAAAATGAAAGGAGAATATGAACTTTCTAACTCCCAGAATGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTACAGCTTAAAGGATTTTACTTTCCTCTTATACTTGAAAGATTGAGGGTCTTACTA / / / / / / / | | TspEI FokI TspDTI | SfaNI | | ApoI TspDTI | TaqI BseGI M D V E F P K M K G E Y E L S N S Q N D W M S N F L K * K E N M N F L T P R M M G C R I S * N E R R I * T F * L P E * C ----:----|----:----|----:----|----:----|----:----|----:----| I S T S N G L I F P S Y S S E L E W F S F P H R I E * F S L L I H V K * S G S H H I D F K R F H F S F I F K R V G L I I MaeII AciI |MaeIII BisI || SetI |BlsI || TaiI ||TauI || | DdeI BsiYI* TaqII \\\ \\ \ \ \ \ GCCGCAAAAGACGTTACTAAGACACCCAGAAATGGATTACATAACGATAAAAGTATCACG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCGTTTTCTGCAATGATTCTGTGGGTCTTTACCTAATGTATTGCTATTTTCATAGTGC //// / / / / / / |||AciI | | | DdeI BsiYI* TaqII ||BisI | | MaeIII |BlsI | MaeII TauI TaiI SetI A A K D V T K T P R N G L H N D K S I T P Q K T L L R H P E M D Y I T I K V S R R K R R Y * D T Q K W I T * R * K Y H A ----:----|----:----|----:----|----:----|----:----|----:----| A A F S T V L V G L F P N C L S L L I V H R L L R * * S V W F H I V Y R Y F Y * G C F V N S L C G S I S * M V I F T D R AciI AccI Hin4II* |BssNAI | HphI |TspDTI | BsiYI* |Hpy166II | | MaeIII || FatI | | Tsp45I || |CviAII | | |Hin4II* || || NlaIII \ \ \\ \\ \\ \ CCTAAATCACTCCGCAGGAAGGAAGTCACCGAAGGAATGAATAGATTTAGTATACATGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTTAGTGAGGCGTCCTTCCTTCAGTGGCTTCCTTACTTATCTAAATCATATGTACTA / // / / / / /// // | || HphI | Tsp45I | ||| |FatI | |BsiYI* | MaeIII | ||| CviAII | AciI Hin4II* | ||NlaIII Hin4II* | |AccI | Hpy166II | BssNAI TspDTI P K S L R R K E V T E G M N R F S I H D L N H S A G R K S P K E * I D L V Y M I * I T P Q E G S H R R N E * I * Y T * Y ----:----|----:----|----:----|----:----|----:----|----:----| G L D S R L F S T V S P I F L N L I C S A * I V G C S P L * R L F S Y I * Y V H R F * E A P L F D G F S H I S K T Y M I SalI |TaqI |AccI BssKI ||HindII CviJI ||Hpy166II | HpaII ||| AcyI | ScrFI ||| | Hpy99I | CauII* CviJI MseI ||| | | HgaI HphI \ \ \ \ \\\ \ \ \ \ ACCAATAAAAGCCCGGTTGAGCCATTGAATAGCGTTAAAGTCGACGCCAATGAAAGCGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTATTTTCGGGCCAACTCGGTAACTTATCGCAATTTCAGCTGCGGTTACTTTCGCTT / /// / / //// / // | ||| CviJI | |||| AcyI |HphI | ||BssKI | |||SalI HgaI | |HpaII | ||AccI | CauII* | ||TaqI | ScrFI | |Hpy166II CviJI | |HindII | Hpy99I MseI T N K S P V E P L N S V K V D A N E S E P I K A R L S H * I A L K S T P M K A K Q * K P G * A I E * R * S R R Q * K R K ----:----|----:----|----:----|----:----|----:----|----:----| V L L L G T S G N F L T L T S A L S L S Y W Y F G P Q A M S Y R * L R R W H F R G I F A R N L W Q I A N F D V G I F A F TspDTI | HphI | | FatI | | NcoI | | StyI | | SecI* | | DsaI* | | |CviAII | | |BsiYI* | | || MaeIII | | || Tsp45I | | || BstEII XmnI | | || NlaIII | SetI TfiI | | || |MnlI SetI | | DdeI HinfI MnlI \ \ \\ \\ \ \ \ \ \ \ AAATCCTCACCATGGTCACCTTACAAAGTTGAAAAGGTTCTAAGAGAATCCTCCAAGACT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGGAGTGGTACCAGTGGAATGTTTCAACTTTTCCAAGATTCTCTTAGGAGGTTCTGA / // / // / / // / / / | || | || | BstEII |XmnI DdeI HinfI MnlI | || | || | Tsp45I SetI TfiI | || | || | MaeIII | || | || SetI | || | |DsaI* | || | |SecI* | || | |MnlI | || | |StyI | || | |NcoI | || | |FatI | || | CviAII | || NlaIII | |BsiYI* | HphI TspDTI K S S P W S P Y K V E K V L R E S S K T N P H H G H L T K L K R F * E N P P R L I L T M V T L Q S * K G S K R I L Q D F ----:----|----:----|----:----|----:----|----:----|----:----| F D E G H D G * L T S F T R L S D E L V F I R V M T V K C L Q F P E L L I R W S F G * W P * R V F N F L N * S F G G L S FatI |CviAII || NlaIII || | AciI BsmAI || | |BisI Hpy188I || | ||BlsI |PleI || | |||TauI DrdI ||MlyI || | |||CviJI Hpy188I |||MseI || | ||||DdeI |HinfI |||VspI TaqI || | ||||Bpu10I \\ \\\\ \ \\ \ \\\\\ TCGGAGTCTCCGATTAATACAAAACGCTTCGATAATCAAACATGGGCGGCTAAGGAAGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCTCAGAGGCTAATTATGTTTTGCGAAGCTATTAGTTTGTACCCGCCGATTCCTTCTT // / / / // / / // //// / || | | | |VspI TaqI | || |||| Bpu10I || | | | |MseI | || |||| DdeI || | | | BsmAI | || |||CviJI || | | PleI | || ||BisI || | | MlyI | || ||AciI || | Hpy188I | || |BlsI || HinfI | || TauI |Hpy188I | |FatI DrdI | CviAII NlaIII S E S P I N T K R F D N Q T W A A K E E R S L R L I Q N A S I I K H G R L R K K G V S D * Y K T L R * S N M G G * G R N ----:----|----:----|----:----|----:----|----:----|----:----| E S D G I L V F R K S L * V H A A L S S K P T E S * Y L V S R Y D F M P P * P L R L R R N I C F A E I I L C P R S L F F TspDTI HindIII | AluI AluI | CviJI CviJI | | SetI | SetI | | |MseI | |TfiI MboII SetI | | ||AhaIII* | |HinfI SetI \ \ \ \ \\\ \ \\ \ ATGGAGAATGAACCTATACTTCAAGCTTTAAAGAAAGCTGAATCAGTAAAGGTGAAACCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTCTTACTTGGATATGAAGTTCGAAATTTCTTTCGACTTAGTCATTTCCACTTTGGT / / / / / / // / / / / | SetI | | | | |MseI | CviJI HinfI SetI MboII | | | | | | AluI TfiI | | | | | SetI | | | | AhaIII* | | | HindIII | | CviJI | | AluI | SetI TspDTI M E N E P I L Q A L K K A E S V K V K P W R M N L Y F K L * R K L N Q * R * N H G E * T Y T S S F K E S * I S K G E T T ----:----|----:----|----:----|----:----|----:----|----:----| I S F S G I S * A K F F A S D T F T F G F P S H V * V E L K L S L Q I L L P S V H L I F R Y K L S * L F S F * Y L H F W MboI HphI BglII | ApoI XhoII BtsI | TspEI | DpnI | FalI | EcoRI | |BstKTI TaqI | FalI | | BsiYI* | ||Hin4II* SetI | | TspRI \ \ \ \ \\\ \ \ \ \ CCACCGAATTCTGGGATAGCGAGATCTCAAAGAAGGTCGAATATGTTTGTTCCACTGCCG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGGCTTAAGACCCTATCGCTCTAGAGTTTCTTCCAGCTTATACAAACAAGGTGACGGC / / / //// / / // HphI | EcoRI |||XhoII SetI TaqI |FalI | TspEI |||BglII |FalI | ApoI |||MboI TspRI BsiYI* ||Hin4II* BtsI |DpnI BstKTI P P N S G I A R S Q R R S N M F V P L P H R I L G * R D L K E G R I C L F H C R T E F W D S E I S K K V E Y V C S T A E ----:----|----:----|----:----|----:----|----:----|----:----| G G F E P I A L D * L L D F I N T G S G V V S N Q S L S I E F F T S Y T Q E V A W R I R P Y R S R L S P R I H K N W Q R AjuI Hpy178III* BinI* |FalI | MboI | MboI |FalI | | DpnI | XhoII ||Eco57I | | |BstKTI | | DpnI ||Eco57MI | | || BinI* | | |BstKTI MnlI ||| MboII | | || | AjuI \ \ \\ \ \\\ \ \ \ \\ \ \ AATAAAGATCCTCTTATTATTCAACACATTCCACCAACAAAATCTTCAGGATCAATACCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTCTAGGAGAATAATAAGTTGTGTAAGGTGGTTGTTTTAGAAGTCCTAGTTATGGT / // / / // / / /// // / | || XhoII | || | MboII ||| || BinI* | || MboI | || Eco57MI ||| |AjuI | |DpnI | || Eco57I ||| MboI | BstKTI | |FalI ||DpnI BinI* | |FalI |BstKTI | AjuI Hpy178III* MnlI N K D P L I I Q H I P P T K S S G S I P I K I L L L F N T F H Q Q N L Q D Q Y Q * R S S Y Y S T H S T N K I F R I N T K ----:----|----:----|----:----|----:----|----:----|----:----| F L S G R I I * C M G G V F D E P D I G S Y L D E * * E V C E V L L I K L I L V I F I R K N N L V N W W C F R * S * Y W MseI Tsp4CI* |AhaIII* Csp6I | TfiI || Hin4I |RsaI | HphI HinfI || Hin4I \\ \ \ \ \\ \ AAAGTACGAACAGTAAAGGAATCACCAATCGCATTTAAAAAAAAATCTACGATAAATAGT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCATGCTTGTCATTTCCTTAGTGGTTAGCGTAAATTTTTTTTTAGATGCTATTTATCA // / / / // || | HphI HinfI |Hin4I || Tsp4CI* TfiI |Hin4I |Csp6I |MseI RsaI AhaIII* K V R T V K E S P I A F K K K S T I N S K Y E Q * R N H Q S H L K K N L R * I V S T N S K G I T N R I * K K I Y D K * S ----:----|----:----|----:----|----:----|----:----|----:----| F T R V T F S D G I A N L F F D V I F L L L V F L L P I V L R M * F F I * S L Y F Y S C Y L F * W D C K F F F R R Y I T Tsp4CI* | FauI | | TspRI | | | AciI | | | SecI* | | | DsaI* | | | | AciI | | | | FnuDII* | | | | NspBII* | | | | |SacII | | | | ||FokI | | | | |||MboI | | | | |||XhoII | | | | |||| DpnI | | | | |||| |BstKTI | | | | |||| || BinI* MwoI | | | | |||| || | BseGI | AluI | | | | |||| || | | BsrI | CviJI | | | | |||| || | | | Hin4I | |Hin4I | | | | |||| || | | | Hin4I | |Hin4I | | | | |||| || | | | | SfaNI | ||SetI | | | | |||| || | | | | | TspRI \ \\\ \ \ \ \ \\\\ \\ \ \ \ \ \ \ CCTGCTATAAGAGCTGTGGAAAACAGTGATACCGCGGGATCTACAAAAGCATCCAGTGTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGATATTCTCGACACCTTTTGTCACTATGGCGCCCTAGATGTTTTCGTAGGTCACAA / / / / / / / // / //// // // | | | CviJI | | | || | |||| || |TspRI | | | AluI | | | || | |||| || |BsrI | | SetI | | | || | |||| || Hin4I | Hin4I | | | || | |||| || Hin4I | Hin4I | | | || | |||| |BseGI MwoI | | | || | |||| BinI* | | | || | |||XhoII | | | || | |||MboI | | | || | ||FokI | | | || | |DpnI | | | || | BstKTI | | | || DsaI* | | | || SecI* | | | || AciI | | | |NspBII* | | | |FnuDII* | | | |AciI | | | SacII | | FauI | Tsp4CI* TspRI P A I R A V E N S D T A G S T K A S S V L L * E L W K T V I P R D L Q K H P V F C Y K S C G K Q * Y R G I Y K S I Q C F ----:----|----:----|----:----|----:----|----:----|----:----| G A I L A T S F L S V A P D V F A D L T D Q * L L Q P F C H Y R P I * L L M W H R S Y S S H F V T I G R S R C F C G T N TstI ApoI BsaXI Hin4I TspEI SecI* |AclI TaqI CviJI Hin4I | MmeI DsaI* |MaeII \ \ \ \ \ \ \\ TTCGATAGGCTATCATCTATTCCAACAAAATCATTTGAAAACAAAATTTCCCGTGGAAAC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTATCCGATAGTAGATAAGGTTGTTTTAGTAAACTTTTGTTTTAAAGGGCACCTTTG / / / / / / / / / | TaqI CviJI Hin4I | | | | TaiI SfaNI Hin4I | | | | SetI | | | DsaI* | | | SecI* | | | BsaXI | | TstI | TspEI | ApoI MmeI F D R L S S I P T K S F E N K I S R G N S I G Y H L F Q Q N H L K T K F P V E T R * A I I Y S N K I I * K Q N F P W K R ----:----|----:----|----:----|----:----|----:----|----:----| K S L S D D I G V F D N S F L I E R P F K R Y A I M * E L L I M Q F C F K G H F E I P * * R N W C F * K F V F N G T S V SetI Ksp632I* TaiI | MnlI | MaeIII | |BsaXI CviJI | Tsp45I | ||TaqI |NlaIV | | BseRI | ||ClaI || FatI | | | MboII | |||TstI || |CviAII | | | TspDTI | |||| MseI || || NlaIII \ \ \ \ \ \\\\ \ \\ \\ \ GTTGGTCACAAATACTCCTCTTCATCAATCGATTTAACAGGCTCCCCCATGAAAAAAGTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAACCAGTGTTTATGAGGAGAAGTAGTTAGCTAAATTGTCCGAGGGGGTACTTTTTTCAA / / // /// / / // / // | | |MboII ||| ClaI MseI || | |FatI | | Tsp45I ||| TaqI || | CviAII | | MaeIII ||Ksp632I* || NlaIII | | TspDTI |MnlI |NlaIV | BseRI BsaXI CviJI MaeII TstI AclI V G H K Y S S S S I D L T G S P M K K V L V T N T P L H Q S I * Q A P P * K K F W S Q I L L F I N R F N R L P H E K S F ----:----|----:----|----:----|----:----|----:----|----:----| T P * L Y E E E D I S K V P E G M F F T R Q D C I S R K M L R N L L S G W S F L N T V F V G R * * D I * C A G G H F F N CviRI* BciVI |TspGWI | SecI* || Hin4I TspDTI MseI | DsaI* || | MseI \ \ \ \ \\ \ \ TCTCAAAAGTTTAAGTCAATAAACTCCACGGATACTGATATGCAAGAAGCGTTAAGAGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTTTTCAAATTCAGTTATTTGAGGTGCCTATGACTATACGTTCTTCGCAATTCTCTA / / / / // / / TspDTI MseI BciVI DsaI* || Hin4I MseI SecI* |CviRI* TspGWI S Q K F K S I N S T D T D M Q E A L R D L K S L S Q * T P R I L I C K K R * E I S K V * V N K L H G Y * Y A R S V K R Y ----:----|----:----|----:----|----:----|----:----|----:----| E * F N L D I F E V S V S I C S A N L S K E F T * T L L S W P Y Q Y A L L T L L R L L K L * Y V G R I S I H L F R * S I BspCNI TaqII |BseMII HphI | Hpy178III* DdeI ||Hin4I | TspEI TsoI | |TaqI \ \\\ \ \ \ \ \\ ATATTCTCAGTAAAAAATAAAATAACCAAAAATAATTCACCCAAAGGAAAAAACTCTCGA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TATAAGAGTCATTTTTTATTTTATTGGTTTTTATTAAGTGGGTTTCCTTTTTTGAGAGCT / /// / / / // DdeI ||BseMII HphI TspEI TaqII |TaqI |BspCNI TsoI Hpy178III* Hin4I I F S V K N K I T K N N S P K G K N S R Y S Q * K I K * P K I I H P K E K T L E I L S K K * N N Q K * F T Q R K K L S K ----:----|----:----|----:----|----:----|----:----|----:----| I N E T F F L I V L F L E G L P F F E R Y I R L L F Y F L W F Y N V W L F F S E Y E * Y F I F Y G F I I * G F S F V R S NheI AluI SecI* CviJI |Hpy188I AluI |MaeI ||MnlI CviJI ||SetI MnlI ||| SetI | SetI ||Cac8I \ \\\ \ \ \ \\\ AAATCCTCTATTCCGAGGTTTGATAAGACTTCTTTGAAGCTAACGACACACAAAAAGCTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGGAGATAAGGCTCCAAACTATTCTGAAGAAACTTCGATTGCTGTGTGTTTTTCGAT / /// / / / / / // MnlI ||| SecI* | CviJI | | |MaeI ||SetI | AluI | | Cac8I |MnlI SetI | CviJI Hpy188I | AluI | BmtI SetI K S S I P R F D K T S L K L T T H K K L N P L F R G L I R L L * S * R H T K S * I L Y S E V * * D F F E A N D T Q K A S ----:----|----:----|----:----|----:----|----:----|----:----| F D E I G L N S L V E K F S V V C L F S F I R * E S T Q Y S K K S A L S V C F A F G R N R P K I L S R Q L * R C V F L * BmtI | BsrDI TspDTI | | MwoI |MaeI | | BstAPI |OliI | | | CviRI* |MslI BsrI \ \ \ \ \\ \ GCAATCATTGCAGAACAGAAAAAGAAGTCCAAACACTCTAGTGATGTTCATAAAACTGGT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTAGTAACGTCTTGTCTTTTTCTTCAGGTTTGTGAGATCACTACAAGTATTTTGACCA / // / / / / / | || CviRI* | | MaeI BsrI | |BstAPI | MslI | |MwoI | OliI | BsrDI TspDTI NheI A I I A E Q K K K S K H S S D V H K T G Q S L Q N R K R S P N T L V M F I K L V N H C R T E K E V Q T L * * C S * N W F ----:----|----:----|----:----|----:----|----:----|----:----| A I M A S C F F F D L C E L S T * L V P L L * Q L V S F S T W V S * H H E Y F Q C D N C F L F L L G F V R T I N M F S T MmeI |AluI TaqI |CviJI Hpy178III* | TfiI || SetI | AciI Tsp4CI* Hin4I | HinfI || Cac8I BccI \ \ \ \ \ \ \\ \ \ TCAAGACCGCACAGTATTTCTCCAACAAAAATAAGTGTCGATTCAAGCTCGCCATCTAAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCTGGCGTGTCATAAAGAGGTTGTTTTTATTCACAGCTAAGTTCGAGCGGTAGATTT / / / / / /// / / / | | Tsp4CI* Hin4I | ||| | Cac8I Hin4I | AciI | ||| CviJI Hpy178III* | ||| AluI | ||SetI | |MmeI | HinfI | TfiI TaqI S R P H S I S P T K I S V D S S S P S K Q D R T V F L Q Q K * V S I Q A R H L K K T A Q Y F S N K N K C R F K L A I * R ----:----|----:----|----:----|----:----|----:----|----:----| E L G C L I E G V F I L T S E L E G D L N L V A C Y K E L L F L H R N L S A M * * S R V T N R W C F Y T D I * A R W R F CviJI | MnlI | | EcoNI | | | BsiYI* Hin4I | | | | SetI | MseI | | | | BsmAI | | TspEI | | | | Eco31I HgaI \ \ \ \ \ \ \ \ \ GAAGTTAAAAATTATTACCAAAGCCCTGTAAGAGGTTATTTGAGACCAACAAAAGCGTCT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAATTTTTAATAATGGTTTCGGGACATTCTCCAATAAACTCTGGTTGTTTTCGCAGA / / / // / / / / / BccI MseI TspEI || | | SetI Eco31I HgaI || | EcoNI BsmAI || BsiYI* |MnlI CviJI E V K N Y Y Q S P V R G Y L R P T K A S K L K I I T K A L * E V I * D Q Q K R L S * K L L P K P C K R L F E T N K S V Y ----:----|----:----|----:----|----:----|----:----|----:----| S T L F * * W L G T L P * K L G V F A D L L * F N N G F G Q L L N N S V L L L T F N F I I V L A R Y S T I Q S W C F R R MaeII |CspCI ApoI || SetI TspEI || TaiI TspEI | MseI || | Hpy99I | MseI \ \ \\ \ \ \ \ ATTTCGCCTAATAAAAATAAAAATTTAACAACGTCGCAAACGCCACATCGTTTGAAAATT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGCGGATTATTTTTATTTTTAAATTGTTGCAGCGTTTGCGGTGTAGCAAACTTTTAA / / // / / | | || MaeII TspEI | | |Hpy99I | | CspCI | | TaiI | | SetI | MseI TspEI ApoI I S P N K N K N L T T S Q T P H R L K I F R L I K I K I * Q R R K R H I V * K L F A * * K * K F N N V A N A T S F E N * ----:----|----:----|----:----|----:----|----:----|----:----| I E G L L F L F K V V D C V G C R K F I * K A * Y F Y F N L L T A F A V D N S F N R R I F I F I * C R R L R W M T Q F N Hpy188I CviJI CspCI MseI XmnI | SspI | HinfI \ \ \ \ \ \ \ AAAGAGAAAACATTAAGAAAACTTTCTCCGAATATTGCTGACATCTCCAAGCCAGAGTCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTCTTTTGTAATTCTTTTGAAAGAGGCTTATAACGACTGTAGAGGTTCGGTCTCAGA / / / / / / / / | CspCI MseI XmnI | SspI CviJI HinfI MseI Hpy188I K E K T L R K L S P N I A D I S K P E S K R K H * E N F L R I L L T S P S Q S L R E N I K K T F S E Y C * H L Q A R V S ----:----|----:----|----:----|----:----|----:----|----:----| L S F V N L F S E G F I A S M E L G S D * L S F M L F V K E S Y Q Q C R W A L T F L F C * S F K R R I N S V D G L W L R BsmAI |PleI SetI Hin4II* ||MlyI TspEI CviJI | TspEI | MnlI \\\ \ \ \ \ \ \ CGTAAATCCAAAAATTATCGGCTTACAAACCTTCAATTACTTCCACCAGCAGAGGCAGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GCATTTAGGTTTTTAATAGCCGAATGTTTGGAAGTTAATGAAGGTGGTCGTCTCCGTCTT / / / / / // / | BsmAI | CviJI SetI || MnlI PleI TspEI |Hin4II* MlyI TspEI R K S K N Y R L T N L Q L L P P A E A E V N P K I I G L Q T F N Y F H Q Q R Q N * I Q K L S A Y K P S I T S T S R G R T ----:----|----:----|----:----|----:----|----:----|----:----| R L D L F * R S V F R * N S G G A S A S E Y I W F N D A * L G E I V E V L L P L T F G F I I P K C V K L * K W W C L C F SetI | Hpy178III* SetI | | MnlI | BsmAI MseI EcoP15I | | TspEI | Eco31I \ \ \ \ \ \ \ CGAGATGACTTAAAAAAAAAGTTTGATAAAAGGTTATCAGGAATTATGAGGTCTCAACAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCTACTGAATTTTTTTTTCAAACTATTTTCCAATAGTCCTTAATACTCCAGAGTTGTC / / / / / / / MseI EcoP15I SetI | | SetI Eco31I | TspEI BsmAI Hpy178III* MnlI R D D L K K K F D K R L S G I M R S Q Q E M T * K K S L I K G Y Q E L * G L N R R * L K K K V * * K V I R N Y E V S T G ----:----|----:----|----:----|----:----|----:----|----:----| R S S K F F F N S L L N D P I I L D * C V L H S L F F T Q Y F T I L F * S T E V S I V * F F L K I F P * * S N H P R L L MboI BglII XhoII | DpnI Hpy166II BseGI FokI | |BstKTI \ \ \ \ \\ GAACATCATCGGCGTAAACAAGAGAAACAAAAAAGGATGTCGCATTTGGAACAAGATCTA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTAGTAGCCGCATTTGTTCTCTTTGTTTTTTCCTACAGCGTAAACCTTGTTCTAGAT / / / // / Hpy166II BseGI | || XhoII | || BglII | || MboI | |DpnI | BstKTI FokI E H H R R K Q E K Q K R M S H L E Q D L N I I G V N K R N K K G C R I W N K I * T S S A * T R E T K K D V A F G T R S K ----:----|----:----|----:----|----:----|----:----|----:----| S C * R R L C S F C F L I D C K S C S R P V D D A Y V L S V F F S T A N P V L D F M M P T F L L F L F P H R M Q F L I * HindIII PshAI | AluI |MaeII | CviJI || SetI TfiI CviJI | | SetI || TaiI HinfI |NlaIV \ \ \ \\ \ \ \\ AAAAAGCAAACAAGCTTTAGTAATGACTACAAGGACATACGTCTAAAAGAATCTTTGGCT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCGTTTGTTCGAAATCATTACTGATGTTCCTGTATGCAGATTTTCTTAGAAACCGA / / / / / / // | | HindIII | MaeII HinfI |NlaIV | CviJI PshAI TfiI CviJI | AluI TaiI SetI SetI K K Q T S F S N D Y K D I R L K E S L A K S K Q A L V M T T R T Y V * K N L W L K A N K L * * * L Q G H T S K R I F G S ----:----|----:----|----:----|----:----|----:----|----:----| F F C V L K L L S * L S M R R F S D K A L F A F L S * Y H S C P C V D L L I K P F L L C A K T I V V L V Y T * F F R Q S Hin4I |FatI ||CviAII Hin4I Csp6I TaqI ||| NlaIII BccI CviRI* |RsaI \ \\\ \ \ \ \\ CCTTTCGATAATCATGTGCGAGATACCATCAACAAAAATACTGCATTTAGTACCGACAAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAAGCTATTAGTACACGCTCTATGGTAGTTGTTTTTATGACGTAAATCATGGCTGTTA // / // / / / // |TaqI | |FatI | | CviRI* |Csp6I Hin4I | CviAII | Hin4I RsaI NlaIII BccI P F D N H V R D T I N K N T A F S T D N L S I I M C E I P S T K I L H L V P T I F R * S C A R Y H Q Q K Y C I * Y R Q Y ----:----|----:----|----:----|----:----|----:----|----:----| G K S L * T R S V M L L F V A N L V S L E K R Y D H A L Y W * C F Y Q M * Y R C R E I I M H S I G D V F I S C K T G V I Tsp4CI* | Hin4I | |HindII CfrI | |Hpy166II | BalI | || TaqI Hpy188I | CviJI | || |Hpy178III* | MaeIII | HaeIII | || || BccI | Tsp45I Hin4I \ \ \ \\ \\ \ \ \ \ ATATTGGCCACAATAAATACAGTTGACCATCGAGAAATAATCGGAAATGTGACCCCAAAG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TATAACCGGTGTTATTTATGTCAACTGGTAGCTCTTTATTAGCCTTTACACTGGGGTTTC / / / / / // / / / / | CfrI | | | || BccI Hpy188I | Tsp45I HaeIII | | | |Hpy178III* | MaeIII CviJI | | | TaqI Hin4I BalI | | Hpy166II | | HindII | Tsp4CI* Hin4I I L A T I N T V D H R E I I G N V T P K Y W P Q * I Q L T I E K * S E M * P Q R I G H N K Y S * P S R N N R K C D P K D ----:----|----:----|----:----|----:----|----:----|----:----| I N A V I F V T S W R S I I P F T V G F Y I P W L L Y L Q G D L F L R F H S G L Y Q G C Y I C N V M S F Y D S I H G W L NheI CviJI |MaeI TfiI ||Cac8I MnlI HinfI |||MboII |TfiI | MnlI ||||BmtI CviJI |HinfI | Hpy188I |||||MaeIII \ \\ \ \ \\\\\\ ATAGCCTCTGTCAATGATTCTTTACCAGAGATAAATACTGATTCTGAAGATGAGGCTAGC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TATCGGAGACAGTTACTAAGAAATGGTCTCTATTTATGACTAAGACTTCTACTCCGATCG / / / // / /// CviJI MnlI HinfI |Hpy188I | ||NheI TfiI |MnlI | |MaeI HinfI | MboII TfiI | Cac8I CviJI BmtI I A S V N D S L P E I N T D S E D E A S * P L S M I L Y Q R * I L I L K M R L A S L C Q * F F T R D K Y * F * R * G * R ----:----|----:----|----:----|----:----|----:----|----:----| I A E T L S E K G S I F V S E S S S A L S L R Q * H N K V L S L Y Q N Q L H P * Y G R D I I R * W L Y I S I R F I L S A Eco57I Eco57MI | AciI | |BisI | ||BlsI | |||FatI | |||TauI | ||||CviAII | ||||| MwoI | ||||| |NlaIII MfeI | ||||| || CviJI CviRI* TspEI \ \\\\\ \\ \ \ \ GTAACTTTAGCGGCATGGGCTAAATCCCCGTATTTGCAAGAGCAATTGATAAGACAGCAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CATTGAAATCGCCGTACCCGATTTAGGGGCATAAACGTTCTCGTTAACTATTCTGTCGTT / / //// // / / / | | |||| || CviJI CviRI* TspEI | | |||| |FatI MfeI | | |||| CviAII | | |||NlaIII | | |||MwoI | | ||BisI | | ||AciI | | |BlsI | | TauI | MaeIII Eco57MI Eco57I V T L A A W A K S P Y L Q E Q L I R Q Q * L * R H G L N P R I C K S N * * D S K N F S G M G * I P V F A R A I D K T A R ----:----|----:----|----:----|----:----|----:----|----:----| T V K A A H A L D G Y K C S C N I L C C R L K L P M P * I G T N A L A I S L V A Y S * R C P S F G R I Q L L L Q Y S L L EciI | AsuI* | AvaII | |BmgT120I | || TspEI CviRI* ApoI BsaBI | || | AciI | MslI TspEI \ \ \\ \ \ \ \ \ GATATAAATCCACAAACTATCTTTGGACCAATTCCGCCTTTGCACACCGATGAAATTTTC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTATATTTAGGTGTTTGATAGAAACCTGGTTAAGGCGGAAACGTGTGGCTACTTTAAAAG / / // / / / / / BsaBI EciI || | AciI | MslI TspEI || TspEI CviRI* ApoI |AvaII |AsuI* BmgT120I D I N P Q T I F G P I P P L H T D E I F I * I H K L S L D Q F R L C T P M K F S Y K S T N Y L W T N S A F A H R * N F P ----:----|----:----|----:----|----:----|----:----|----:----| S I F G C V I K P G I G G K C V S S I K L Y L D V F * R Q V L E A K A C R H F K I Y I W L S D K S W N R R Q V G I F N E TspDTI | StyI | AvrII | SecI* AciI | |MaeI HgaI | FnuDII* SduI SetI | || CviJI | SetI | | TspEI BseSI |Hpy178III* \ \\ \ \ \ \ \ \ \ \\ CCAAATCCTAGGCTAAACAGGTTGAAACCGCGTCAAATTGTGCCCAAAAGGTCTTGA 2050 2060 2070 2080 2090 ----:----|----:----|----:----|----:----|----:----|----:-- GGTTTAGGATCCGATTTGTCCAACTTTGGCGCAGTTTAACACGGGTTTTCCAGAACT / /// / / / // / / TspDTI ||CviJI SetI HgaI FnuDII* |BseSI SetI Hpy178III* |SecI* AciI |SduI |AvrII TspEI |StyI MaeI P N P R L N R L K P R Q I V P K R S * Q I L G * T G * N R V K L C P K G L X K S * A K Q V E T A S N C A Q K V L X ----:----|----:----|----:----|----:----|----:----|----:-- G F G L S F L N F G R * I T G L L D Q G L D * A L C T S V A D F Q A W F T K W I R P * V P Q F R T L N H G F P R S # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 9 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 2 DraI AjuI 1 AluI 8 AluBI ApoI 5 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 1 BpuEI BciVI 1 BfuI BdaI 2 BfiI 1 BmrI,BmuI BglII 2 BinI* 3 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 1 BmtI 2 BspOI Bpu10I 1 BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BsmAI 4 Alw26I,BstMAI BspCNI 1 BsrDI 1 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 6 BtsI 1 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 6 CviJI 25 CviKI-1 CviRI* 6 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 6 MalI DrdI 1 AasI,DseDI DsaI* 4 BtgI,BstDSI EciI 1 Eco31I 2 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 2 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI FalI 2 FatI 6 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI Hin4I 8 Hin4II* 4 HpyAV HindII 2 HincII HindIII 2 HinfI 10 HpaII 1 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 7 Hpy99I 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 6 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 1 MunI MlyI 3 SchI MmeI 2 MnlI 12 MseI 14 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NcoI 1 Bsp19I NheI 2 AsuNHI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I OliI 1 AleI PleI 3 PpsI PshAI 1 BstPAI,BoxI RsaI 3 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SalI 1 ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 24 SfaNI 3 LweI SmlI 1 SmoI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 11 TaqII 2 TauI 3 TfiI 7 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 4 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 11 TspEI 15 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI TstI 1 VspI 1 PshBI,AseI XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AflII AflIII AgeI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI BaeI BamHI BarI BbvCI BceAI BcgI BclI BetI* BglI BmeT110I BplI BsaAI BsePI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BsrBI BstXI BtgZI BtrI Cfr10I Cfr9I DinI DraII DraIII Eam1105I Ecl136II Eco47III EcoICRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FseI FspAI GlaI GsaI GsuI HaeII HgiAI* HgiCI* HgiJII* HhaI Hin6I HinP1I HpaI HspAI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NmeAIII NotI NruI NsiI NspI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SanDI SapI SauI* ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769