Restriction Map of TPS1/YBR126C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

TPS1/YBR126C on chromosome II from coordinates 490392 to 488905.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 DdeI Bpu10I | Hin6I | TspGWI | |GlaI | |Eco57I | |Eco57MI | || MboII | || BbvII* | || | Tth111I MnlI | ||HhaI | |SetI | MaeIII MslI \ \\\ \ \\ \ \ \ ATGACTACGGATAACGCTAAGGCGCAACTGACCTCGTCTTCAGGGGGTAACATTATTGTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGATGCCTATTGCGATTCCGCGTTGACTGGAGCAGAAGTCCCCCATTGTAATAACAC ///// / / // / / / ||||| | | || MnlI | MslI ||||| | | |Tth111I MaeIII ||||| | | BbvII* ||||| | SetI ||||| MboII ||||Hin6I |||GlaI ||HhaI |Eco57MI |Eco57I TspGWI Bpu10I DdeI M T T D N A K A Q L T S S S G G N I I V * L R I T L R R N * P R L Q G V T L L W D Y G * R * G A T D L V F R G * H Y C G ----:----|----:----|----:----|----:----|----:----|----:----| X V V S L A L A C S V E D E P P L M I T X S * P Y R * P A V S R T K L P Y C * Q H S R I V S L R L Q G R R * P T V N N H Tsp4CI* | Csp6I MaeIII Csp6I |Csp6I |RsaI CviJI Tsp45I MmeI |RsaI ||RsaI ||BslFI \ \ \ \\ \\\ \\\ GTGTCCAACAGGCTTCCCGTGACAATCACTAAAAACAGCAGTACGGGACAGTACGAGTAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CACAGGTTGTCCGAAGGGCACTGTTAGTGATTTTTGTCGTCATGCCCTGTCATGCTCATG / / / // / // /// CviJI | MmeI |Csp6I | || ||Hin4I Tsp45I RsaI | || |Csp6I MaeIII | || RsaI | |Csp6I | RsaI Tsp4CI* V S N R L P V T I T K N S S T G Q Y E Y C P T G F P * Q S L K T A V R D S T S T V Q Q A S R D N H * K Q Q Y G T V R V R ----:----|----:----|----:----|----:----|----:----|----:----| T D L L S G T V I V L F L L V P C Y S Y P T W C A E R S L * * F C C Y P V T R T H G V P K G H C D S F V A T R S L V L V Hin4I BsaXI |EcoP15I ||MnlI |||BsrDI MaeII |||| BetI* | Csp6I |||| BspMII* | |RsaI |||| |MmeI | |SetI |||| |HpaII Hin4II* | |TaiI |||| |Hpy178III* | BarI | |BbvII* |||| || CviJI | |BsaXI | ||Hpy166II |||| || | MaeIII | || Hin4I | |||MboII |||| || | Tsp45I | || | BceAI | |||| MboII \\\\ \\ \ \ \ \\ \ \ \ \\\\ \ GCAATGTCGTCCGGAGGGCTGGTCACGGCGTTGGAAGGGTTGAAGAAGACGTACACTTTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTACAGCAGGCCTCCCGACCAGTGCCGCAACCTTCCCAACTTCTTCTGCATGTGAAAG // / // // / // / / / / /// / || | || || CviJI || | BsaXI | | ||| BbvII* || | || |BspMII* || | Hin4I | | ||| MboII || | || |BetI* || BarI | | ||Hpy166II || | || Hpy178III* |Hin4II* | | ||MboII || | || HpaII Tsp45I | | ||Csp6I || | |MmeI MaeIII | | |RsaI || | EcoP15I | | MaeII || BsrDI | TaiI || MnlI | SetI |BslFI BceAI BsaXI A M S S G G L V T A L E G L K K T Y T F Q C R P E G W S R R W K G * R R R T L S N V V R R A G H G V G R V E E D V H F Q ----:----|----:----|----:----|----:----|----:----|----:----| A I D D P P S T V A N S P N F F V Y V K R L T T R L A P * P T P L T S S S T C K C H R G S P Q D R R Q F P Q L L R V S E BccI |BarI || Hpy188I || | BssKI || | CviJI || | EcoRII || | HaeIII || | |SecI* || | |BseGI || | ||ScrFI || | ||BseBI || | ||| CviJI || | ||| |MaeI || | ||| ||FokI MboI || | ||| ||| TfiI | MnlI || | ||| ||| HinfI | DpnI || | ||| ||| |BdaI | |BstKTI || | ||| ||| |BdaI | || Hin4II* || | ||| ||| || Hpy178III* | || | SetI || | ||| ||| || | Hin4II* | || | BinI* \\ \ \\\ \\\ \\ \ \ \ \\ \ \ AAGTGGTTCGGATGGCCTGGGCTAGAGATTCCTGACGATGAGAAGGATCAGGTGAGGAAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTCACCAAGCCTACCGGACCCGATCTCTAAGGACTGCTACTCTTCCTAGTCCACTCCTTC / / / // / // / // / / / // // / / BarI | | || | || | || | | Hin4II* || || BinI* BdaI | | || | || | || | Hpy178III* || |Hin4II* BdaI | | || | || | || HinfI || MboI | | || | || | || TfiI || SetI | | || | || | |FokI |DpnI | | || | || | BdaI BstKTI | | || | || | BdaI MnlI | | || | || MaeI | | || | |CviJI | | || | EcoRII | | || | BssKI | | || | SecI* | | || BseBI | | || ScrFI | | |HaeIII | | |CviJI | | BseGI | Hpy188I BccI K W F G W P G L E I P D D E K D Q V R K S G S D G L G * R F L T M R R I R * G R V V R M A W A R D S * R * E G S G E E G ----:----|----:----|----:----|----:----|----:----|----:----| L H N P H G P S S I G S S S F S * T L F * T T R I A Q A L S E Q R H S P D P S S L P E S P R P * L N R V I L L I L H P L MboII BdaI |Csp6I Hpy178III* BdaI ||RsaI |DdeI |HphI ||| BseMII |BccI BtgZI || BceAI MseI ||| |BspCNI |Bpu10I | TspDTI \\ \ \ \\\ \\ \\ \ \ GACTTGCTGGAAAAGTTTAATGCCGTACCCATCTTCCTGAGCGATGAAATCGCAGACTTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAACGACCTTTTCAAATTACGGCATGGGTAGAAGGACTCGCTACTTTAGCGTCTGAAT / / / / // / / / / HphI BceAI | | |BspCNI | Bpu10I | BtgZI | | |Csp6I | DdeI TspDTI | | BseMII Hpy178III* | | RsaI BccI | MboII MseI D L L E K F N A V P I F L S D E I A D L T C W K S L M P Y P S S * A M K S Q T Y L A G K V * C R T H L P E R * N R R L T ----:----|----:----|----:----|----:----|----:----|----:----| S K S S F N L A T G M K R L S S I A S K P S A P F T * H R V W R G S R H F R L S V Q Q F L K I G Y G D E Q A I F D C V * BseGI |XcmI || BssKI || EcoRII || | MslI || | ScrFI CfrI || | BseBI | CviJI || | | BccI BceAI | HaeIII || | | | BcgI TspEI | | FokI || | | | |MboI \ \ \ \ \\ \ \ \ \\ CACTACAACGGGTTCAGTAATTCTATTCTATGGCCGTTATTCCATTACCATCCTGGTGAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTGATGTTGCCCAAGTCATTAAGATAAGATACCGGCAATAAGGTAATGGTAGGACCACTC / / / / / / / // // / | TspEI | | FokI | XcmI || || BstKTI BceAI | CfrI BseGI || |BccI HaeIII || EcoRII CviJI || BssKI || BcgI |BseBI |ScrFI MslI H Y N G F S N S I L W P L F H Y H P G E T T T G S V I L F Y G R Y S I T I L V R L Q R V Q * F Y S M A V I P L P S W * D ----:----|----:----|----:----|----:----|----:----|----:----| C * L P N L L E I R H G N N W * W G P S V S C R T * Y N * E I A T I G N G D Q H V V V P E T I R N * P R * E M V M R T L DpnI |BstKTI HphI ||TspEI | MaeII ||| AjuI | | SetI ||| HphI BsmI MnlI | | TaiI ||| |TaqI Hpy99I | MwoI | BcgI AjuI | | |Hpy166II \\\ \\ \ \ \ \ \ \ \ \ \\ ATCAATTTCGACGAGAATGCGTGGTTGGCATACAACGAGGCAAACCAGACGTTCACCAAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTAAAGCTGCTCTTACGCACCAACCGTATGTTGCTCCGTTTGGTCTGCAAGTGGTTG /// /// / / / // / / / / / ||| ||| TaqI | MwoI || AjuI | | | Hpy166II ||| ||Hpy99I BsmI |BcgI | | MaeII ||| |TspEI MnlI | TaiI ||| HphI | SetI ||MboI HphI |AjuI DpnI I N F D E N A W L A Y N E A N Q T F T N S I S T R M R G W H T T R Q T R R S P T Q F R R E C V V G I Q R G K P D V H Q R ----:----|----:----|----:----|----:----|----:----|----:----| I L K S S F A H N A Y L S A F W V N V L S * N R R S H T T P M C R P L G S T * W D I E V L I R P Q C V V L C V L R E G V FatI TaqII CviRI* | MseI |CviAII DdeI | TspDTI || NlaIII \ \ \ \\ \ GAGATTGCTAAGACTATGAACCATAACGATTTAATCTGGGTGCATGATTACCATTTGATG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAACGATTCTGATACTTGGTATTGCTAAATTAGACCCACGTACTAATGGTAAACTAC / / / / / // DdeI | | MseI | |FatI | TspDTI | CviAII TaqII CviRI* NlaIII E I A K T M N H N D L I W V H D Y H L M R L L R L * T I T I * S G C M I T I * C D C * D Y E P * R F N L G A * L P F D V ----:----|----:----|----:----|----:----|----:----|----:----| S I A L V I F W L S K I Q T C S * W K I R S Q * S * S G Y R N L R P A H N G N S L N S L S H V M V I * D P H M I V M Q H HinfI CviRI* | Hpy178III* | AclI | | TfiI | MaeII NlaIV | | HinfI | | MseI |BetI* | | |PleI | | SetI |BspMII* | | ||MlyI | | TaiI ||HpaII | | ||| BsiI* | | | BsgI ||Hpy178III* | | ||| Hpy178III* | | | | SetI \\\ \ \ \\\ \ \ \ \ \ \ TTGGTTCCGGAAATGTTGAGAGTCAAGATTCACGAGAAGCAACTGCAAAACGTTAAGGTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AACCAAGGCCTTTACAACTCTCAGTTCTAAGTGCTCTTCGTTGACGTTTTGCAATTCCAG / // / / // / / / / // / | |BspMII* | | || | BsiI* | | || MseI | |BetI* | | || Hpy178III* | | || SetI | Hpy178III* | | |HinfI | | |BsgI | HpaII | | |TfiI | | MaeII NlaIV | | PleI | | AclI | | MlyI | TaiI | Hpy178III* | SetI HinfI CviRI* L V P E M L R V K I H E K Q L Q N V K V W F R K C * E S R F T R S N C K T L R S G S G N V E S Q D S R E A T A K R * G R ----:----|----:----|----:----|----:----|----:----|----:----| N T G S I N L T L I * S F C S C F T L T T P E P F T S L * S E R S A V A F R * P Q N R F H Q S D L N V L L L Q L V N L D ApoI NlaIV TspEI TfiI SetI | CviRI* TaqI Hin4II* HinfI | Hpy188I \ \ \ \ \ \ \ GGGTGGTTCCTGCACACACCATTCCCTTCGAGTGAAATTTACAGAATCTTACCTGTCAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCCACCAAGGACGTGTGTGGTAAGGGAAGCTCACTTTAAATGTCTTAGAATGGACAGTCT / / / / / / / / | CviRI* | | TspEI | SetI Hpy188I NlaIV | | ApoI HinfI | Hin4II* TfiI TaqI G W F L H T P F P S S E I Y R I L P V R G G S C T H H S L R V K F T E S Y L S D V V P A H T I P F E * N L Q N L T C Q T ----:----|----:----|----:----|----:----|----:----|----:----| P H N R C V G N G E L S I * L I K G T L R T T G A C V M G K S H F K C F R V Q * P P E Q V C W E R R T F N V S D * R D S Hin4II* NlaIV \ \ CAAGAGATTTTGAAGGGTGTTTTGAGTTGTGATTTAGTCGGGTTCCACACATACGATTAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCTAAAACTTCCCACAAAACTCAACACTAAATCAGCCCAAGGTGTGTATGCTAATA / / Hin4II* NlaIV Q E I L K G V L S C D L V G F H T Y D Y K R F * R V F * V V I * S G S T H T I M R D F E G C F E L * F S R V P H I R L C ----:----|----:----|----:----|----:----|----:----|----:----| C S I K F P T K L Q S K T P N W V Y S * V L S K S P H K S N H N L R T G C M R N L L N Q L T N Q T T I * D P E V C V I I CviRI* | MwoI | BstAPI | | MseI | | | MaeII | | | | SetI MboII | | | | TaiI BbvII* | | | | |Hpy166II CviRI* |TspGWI | | | | || BsrDI \ \\ \ \ \ \ \\ \ GCAAGACATTTCTTGTCTTCCGTGCAAAGAGTGCTTAACGTGAACACATTGCCTAATGGG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCTGTAAAGAACAGAAGGCACGTTTCTCACGAATTGCACTTGTGTAACGGATTACCC / / / / / / / / / | | BbvII* | BstAPI | | | BsrDI | TspGWI | MwoI | | Hpy166II | MboII CviRI* | MaeII CviRI* MseI TaiI SetI A R H F L S S V Q R V L N V N T L P N G Q D I S C L P C K E C L T * T H C L M G K T F L V F R A K S A * R E H I A * W G ----:----|----:----|----:----|----:----|----:----|----:----| A L C K K D E T C L T S L T F V N G L P H L V N R T K R A F L A * R S C M A * H C S M E Q R G H L S H K V H V C Q R I P MseI |HpaI |HindII |Hpy166II || MaeII Hin4II* || | SetI | TaqI || | TaiI | | MaeII || | | AsuI* | | |BtrI BssKI || | | DraII | | ||Hpy99I EcoRII || | | |NlaIV | | |||SetI |SecI* || | | |BmgT120I | | |||TaiI ||ScrFI TfiI || | | ||CviJI | | ||||HphI ||BseBI HinfI || | | ||HaeIII | | ||||Hpy166II \\\ \ \\ \ \ \\\ \ \ \\\\\ GTGGAATACCAGGGCAGATTCGTTAACGTAGGGGCCTTCCCTATCGGTATCGACGTGGAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTTATGGTCCCGTCTAAGCAATTGCATCCCCGGAAGGGATAGCCATAGCTGCACCTG / / / // / /// / / / //// | EcoRII | || | ||DraII | | | |||Hpy166II | BssKI | || | ||AsuI* | | | ||HphI | SecI* | || | |BmgT120I | | | |MaeII BseBI | || | |HaeIII | | | BtrI ScrFI | || | |CviJI | | TaqI | || | NlaIV | | TaiI | || MaeII | | SetI | |MseI | Hpy99I | |TaiI Hin4II* | |SetI | Hpy166II | HindII | HpaI HinfI TfiI V E Y Q G R F V N V G A F P I G I D V D W N T R A D S L T * G P S L S V S T W T G I P G Q I R * R R G L P Y R Y R R G Q ----:----|----:----|----:----|----:----|----:----|----:----| T S Y W P L N T L T P A K G I P I S T S P P I G P C I R * R L P R G * R Y R R P H F V L A S E N V Y P G E R D T D V H V Hin4II* BccI TfiI Csp6I TfiI |MfeI |Hpy166II TspGWI HinfI |RsaI HinfI |TspEI BbvI \\ \ \ \\ \ \\ \ AAGTTCACCGATGGGTTGAAAAAGGAATCCGTACAAAAGAGAATCCAACAATTGAAGGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAGTGGCTACCCAACTTTTTCCTTAGGCATGTTTTCTCTTAGGTTGTTAACTTCCTT / / / // / / / Hpy166II TspGWI | |Csp6I | | TspEI BccI | RsaI | | MfeI HinfI | Hin4II* TfiI HinfI TfiI K F T D G L K K E S V Q K R I Q Q L K E S S P M G * K R N P Y K R E S N N * R K V H R W V E K G I R T K E N P T I E G N ----:----|----:----|----:----|----:----|----:----|----:----| L N V S P N F F S D T C F L I W C N F S C T * R H T S F P I R V F S F G V I S P L E G I P Q F L F G Y L L S D L L Q L F MmeI | TseI | CviJI | |BisI SalI | ||BlsI |TaqI | |||CviRI* |AccI | |||| MboI ||HindII | |||| | DpnI ||Hpy166II | |||| | |BstKTI ||| CviJI SetI \ \\\\ \ \\ \\\ \ \ ACTTTCAAGGGCTGCAAGATCATAGTTGGTGTCGACAGGCTGGATTACATCAAAGGTGTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAGTTCCCGACGTTCTAGTATCAACCACAGCTGTCCGACCTAATGTAGTTTCCACAC / / //// // / /// / / BbvI | |||| || MboI ||| CviJI SetI | |||| |DpnI ||SalI | |||| BstKTI |AccI | |||CviRI* |TaqI | |||TseI Hpy166II | ||BisI HindII | |BlsI | CviJI MmeI T F K G C K I I V G V D R L D Y I K G V L S R A A R S * L V S T G W I T S K V C F Q G L Q D H S W C R Q A G L H Q R C A ----:----|----:----|----:----|----:----|----:----|----:----| V K L P Q L I M T P T S L S S * M L P T F K * P S C S * L Q H R C A P N C * L H S E L A A L D Y N T D V P Q I V D F T H DdeI | Hpy188I | | MnlI | | |CviRI* | | || Cac8I | | || |BspCNI | | || ||BseMII | | || |||FatI | | || |||NcoI | | || |||StyI | | || |||SecI* | | || |||DsaI* | | || ||||CviAII Hpy188I | | || ||||| NlaIII | BseGI | | || ||||| |MslI | | Hpy178III* | | || ||||| || FokI | | |MnlI | | || ||||| || XmnI | | || SfaNI \ \ \\ \\\\\ \\ \ \ \ \\ \ CCTCAGAAGTTGCACGCCATGGAAGTGTTTCTGAACGAGCATCCAGAATGGAGGGGCAAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGTCTTCAACGTGCGGTACCTTCACAAAGACTTGCTCGTAGGTCTTACCTCCCCGTTC // / /// / /// / // / / / / / |DdeI | ||| | ||| | || BseGI | | SfaNI SetI | | ||| | ||| | |Hpy188I | Hpy178III* | | ||| | ||| | FokI MnlI | | ||| | ||| XmnI | | ||| | ||MslI | | ||| | |DsaI* | | ||| | |SecI* | | ||| | |StyI | | ||| | |NcoI | | ||| | |FatI | | ||| | CviAII | | ||| NlaIII | | ||BseMII | | ||Cac8I | | |BspCNI | | CviRI* | MnlI Hpy188I P Q K L H A M E V F L N E H P E W R G K L R S C T P W K C F * T S I Q N G G A R S E V A R H G S V S E R A S R M E G Q G ----:----|----:----|----:----|----:----|----:----|----:----| G * F N C A M S T N R F S C G S H L P L A E S T A R W P L T E S R A D L I S P C R L L Q V G H F H K Q V L M W F P P A L Csp6I |RsaI || Hin4I BtsI || Hin4I TspRI || | SspI Csp6I SetI | PflMI || | MboII SetI |RsaI | CviRI* | BsiYI* Ksp632I* || | | MseI \ \\ \ \ \ \ \ \\ \ \ \ GTTGTTCTGGTACAGGTTGCAGTGCCAAGTCGTGGAGATGTGGAAGAGTACCAATATTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAAGACCATGTCCAACGTCACGGTTCAGCACCTCTACACCTTCTCATGGTTATAAAT /// / / / / / /// // / ||| | | | BsiYI* | ||| |SspI MseI ||| | | | PflMI | ||| MboII ||| | | BtsI | ||Csp6I ||| | CviRI* | |RsaI ||| TspRI | Hin4I ||SetI | Hin4I |Csp6I Ksp632I* RsaI V V L V Q V A V P S R G D V E E Y Q Y L L F W Y R L Q C Q V V E M W K S T N I * C S G T G C S A K S W R C G R V P I F K ----:----|----:----|----:----|----:----|----:----|----:----| T T R T C T A T G L R P S T S S Y W Y K P Q E P V P Q L A L D H L H P L T G I N N N Q Y L N C H W T T S I H F L V L I * BslFI |Csp6I ||RsaI MboI ||| Tsp4CI* BglII Hin4I ||| |FokI XhoII Hin4I ||| || ApoI | DpnI | TfiI ||| || TspEI | |BstKTI | HinfI Tsp4CI* ||| || EcoRI \ \\ \ \ \ \\\ \\ \ AGATCTGTGGTCAATGAGTTGGTCGGTAGAATCAACGGTCAGTTCGGTACTGTGGAATTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGACACCAGTTACTCAACCAGCCATCTTAGTTGCCAGTCAAGCCATGACACCTTAAG // / / / / /// / / || XhoII Hin4I | Tsp4CI* ||| | EcoRI || BglII Hin4I HinfI ||| | TspEI || MboI TfiI ||| | ApoI |DpnI ||| FokI BstKTI ||Tsp4CI* ||BslFI |Csp6I RsaI R S V V N E L V G R I N G Q F G T V E F D L W S M S W S V E S T V S S V L W N S I C G Q * V G R * N Q R S V R Y C G I R ----:----|----:----|----:----|----:----|----:----|----:----| L D T T L S N T P L I L P * N P V T S N L I Q P * H T P R Y F * R D T R Y Q P I S R H D I L Q D T S D V T L E T S H F E BccI |FatI ||CviAII AluI TspDTI ||| CviRI* SapI CviJI | BseGI ||| NlaIII Ksp632I* | SetI MboII \ \ \\\ \ \ \ \ \ GTCCCCATCCATTTCATGCACAAGTCTATACCATTTGAAGAGCTGATTTCGTTATATGCT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CAGGGGTAGGTAAAGTACGTGTTCAGATATGGTAAACTTCTCGACTAAAGCAATATACGA / / / // / / / / | BseGI | |CviRI* | | CviJI MboII TspDTI | |FatI | | AluI | CviAII | SetI NlaIII Ksp632I* BccI SapI V P I H F M H K S I P F E E L I S L Y A S P S I S C T S L Y H L K S * F R Y M L P H P F H A Q V Y T I * R A D F V I C C ----:----|----:----|----:----|----:----|----:----|----:----| T G M W K M C L D I G N S S S I E N Y A R G W G N * A C T * V M Q L A S K T I H D G D M E H V L R Y W K F L Q N R * I S BtgZI | BsmAI | Eco31I | | Hpy166II | | | BccI AloI BcgI TspDTI \ \ \ \ \ \ \ GTGAGCGATGTTTGTTTGGTCTCGTCCACCCGTGATGGTATGAACTTGGTTTCCTACGAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CACTCGCTACAAACAAACCAGAGCAGGTGGGCACTACCATACTTGAACCAAAGGATGCTT / / // / / | | |BccI BcgI TspDTI | | |AloI | | Eco31I | | BsmAI | Hpy166II BtgZI V S D V C L V S S T R D G M N L V S Y E * A M F V W S R P P V M V * T W F P T N E R C L F G L V H P * W Y E L G F L R I ----:----|----:----|----:----|----:----|----:----|----:----| T L S T Q K T E D V R S P I F K T E * S Q S R H K N P R T W G H H Y S S P K R R H A I N T Q D R G G T I T H V Q N G V F MboII | BdaI Hpy166II | BdaI | HgiCI* | SetI | | SetI | NlaIV | | NlaIV | |BseMII | | | AciI AloI | ||BspCNI Hpy178III* | | | BisI | Cac8I BcgI | ||| MseI |DdeI | | | |BlsI \ \ \ \ \\\ \ \\ \ \ \ \\ TATATTGCTTGCCAAGAAGAAAAGAAAGGTTCCTTAATCCTGAGTGAGTTCACAGGTGCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAACGAACGGTTCTTCTTTTCTTTCCAAGGAATTAGGACTCACTCAAGTGTCCACGG / / / ///// / / / / / //// AloI Cac8I BcgI ||||| MseI | DdeI | | |||BisI ||||BspCNI | | | ||HgiCI* ||||NlaIV | | | ||BlsI |||BseMII | | | |TauI ||BdaI | | | NlaIV ||BdaI | | SetI |MboII | Hpy166II SetI Hpy178III* Y I A C Q E E K K G S L I L S E F T G A I L L A K K K R K V P * S * V S S Q V P Y C L P R R K E R F L N P E * V H R C R ----:----|----:----|----:----|----:----|----:----|----:----| Y I A Q W S S F F P E K I R L S N V P A I Y Q K G L L F S L N R L G S H T * L H I N S A L F F L F T G * D Q T L E C T G MboI SfaNI TauI | DpnI | BdaI StyI | |BstKTI | BdaI SecI* | || Hpy188I \ \ \ \ \\ \ GCACAATCCTTGAATGGTGCTATTATTGTAAATCCTTGGAACACCGATGATCTTTCTGAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGTTAGGAACTTACCACGATAATAACATTTAGGAACCTTGTGGCTACTAGAAAGACTA // / // / / |BdaI SecI* || | Hpy188I |BdaI StyI || SfaNI AciI || MboI |DpnI BstKTI A Q S L N G A I I V N P W N T D D L S D H N P * M V L L L * I L G T P M I F L M T I L E W C Y Y C K S L E H R * S F * C ----:----|----:----|----:----|----:----|----:----|----:----| A C D K F P A I I T F G Q F V S S R E S R V I R S H H * * Q L D K S C R H D K Q C L G Q I T S N N Y I R P V G I I K R I MseI BccI |HpaI | StuI |HindII | CviJI |Hpy166II MnlI | HaeIII || BsrI BfiI \ \ \ \\ \ \ GCCATCAACGAGGCCTTGACTTTGCCCGATGTAAAGAAAGAAGTTAACTGGGAAAAACTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTAGTTGCTCCGGAACTGAAACGGGCTACATTTCTTTCTTCAATTGACCCTTTTTGAA / / / // / / MnlI | HaeIII || BsrI BfiI | CviJI |MseI | StuI Hpy166II BccI HindII HpaI A I N E A L T L P D V K K E V N W E K L P S T R P * L C P M * R K K L T G K N F H Q R G L D F A R C K E R S * L G K T L ----:----|----:----|----:----|----:----|----:----|----:----| A M L S A K V K G S T F F S T L Q S F S H W * R P R S K A R H L S L L * S P F V G D V L G Q S Q G I Y L F F N V P F F K HphI | FatI Hin4II* | |CviAII | ApoI | || TspEI | TspEI | || NlaIII \ \ \ \\ \ TACAAATACATCTCTAAATACACTTCTGCCTTCTGGGGTGAAAATTTCGTCCATGAATTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTTATGTAGAGATTTATGTGAAGACGGAAGACCCCACTTTTAAAGCAGGTACTTAAT / / / / // / Hin4II* | | | || TspEI | | | |FatI | | | CviAII | | NlaIII | HphI TspEI ApoI Y K Y I S K Y T S A F W G E N F V H E L T N T S L N T L L P S G V K I S S M N Y Q I H L * I H F C L L G * K F R P * I I ----:----|----:----|----:----|----:----|----:----|----:----| * L Y M E L Y V E A K Q P S F K T W S N K C I C R * I C K Q R R P H F N R G H I V F V D R F V S R G E P T F I E D M F * AluI CviJI |BseRI TatI ||SetI Tsp4CI* ||| MwoI |Csp6I ||| | AluI ||RsaI ||| | CviJI ||| TspDTI ||| | | SetI MnlI \\\ \ \\\ \ \ \ \ TACAGTACATCATCAAGCTCAACAAGCTCCTCTGCCACCAAAAACTGA 1450 1460 1470 1480 ----:----|----:----|----:----|----:----|----:--- ATGTCATGTAGTAGTTCGAGTTGTTCGAGGAGACGGTGGTTTTTGACT / /// /// / / / / | ||TatI ||| | | CviJI MnlI | |Csp6I ||| | | AluI | TspDTI ||| | SetI | RsaI ||| MwoI Tsp4CI* ||CviJI ||AluI |BseRI SetI Y S T S S S S T S S S A T K N * T V H H Q A Q Q A P L P P K T X Q Y I I K L N K L L C H Q K L X ----:----|----:----|----:----|----:----|----:--- Y L V D D L E V L E E A V L F Q I C Y M M L S L L S R Q W W F S V T C * * A * C A G R G G F V S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AclI 1 Psp1406I AjuI 1 AloI 1 AluI 3 AluBI ApoI 3 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 7 BceAI 3 BcgI 2 BdaI 4 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 Bpu10I 2 BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 3 BseRI 1 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 3 BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstAPI 1 BstKTI 5 BtgZI 2 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 2 BstC8I CfrI 1 AcoI,EaeI Csp6I 10 CviQI,RsaNI CviAII 4 CviJI 12 CviKI-1 CviRI* 9 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 5 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI FatI 4 FokI 4 GlaI 1 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 8 HpyAV Hin6I 1 HinP1I,HspAI HindII 3 HincII HinfI 8 HpaI 2 KspAI HpaII 2 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 5 Hpy99I 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 3 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 MfeI 1 MunI MlyI 1 SchI MmeI 3 MnlI 8 MseI 8 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI RsaI 10 AfaI SalI 1 SapI 1 LguI,PciSI,BspQI ScrFI 3 BmrFI,MspR9I,Bme1390I SecI* 4 BseDI,BssECI,BsaJI SetI 18 SfaNI 2 LweI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 4 TaqII 1 TatI 1 TauI 1 TfiI 7 PfeI TseI 1 ApeKI Tsp45I 2 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 7 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 1 TscAI Tth111I 1 PflFI,PsyI,AspI XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AflIII AgeI AhaIII* AlfI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BbvCI Bce83I* BciVI BclI BglI BmeT110I BmtI BplI BsaAI BsaBI BsePI BseSI BseYI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I CauII* Cfr10I Cfr9I ClaI CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GsaI GsuI HaeII HgaI HgiAI* HgiJII* HindIII KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SauI* ScaI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TsoI TspMI TstI VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769