Restriction Map of LYS2/YBR115C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

LYS2/YBR115C on chromosome II from coordinates 473926 to 469748.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.32021

EMBOSS_001 MaeIII SetI | TspRI MmeI |Hpy178III* | | FatI \ \\ \ \ \ ATGACTAACGAAAAGGTCTGGATAGAGAAGTTGGATAATCCAACTCTTTCAGTGTTACCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGATTGCTTTTCCAGACCTATCTCTTCAACCTATTAGGTTGAGAAAGTCACAATGGT / / / / / / | SetI Hpy178III* TspRI | NlaIII MmeI MaeIII M T N E K V W I E K L D N P T L S V L P * L T K R S G * R S W I I Q L F Q C Y H D * R K G L D R E V G * S N S F S V T T ----:----|----:----|----:----|----:----|----:----|----:----| X V L S F T Q I S F N S L G V R E T N G X S * R F P R S L S T P Y D L E K L T V H S V F L D P Y L L Q I I W S K * H * W CviAII AluI | MmeI CviJI AluI | NlaIII SetI | SetI MaeIII CviJI \ \ \ \ \ \ \ CATGACTTTTTACGCCCACAACAAGAACCTTATACGAAACAAGCTACATATTCGTTACAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTGAAAAATGCGGGTGTTGTTCTTGGAATATGCTTTGTTCGATGTATAAGCAATGTC /// / / / / / ||FatI SetI | CviJI | CviJI |CviAII | AluI | AluI MmeI SetI MaeIII SetI H D F L R P Q Q E P Y T K Q A T Y S L Q M T F Y A H N K N L I R N K L H I R Y S * L F T P T T R T L Y E T S Y I F V T A ----:----|----:----|----:----|----:----|----:----|----:----| C S K K R G C C S G * V F C A V Y E N C V H S K V G V V L V K Y S V L * M N T V M V K * A W L L F R I R F L S C I R * L SetI | DdeI | BbvCI | Bpu10I | |SetI | |MwoI | || AluI | || CviJI | || | TaqI | || | SetI | || | | MnlI | || | | |MwoI | || | | || BspCNI | || | | || |BseMII | || | | || || FatI | || | | || || BspHI | || | | || || |CviAII | || | | || || |Hpy178III* | || | | || || || NlaIII | || | | || || || | MnlI BbvI \ \\ \ \ \\ \\ \\ \ \ \ CTACCTCAGCTCGATGTGCCTCATGATAGTTTTTCTAACAAATACGCTGTCGCTTTGAGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GATGGAGTCGAGCTACACGGAGTACTATCAAAAAGATTGTTTATGCGACAGCGAAACTCA // /// // // / // / / || ||| || || | || MnlI BbvI || ||| || || | |BspHI || ||| || || | |FatI || ||| || || | Hpy178III* || ||| || || | CviAII || ||| || || NlaIII || ||| || |BseMII || ||| || BspCNI || ||| |MnlI || ||| |TaqI || ||| MwoI || ||CviJI || ||AluI || |Bpu10I || |BbvCI || |DdeI || SetI |MwoI SetI L P Q L D V P H D S F S N K Y A V A L S Y L S S M C L M I V F L T N T L S L * V T S A R C A S * * F F * Q I R C R F E C ----:----|----:----|----:----|----:----|----:----|----:----| S G * S S T G * S L K E L L Y A T A K L A V E A R H A E H Y N K * C I R Q R K S * R L E I H R M I T K R V F V S D S Q T MaeIII | AgeI TseI | BetI* CviJI | Cfr10I |BisI | |HpaII ||BlsI | || MaeIII |||CviRI* | || Tsp45I HphI \\\\ \ \\ \ \ GTATGGGCTGCATTGATATATAGAGTAACCGGTGACGATGATATTGTTCTTTATATTGCG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CATACCCGACGTAACTATATATCTCATTGGCCACTGCTACTATAACAAGAAATATAACGC //// / // / / |||CviRI* | || | HphI |||TseI | || Tsp45I ||BisI | || MaeIII |BlsI | |Cfr10I CviJI | |BetI* | |AgeI | HpaII MaeIII V W A A L I Y R V T G D D D I V L Y I A Y G L H * Y I E * P V T M I L F F I L R M G C I D I * S N R * R * Y C S L Y C E ----:----|----:----|----:----|----:----|----:----|----:----| T H A A N I Y L T V P S S S I T R * I A H I P Q M S I Y L L R H R H Y Q E K Y Q Y P S C Q Y I S Y G T V I I N N K I N R SmlI AflII |MseI AluI || CspCI MaeII CviJI || |TfiI | SetI CspCI || |HinfI SspI | TaiI MseI | SetI \\ \\ \ \ \ \ \ \ AATAACAAAATCTTAAGATTCAATATTCAACCAACGTGGTCATTTAATGAGCTGTATTCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGTTTTAGAATTCTAAGTTATAAGTTGGTTGCACCAGTAAATTACTCGACATAAGA /// / / / / / / / ||| | SspI | MaeII | | CviJI ||| HinfI TaiI | | AluI ||| TfiI SetI | CspCI ||AflII | SetI ||SmlI MseI |MseI CspCI N N K I L R F N I Q P T W S F N E L Y S I T K S * D S I F N Q R G H L M S C I L * Q N L K I Q Y S T N V V I * * A V F Y ----:----|----:----|----:----|----:----|----:----|----:----| F L L I K L N L I * G V H D N L S S Y E S Y C F R L I * Y E V L T T M * H A T N I V F D * S E I N L W R P * K I L Q I R AluI BdaI TspEI CviJI BdaI | MseI | SetI CviJI NheI | |BdaI | |TspEI HaeIII BdaI AluI | |BdaI | || MnlI | TspEI BdaI CviJI \ \\ \ \\ \ \ \ \ \ ACAATTAACAATGAGTTGAACAAGCTCAATTCTATTGAGGCCAATTTTTCCTTTGACGAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTAATTGTTACTCAACTTGTTCGAGTTAAGATAACTCCGGTTAAAAAGGAAACTGCTC / // / / / / / / / / / / | |MseI | | | TspEI | | TspEI BdaI | CviJI | TspEI | | MnlI | HaeIII BdaI | AluI BdaI | CviJI | CviJI | BmtI BdaI | AluI BdaI SetI SetI BdaI T I N N E L N K L N S I E A N F S F D E Q L T M S * T S S I L L R P I F P L T S N * Q * V E Q A Q F Y * G Q F F L * R A ----:----|----:----|----:----|----:----|----:----|----:----| V I L L S N F L S L E I S A L K E K S S * L * C H T S C A * N * Q P W N K R Q R C N V I L Q V L E I R N L G I K G K V L MboI BglII XhoII | DpnI | BdaI | BdaI | |PflMI | |BstKTI | |BsiYI* | ||Hpy178III* | ||| AsuI* MaeI | ||| AvaII |SetI | ||| DraII |Cac8I | ||| PpuMI || AluI | ||| |BmgT120I || BmtI ApoI | ||| ||NlaIV MnlI || CviJI XmnI | ||| ||| TspGWI | BspCNI || | SetI TspEI | ||| ||| |DdeI | |BseMII \\ \ \ \ \ \\\ \\\ \\ \ \\ CTAGCTGAAAAAATTCAAAGTTGCCAAGATCTGGAAAGGACCCCTCAGTTGTTCCGTTTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GATCGACTTTTTTAAGTTTCAACGGTTCTAGACCTTTCCTGGGGAGTCAACAAGGCAAAC /// / / /// / / // / / // ||CviJI | TspEI ||| | | || DdeI | |BseMII ||NheI | ApoI ||| | | |TspGWI | BspCNI ||AluI XmnI ||| | | |PpuMI MnlI |MaeI ||| | | |DraII Cac8I ||| | | |AvaII SetI ||| | | |AsuI* ||| | | BmgT120I ||| | | NlaIV ||| | Hpy178III* ||| XhoII ||| BglII ||| MboI ||DpnI |BstKTI BsiYI* PflMI BdaI BdaI L A E K I Q S C Q D L E R T P Q L F R L * L K K F K V A K I W K G P L S C S V W S * K N S K L P R S G K D P S V V P F G ----:----|----:----|----:----|----:----|----:----|----:----| S A S F I * L Q W S R S L V G * N N R K A L Q F F E F N G L D P F S G E T T G N * S F F N L T A L I Q F P G R L Q E T Q CviJI SfaNI HaeIII TspEI | Hpy166II \ \ \ \ GCCTTTTTGGAAAACCAAGATTTCAAATTAGACGAGTTCAAGCATCATTTAGTGGACTTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAAAAACCTTTTGGTTCTAAAGTTTAATCTGCTCAAGTTCGTAGTAAATCACCTGAAA / / // HaeIII TspEI |SfaNI CviJI Hpy166II A F L E N Q D F K L D E F K H H L V D F P F W K T K I S N * T S S S I I * W T L L F G K P R F Q I R R V Q A S F S G L C ----:----|----:----|----:----|----:----|----:----|----:----| A K K S F W S K L N S S N L C * K T S K P R K P F G L N * I L R T * A D N L P S G K Q F V L I E F * V L E L M M * H V K Hin6I |GlaI |MstI* |FspAI ||FatI ||HhaI ApoI |||CviAII AluI BciVI |||| NspI MseI CviJI TspEI BsrI |||| NlaIII |TspEI PsiI | SetI \ \ \\\\ \ \\ \ \ \ GCTTTGAATTTGGATACCAGTAATAATGCGCATGTTTTGAACTTAATTTATAACAGCTTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACTTAAACCTATGGTCATTATTACGCGTACAAAACTTGAATTAAATATTGTCGAAT / / / /// // / / / / / | | BsrI ||| |FatI | | | | CviJI | TspEI ||| CviAII | | | | AluI | ApoI ||NlaIII | | | SetI BciVI ||Hin6I | | PsiI ||NspI | TspEI |FspAI MseI |MstI* |GlaI HhaI A L N L D T S N N A H V L N L I Y N S L L * I W I P V I M R M F * T * F I T A Y F E F G Y Q * * C A C F E L N L * Q L T ----:----|----:----|----:----|----:----|----:----|----:----| A K F K S V L L L A C T K F K I * L L K Q K S N P Y W Y Y H A H K S S L K Y C S S Q I Q I G T I I R M N Q V * N I V A * TspDTI | EcoP15I | | AciI | | | AsuI* | | | AvaII TseI Tsp4CI* | | | |BmgT120I |BisI | TaqI | | | || TsoI BbvI ||FokI | AsuII MaeIII | | | || |TspEI | SspI ||BlsI \ \ \ \ \ \ \\ \\ \ \ \\\ CTGTATTCGAATGAAAGAGTAACCATTGTTGCGGACCAATTTACTCAATATTTGACTGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GACATAAGCTTACTTTCTCATTGGTAACAACGCCTGGTTAAATGAGTTATAAACTGACGA / / // / //// / / // Tsp4CI* AsuII || | |||| TspEI SspI |BisI TaqI || | |||AvaII BbvI BlsI || | |||AsuI* || | ||BmgT120I || | |TsoI || | AciI || EcoP15I |TspDTI MaeIII L Y S N E R V T I V A D Q F T Q Y L T A C I R M K E * P L L R T N L L N I * L L V F E * K S N H C C G P I Y S I F D C C ----:----|----:----|----:----|----:----|----:----|----:----| S Y E F S L T V M T A S W N V * Y K V A V T N S H F L L W Q Q P G I * E I N S Q Q I R I F S Y G N N R V L K S L I Q S S Hin6I |GlaI ||HhaI |||DdeI |||BinI* |||EspI* |||| MboI HphI |||| | DpnI | FokI |||| | |BstKTI | | MboI |||| | ||BseGI | | BclI |||| | ||| MfeI | | Hpy188I BseGI |||| | ||| TspEI | | | DpnI | StyI |||| | ||| | BccI | | | |BstKTI | SecI* |||| | ||| | | CviRI* | | | || AciI | | SfaNI \\\\ \ \\\ \ \ \ \ \ \ \\ \ \ \ \ GCGCTAAGCGATCCATCCAATTGCATAACTAAAATCTCTCTGATCACCGCATCATCCAAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGATTCGCTAGGTAGGTTAACGTATTGATTTTAGAGAGACTAGTGGCGTAGTAGGTTC ///// / // / // / / // / // / ||||| | || MboI |CviRI* HphI | || | |BseGI SecI* ||||| | |BseGI TspEI | || | AciI StyI ||||| | |DpnI BccI | || BclI ||||| | BstKTI MfeI | || MboI ||||| EspI* | |DpnI ||||| DdeI | |FokI ||||BinI* | BstKTI |||FokI Hpy188I ||Hin6I |GlaI TseI HhaI A L S D P S N C I T K I S L I T A S S K R * A I H P I A * L K S L * S P H H P R A K R S I Q L H N * N L S D H R I I Q G ----:----|----:----|----:----|----:----|----:----|----:----| A S L S G D L Q M V L I E R I V A D D L Q A L R D M W N C L * F R E S * R M M W R * A I W G I A Y S F D R Q D G C * G L BinI* Hpy166II | MboI | SetI | | DpnI | | |BstKTI | | || DdeI CviJI MmeI Hpy178III* \ \ \\ \ \ \ \ GATAGTTTACCTGATCCAACTAAGAACTTGGGCTGGTGCGATTTCGTGGGGTGTATTCAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCAAATGGACTAGGTTGATTCTTGAACCCGACCACGCTAAAGCACCCCACATAAGTG / // // / / / / / | || || MboI DdeI CviJI MmeI Hpy178III* | || |DpnI | || BstKTI | |BinI* | |SetI | Hpy166II SfaNI D S L P D P T K N L G W C D F V G C I H I V Y L I Q L R T W A G A I S W G V F T * F T * S N * E L G L V R F R G V Y S R ----:----|----:----|----:----|----:----|----:----|----:----| S L K G S G V L F K P Q H S K T P H I * P Y N V Q D L * S S P S T R N R P T Y E I T * R I W S L V Q A P A I E H P T N V Hin4II* | Eco57I | Eco57MI | | SetI PfoI | | | BsmAI BssKI | | | | MlyI EcoRII | | | | PleI | ScrFI | | | | | AjuI | BseBI CviJI | | | | | | HinfI \ \ \ \ \ \ \ \ \ \ GACATTTTCCAGGACAATGCTGAAGCCTTCCCAGAGAGAACCTGTGTTGTGGAGACTCCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAAAAGGTCCTGTTACGACTTCGGAAGGGTCTCTCTTGGACACAACACCTCTGAGGT / / / / / / /// / | EcoRII CviJI | | | ||BsmAI HinfI | BssKI | | | |PleI | PfoI | | | MlyI BseBI | | AjuI ScrFI | Eco57MI | Eco57I | SetI Hin4II* D I F Q D N A E A F P E R T C V V E T P T F S R T M L K P S Q R E P V L W R L Q H F P G Q C * S L P R E N L C C G D S N ----:----|----:----|----:----|----:----|----:----|----:----| S M K W S L A S A K G S L V Q T T S V G R C K G P C H Q L R G L S F R H Q P S E V N E L V I S F G E W L S G T N H L S W MmeI BslFI | Hpy178III* | ApoI MmeI | |NruI | TspEI Hpy188I |AjuI | |FnuDII* AciI \ \ \ \\ \ \\ \ ACACTAAATTCCGACAAGTCCCGTTCTTTCACTTATCGCGACATCAACCGCACTTCTAAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGATTTAAGGCTGTTCAGGGCAAGAAAGTGAATAGCGCTGTAGTTGGCGTGAAGATTG / // / / / // / | || | MmeI MmeI |Hpy178III* AciI | || AjuI FnuDII* | |Hpy188I NruI | TspEI | ApoI BslFI T L N S D K S R S F T Y R D I N R T S N H * I P T S P V L S L I A T S T A L L T T K F R Q V P F F H L S R H Q P H F * H ----:----|----:----|----:----|----:----|----:----|----:----| V S F E S L D R E K V * R S M L R V E L L V L N R C T G N K * K D R C * G C K * C * I G V L G T R E S I A V D V A S R V HphI |MboI |MboII SetI || DpnI MseI |MnlI SetI || |BstKTI \ \\ \ \\ \\ ATAGTTGCCCATTATTTGATTAAAACAGGTATCAAAAGAGGTGATGTAGTGATGATCTAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TATCAACGGGTAATAAACTAATTTTGTCCATAGTTTTCTCCACTACATCACTACTAGATA / / / / // // / | | MnlI SetI || || MboI | SetI || |DpnI MseI || BstKTI |MboII HphI I V A H Y L I K T G I K R G D V V M I Y * L P I I * L K Q V S K E V M * * * S I S C P L F D * N R Y Q K R * C S D D L F ----:----|----:----|----:----|----:----|----:----|----:----| M T A W * K I L V P I L L P S T T I I * C L Q G N N S * F L Y * F L H H L S S R Y N G M I Q N F C T D F S T I Y H H D I Hpy178III* | MroNI | CviJI | Cfr10I | |HpaII | ||NaeI | ||Cac8I | ||| Hin6I TaqII | ||| |GlaI MaeI BccI | BccI | ||| ||HhaI \ \ \ \ \ \\\ \\\ TCTTCTAGGGGTGTGGATTTGATGGTATGTGTGATGGGTGTCTTGAAAGCCGGCGCAACC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGATCCCCACACCTAAACTACCATACACACTACCCACAGAACTTTCGGCCGCGTTGG / / / / / / ///// / MaeI BccI | BccI | | ||||| SetI TaqII | | ||||Hin6I | | |||GlaI | | ||Cfr10I | | ||MroNI | | ||HhaI | | |HpaII | | Cac8I | | NaeI | CviJI Hpy178III* S S R G V D L M V C V M G V L K A G A T L L G V W I * W Y V * W V S * K P A Q P F * G C G F D G M C D G C L E S R R N L ----:----|----:----|----:----|----:----|----:----|----:----| E E L P T S K I T H T I P T K F A P A V N K * P H P N S P I H S P H R S L R R L R R P T H I Q H Y T H H T D Q F G A C G BseYI | GsaI CspCI SetI TaqI CviRI* | CviJI DdeI |SetI \ \ \ \ \ \ \\ TTTTCAGTTATCGACCCTGCATATCCCCCAGCCAGACAAACCATTTACTTAGGTGTTGCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGTCAATAGCTGGGACGTATAGGGGGTCGGTCTGTTTGGTAAATGAATCCACAACGA / / / / // TaqI CviRI* | BseYI |CspCI | CviJI |DdeI GsaI SetI F S V I D P A Y P P A R Q T I Y L G V A F Q L S T L H I P Q P D K P F T * V L L F S Y R P C I S P S Q T N H L L R C C * ----:----|----:----|----:----|----:----|----:----|----:----| K E T I S G A Y G G A L C V M * K P T A R K L * R G Q M D G L W V F W K S L H Q K * N D V R C I G W G S L G N V * T N S MfeI TseI TspEI EcoP15I AluI | MboI | MaeII CviJI | | DpnI | |PmaCI CspCI | | |BstKTI | |BsaAI |BisI | | || SpeI | || SetI ||BlsI | | || |MaeI | || TaiI BbvI ||SetI | | || ||BinI* \ \\ \ \ \\\ \ \ \\ \\\ AAACCACGTGGGTTGATTGTTATTAGAGCTGCTGGACAATTGGATCAACTAGTAGAAGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGTGCACCCAACTAACAATAATCTCGACGACCTGTTAACCTAGTTGATCATCTTCTA / / // / / //// / // / // | | |MaeII BbvI | |||TseI | || MboI |SpeI | | BsaAI | ||BisI | |DpnI BinI* | | PmaCI | |BlsI | BstKTI MaeI | TaiI | CviJI TspEI | SetI | AluI MfeI EcoP15I CspCI SetI K P R G L I V I R A A G Q L D Q L V E D N H V G * L L L E L L D N W I N * * K I T T W V D C Y * S C W T I G S T S R R L ----:----|----:----|----:----|----:----|----:----|----:----| L G R P N I T I L A A P C N S * S T S S * V V H T S Q * * L Q Q V I P D V L L L F W T P Q N N N S S S S L Q I L * Y F I TspDTI |BtgZI || Hpy178III* || | TfiI || | HinfI || | | XmnI BccI MboII TspEI || | | TspEI | Hpy178III* \ \ \\ \ \ \ \ \ TACATCAATGATGAATTGGAGATTGTTTCAAGAATCAATTCCATCGCTATTCAAGAAAAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTAGTTACTACTTAACCTCTAACAAAGTTCTTAGTTAAGGTAGCGATAAGTTCTTTTA / / / / // / / / MboII TspEI TspDTI | || TspEI | Hpy178III* | |XmnI BccI | HinfI | TfiI Hpy178III* BtgZI Y I N D E L E I V S R I N S I A I Q E N T S M M N W R L F Q E S I P S L F K K M H Q * * I G D C F K N Q F H R Y S R K W ----:----|----:----|----:----|----:----|----:----|----:----| * M L S S N S I T E L I L E M A I * S F N C * H H I P S Q K L F * N W R * E L F V D I I F Q L N N * S D I G D S N L F I BseGI | CviJI Acc65I | |NlaIV HgiCI* | || FokI |Csp6I | || | NdeI ||RsaI | || | | MboI ||NlaIV | || | | BclI |||Hin4II* SetI | || | | | DpnI ||||KpnI | TspEI MnlI | || | | | |BstKTI \\\\\ \ \ \ \ \\ \ \ \ \\ GGTACCATTGAAGGTGGCAAATTGGACAATGGCGAGGATGTTTTGGCTCCATATGATCAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGGTAACTTCCACCGTTTAACCTGTTACCGCTCCTACAAAACCGAGGTATACTAGTG / /// / / / / // / // / | ||| SetI | MnlI BseGI |NlaIV | || BclI | ||HgiCI* TspEI CviJI | || MboI | ||Acc65I | |DpnI | |Csp6I | BstKTI | Hin4II* FokI | NlaIV NdeI | RsaI KpnI G T I E G G K L D N G E D V L A P Y D H V P L K V A N W T M A R M F W L H M I T Y H * R W Q I G Q W R G C F G S I * S L ----:----|----:----|----:----|----:----|----:----|----:----| P V M S P P L N S L P S S T K A G Y S * H Y W Q L H C I P C H R P H K P E M H D T G N F T A F Q V I A L I N Q S W I I V AsuI* AvaII |BmgT120I || TfiI MmeI SetI || HinfI \ \ \\ \ TACAAAGACACCAGAACAGGTGTTGTAGTTGGACCAGATTCCAACCCAACCCTATCTTTC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTTCTGTGGTCTTGTCCACAACATCAACCTGGTCTAAGGTTGGGTTGGGATAGAAAG / / // / MmeI SetI |AvaII HinfI |AsuI* TfiI BmgT120I Y K D T R T G V V V G P D S N P T L S F T K T P E Q V L * L D Q I P T Q P Y L S Q R H Q N R C C S W T R F Q P N P I F H ----:----|----:----|----:----|----:----|----:----|----:----| * L S V L V P T T T P G S E L G V R D K S C L C W F L H Q L Q V L N W G L G I K V F V G S C T N Y N S W I G V W G * R E MmeI | Hin4II* | | NlaIV | | | Hpy188I StyI | | | | XmnI DdeI AccI SecI* | | | | |SetI SauI* |Hpy166II | CviJI \ \ \ \ \\ \ \\ \ \ ACATCTGGTTCCGAAGGTATTCCTAAGGGTGTTCTTGGTAGACATTTTTCCTTGGCTTAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGACCAAGGCTTCCATAAGGATTCCCACAAGAACCATCTGTAAAAAGGAACCGAATA / / / / / / / // // | | | | | XmnI SauI* |AccI |CviJI | | | | SetI DdeI Hpy166II SecI* | | | Hpy188I StyI | | NlaIV | Hin4II* MmeI T S G S E G I P K G V L G R H F S L A Y H L V P K V F L R V F L V D I F P W L I I W F R R Y S * G C S W * T F F L G L L ----:----|----:----|----:----|----:----|----:----|----:----| V D P E S P I G L P T R P L C K E K A * * M Q N R L Y E * P H E Q Y V N K R P K C R T G F T N R L T N K T S M K G Q S I ApoI TspEI MfeI FokI | BseMII DdeI TspEI BseGI |SetI MseI | |BspCNI EspI* \ \ \\ \ \ \\ \ TATTTCAATTGGATGTCCAAAAGGTTCAACTTAACAGAAAATGATAAATTCACAATGCTG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAGTTAACCTACAGGTTTTCCAAGTTGAATTGTCTTTTACTATTTAAGTGTTACGAC / / / / / // / | BseGI SetI FokI MseI || TspEI TspEI || ApoI MfeI |BspCNI BseMII Y F N W M S K R F N L T E N D K F T M L I S I G C P K G S T * Q K M I N S Q C * F Q L D V Q K V Q L N R K * * I H N A E ----:----|----:----|----:----|----:----|----:----|----:----| * K L Q I D L L N L K V S F S L N V I S N N * N S T W F T * S L L F H Y I * L A I E I P H G F P E V * C F I I F E C H Q BinI* CviRI* | FatI | |CviAII BslFI | || MboI HgiCI* AciI | || |NlaIII | SetI BsrBI | || ||DpnI BdaI | NlaIV | BdaI | || |||BstKTI BdaI | | SduI | BdaI | || |||| TspEI Hpy166II | | BseSI \ \ \ \\ \\\\ \ \ \ \ \ AGCGGTATTGCACATGATCCAATTCAAAGAGATATGTTTACACCATTATTTTTAGGTGCC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCCATAACGTGTACTAGGTTAAGTTTCTCTATACAAATGTGGTAATAAAAATCCACGG // / /// /// / / / / / // // || AciI ||| ||| MboI TspEI | Hpy166II | || |Bce83I* |BsrBI ||| ||DpnI BdaI | || HgiCI* |BdaI ||| |BstKTI BdaI | || BslFI |BdaI ||| |FatI | |NlaIV EspI* ||| CviAII | BseSI DdeI ||NlaIII | SduI |BinI* SetI CviRI* S G I A H D P I Q R D M F T P L F L G A A V L H M I Q F K E I C L H H Y F * V P R Y C T * S N S K R Y V Y T I I F R C P ----:----|----:----|----:----|----:----|----:----|----:----| L P I A C S G I * L S I N V G N N K P A S R Y Q V H D L E F L Y T * V M I K L H A T N C M I W N L S I H K C W * K * T G Csp6I |RsaI ||Hpy166II ||| BssKI ||| |HpaII ||| ||ScrFI ||| ||CauII* ||| |||AsuI* MfeI SmlI ||| ||||BmgT120I TspEI | Hpy178III* ||| |||||CviJI BsiYI* |Bce83I* | | BceAI ||| |||||HaeIII |AciI \\ \ \ \ \\\ \\\\\\ \\ CAATTGTATGTCCCTACTCAAGATGATATTGGTACACCGGGCCGTTTAGCGGAATGGATG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAACATACAGGGATGAGTTCTACTATAACCATGTGGCCCGGCAAATCGCCTTACCTAC / / / // / // / / / TspEI | | || | || | AciI BseGI MfeI | | || | || BsiYI* | | || | |AsuI* | | || | BmgT120I | | || | HaeIII | | || | BssKI | | || | CviJI | | || CauII* | | || HpaII | | || ScrFI | | |Hpy166II | | |Csp6I | | RsaI | BceAI Hpy178III* SmlI Q L Y V P T Q D D I G T P G R L A E W M N C M S L L K M I L V H R A V * R N G * I V C P Y S R * Y W Y T G P F S G M D E ----:----|----:----|----:----|----:----|----:----|----:----| W N Y T G V * S S I P V G P R K A S H I G I T H G * E L H Y Q Y V P G N L P I S L Q I D R S L I I N T C R A T * R F P H SetI | FatI | NcoI | StyI | SecI* | DsaI* | |CviAII | ||BsiYI* | ||| AarI CviRI* | ||| BspMI | MaeIII | ||| NlaIII BseGI FokI | Tsp4CI* MseI | ||| | TspEI \ \ \ \ \ \ \\\ \ \ AGTAAGTATGGTTGCACAGTTACCCATTTAACACCTGCCATGGGTCAATTACTTACTGCC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTCATACCAACGTGTCAATGGGTAAATTGTGGACGGTACCCAGTTAATGAATGACGG // / / / / // // / / || | MaeIII | SetI || || | TspEI || Tsp4CI* MseI || || BspMI |CviRI* || || AarI FokI || |DsaI* || |SecI* || |StyI || |NcoI || |FatI || CviAII |NlaIII BsiYI* S K Y G C T V T H L T P A M G Q L L T A V S M V A Q L P I * H L P W V N Y L L P * V W L H S Y P F N T C H G S I T Y C P ----:----|----:----|----:----|----:----|----:----|----:----| L L Y P Q V T V W K V G A M P * N S V A S Y T H N C L * G N L V Q W P D I V * Q T L I T A C N G M * C R G H T L * K S G FatI AluI |CviAII CviJI DdeI || TaqII MaeIII MseI | SetI | MaeIII || NlaIII Tsp45I | HphI \ \ \ \ \\ \ \ \ \ CAAGCTACTACACCATTCCCTAAGTTACATCATGCGTTCTTTGTGGGTGACATTTTAACA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGATGATGTGGTAAGGGATTCAATGTAGTACGCAAGAAACACCCACTGTAAAATTGT / / / / / /// / / | CviJI DdeI | | ||FatI | HphI | AluI | | |CviAII | MseI SetI | | TaqII Tsp45I | NlaIII MaeIII MaeIII Q A T T P F P K L H H A F F V G D I L T K L L H H S L S Y I M R S L W V T F * Q S Y Y T I P * V T S C V L C G * H F N K ----:----|----:----|----:----|----:----|----:----|----:----| W A V V G N G L N C * A N K T P S M K V G L * * V M G * T V D H T R Q P H C K L L S S C W E R L * M M R E K H T V N * C MaeII DdeI |BseMII |Hpy188I MseI ||BspCNI || MaeIII StyI | AlfI |||SetI || | SetI BceAI | AlfI |||TaiI || | |AlfI SecI* | | Csp6I |||| MnlI || | |AlfI | SetI TspEI | | |RsaI \\\\ \ \\ \ \\ \ \ \ \ \ \\ AAACGTGATTGTCTGAGGTTACAAACCTTGGCAGAAAATTGCCGTATTGTTAATATGTAC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGCACTAACAGACTCCAATGTTTGGAACCGTCTTTTAACGGCATAACAATTATACATG // / / / // / / / / / / / /// || | MnlI | || | | | | SecI* TspEI AlfI ||Tsp4CI* || MaeII | || | | | | StyI AlfI |Csp6I |BspCNI | || | | | BceAI MseI RsaI BseMII | || | | SetI TaiI | || | MaeIII SetI | || AlfI | || AlfI | |DdeI | SetI Hpy188I K R D C L R L Q T L A E N C R I V N M Y N V I V * G Y K P W Q K I A V L L I C T T * L S E V T N L G R K L P Y C * Y V R ----:----|----:----|----:----|----:----|----:----|----:----| F R S Q R L N C V K A S F Q R I T L I Y L V H N D S T V F R P L F N G Y Q * Y T F T I T Q P * L G Q C F I A T N N I H V Acc65I HgiCI* Tsp4CI* |Csp6I BinI* ||RsaI DraIII | MboI ||NlaIV |Cac8I TaqI MseI | | DpnI ||| KpnI TspRI || CviRI* AsuII BsgI | | |BstKTI \\\ \ \ \\ \ \ \ \ \ \\ GGTACCACTGAAACACAGCGTGCAGTTTCTTATTTCGAAGTTAAATCAAAAAATGACGAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGGTGACTTTGTGTCGCACGTCAAAGAATAAAGCTTCAATTTAGTTTTTTACTGCTA / /// / / / / / / / // | ||HgiCI* | | CviRI* | | MseI | |DpnI | ||Acc65I | Cac8I | BsgI | BstKTI | |Csp6I DraIII AsuII BinI* | NlaIV TaqI | TspRI | RsaI KpnI G T T E T Q R A V S Y F E V K S K N D D V P L K H S V Q F L I S K L N Q K M T I Y H * N T A C S F L F R S * I K K * R S ----:----|----:----|----:----|----:----|----:----|----:----| P V V S V C R A T E * K S T L D F F S S R Y W Q F V A H L K K N R L * I L F H R T G S F C L T C N R I E F N F * F I V I FatI AclI EcoP15I |CviAII MaeII | BdaI || NlaIII BdaI | SetI | BdaI TspEI || | Cac8I BdaI SetI | TaiI \ \ \ \\ \ \ \ \ \ \ CCAAACTTTTTGAAAAAATTGAAAGATGTCATGCCTGCTGGTAAAGGTATGTTGAACGTT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTGAAAAACTTTTTTAACTTTCTACAGTACGGACGACCATTTCCATACAACTTGCAA / / / / / // / / / / / MboI | EcoP15I TspEI | || Cac8I | SetI | MaeII BdaI | |FatI BdaI | AclI BdaI | CviAII BdaI TaiI NlaIII SetI P N F L K K L K D V M P A G K G M L N V Q T F * K N * K M S C L L V K V C * T F K L F E K I E R C H A C W * R Y V E R S ----:----|----:----|----:----|----:----|----:----|----:----| G F K K F F N F S T M G A P L P I N F T D L S K S F I S L H * A Q Q Y L Y T S R W V K Q F F Q F I D H R S T F T H Q V N MboI | DpnI AluI | |PvuI CviJI MseI | |McrI* | SetI |HpaI | |BstKTI | |SpeI |HindII | || Csp6I | ||MaeI |Hpy166II | || |RsaI SetI \ \\\ \\ \ \\ \\ \ CAGCTACTAGTTGTTAACAGGAACGATCGTACTCAAATATGTGGTATTGGCGAAATAGGT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGATGATCAACAATTGTCCTTGCTAGCATGAGTTTATACACCATAACCGCTTTATCCA / / // // // / // / | CviJI |SpeI |MseI || | |Csp6I SetI | AluI MaeI Hpy166II || | RsaI SetI HindII || MboI HpaI |DpnI BstKTI McrI* PvuI Q L L V V N R N D R T Q I C G I G E I G S Y * L L T G T I V L K Y V V L A K * V A T S C * Q E R S Y S N M W Y W R N R * ----:----|----:----|----:----|----:----|----:----|----:----| * S S T T L L F S R V * I H P I P S I P E A V L Q * C S R D Y E F I H Y Q R F L L * * N N V P V I T S L Y T T N A F Y T CviRI* | SetI | | Hin4II* | | |CfrI | | || CviJI | | || HaeIII AarI | | || | MnlI BspMI | | || | |BsgI | HphI | | || | ||SetI TspEI \ \ \ \ \\ \ \\\ \ GAGATTTATGTTCGTGCAGGTGGTTTGGCCGAAGGTTATAGAGGATTACCAGAATTGAAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAAATACAAGCACGTCCACCAAACCGGCTTCCAATATCTCCTAATGGTCTTAACTTA / / // / / / // / | | |SetI | | | |BsgI TspEI | | CviRI* | | | |MnlI | BspMI | | | SetI | AarI | | CfrI HphI | HaeIII | CviJI Hin4II* E I Y V R A G G L A E G Y R G L P E L N R F M F V Q V V W P K V I E D Y Q N * I D L C S C R W F G R R L * R I T R I E * ----:----|----:----|----:----|----:----|----:----|----:----| S I * T R A P P K A S P * L P N G S N F H S K H E H L H N P R L N Y L I V L I S L N I N T C T T Q G F T I S S * W F Q I MboI | DpnI | |BstKTI Hpy166II | || TspEI ApoI | BdaI | || |BsrI BdaI TspEI | BdaI BsrI | || |TspRI BdaI \ \ \ \ \ \\ \\ \ AAAGAAAAATTTGTGAACAACTGGTTTGTTGAAAAAGATCACTGGAATTATTTGGATAAG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTTTTAAACACTTGTTGACCAAACAACTTTTTCTAGTGACCTTAATAAACCTATTC / / / / // / / / / | | BdaI BsrI || | BsrI | BdaI | | BdaI || MboI | BdaI | Hpy166II |DpnI TspEI TspEI BstKTI ApoI TspRI K E K F V N N W F V E K D H W N Y L D K K K N L * T T G L L K K I T G I I W I R R K I C E Q L V C * K R S L E L F G * G ----:----|----:----|----:----|----:----|----:----|----:----| L S F N T F L Q N T S F S * Q F * K S L Y L F I Q S C S T Q Q F L D S S N N P Y F F F K H V V P K N F F I V P I I Q I L Hpy166II | BsmAI | |StyI | |SecI* | || SetI AsuI* TatI | || | TsoI AvaII Bsp1407I | || | |HphI |BmgT120I |Csp6I | || | || TspEI ||SetI ||RsaI \ \\ \ \\ \ \\\ \\\ GATAATGGTGAACCTTGGAGACAATTCTGGTTAGGTCCAAGAGATAGATTGTACAGAACG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTACCACTTGGAACCTCTGTTAAGACCAATCCAGGTTCTCTATCTAACATGTCTTGC // /// / / // /// |SetI ||HphI TspEI | |AvaII ||Bsp1407I | |SecI* | |AsuI* ||TatI | |StyI | BmgT120I |Csp6I | BsmAI SetI RsaI | TsoI Hpy166II D N G E P W R Q F W L G P R D R L Y R T I M V N L G D N S G * V Q E I D C T E R * W * T L E T I L V R S K R * I V Q N G ----:----|----:----|----:----|----:----|----:----|----:----| S L P S G Q L C N Q N P G L S L N Y L V P Y H H V K S V I R T L D L L Y I T C F I I T F R P S L E P * T W S I S Q V S R MaeIII Tsp45I CviJI Tsp4CI* | MboI | Tsp4CI* | BclI SetI | | HphI | | DpnI |HphI | | | AciI | | |BstKTI \\ \ \ \ \ \ \ \\ GGTGATTTAGGTCGTTATCTACCAAACGGTGACTGTGAATGTTGCGGTAGGGCTGATGAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTAAATCCAGCAATAGATGGTTTGCCACTGACACTTACAACGCCATCCCGACTACTA / / / / / / / // | HphI | | HphI AciI CviJI |DpnI SetI | Tsp4CI* BstKTI | Tsp45I | MaeIII Tsp4CI* G D L G R Y L P N G D C E C C G R A D D V I * V V I Y Q T V T V N V A V G L M I * F R S L S T K R * L * M L R * G * * S ----:----|----:----|----:----|----:----|----:----|----:----| P S K P R * R G F P S Q S H Q P L A S S P H N L D N D V L R H S H I N R Y P Q H T I * T T I * W V T V T F T A T P S I I Hpy188I |TfiI MseI |HinfI | ApoI || TaqI | TspEI || | TspEI FokI BseGI \ \ \\ \ \ \ \ CAAGTTAAAATTCGTGGGTTCAGAATCGAATTAGGAGAAATAGATACGCACATTTCCCAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCAATTTTAAGCACCCAAGTCTTAGCTTAATCCTCTTTATCTATGCGTGTAAAGGGTT / / / / / / / / / BclI MseI TspEI | | | TspEI FokI BseGI MboI ApoI | | TaqI | HinfI | TfiI Hpy188I Q V K I R G F R I E L G E I D T H I S Q K L K F V G S E S N * E K * I R T F P N S * N S W V Q N R I R R N R Y A H F P T ----:----|----:----|----:----|----:----|----:----|----:----| * T L I R P N L I S N P S I S V C M E W D L * F E H T * F R I L L F L Y A C K G L N F N T P E S D F * S F Y I R V N G L CviJI \ CATCCATTGGTAAGAGAAAACATTACTTTAGTTCGCAAAAATGCCGACAATGAGCCAACA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGGTAACCATTCTCTTTTGTAATGAAATCAAGCGTTTTTACGGCTGTTACTCGGTTGT / CviJI H P L V R E N I T L V R K N A D N E P T I H W * E K T L L * F A K M P T M S Q H S I G K R K H Y F S S Q K C R Q * A N I ----:----|----:----|----:----|----:----|----:----|----:----| C G N T L S F M V K T R L F A S L S G V V D M P L L F C * K L E C F H R C H A L M W Q Y S F V N S * N A F I G V I L W C BslFI |MboI |BclI AsuI* || DpnI AvaII Hin4I || |BstKTI |BmgT120I Hin4I AjuI Hin4I || || MslI ||NlaIV | CviJI DdeI Hin4I \\ \\ \ \\\ \ \ \ \ TTGATCACATTTATGGTCCCAAGATTTGACAAGCCAGATGACTTGTCTAAGTTCCAAAGT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAGTGTAAATACCAGGGTTCTAAACTGTTCGGTCTACTGAACAGATTCAAGGTTTCA //// / // / / / / / |||| MslI || Hin4I CviJI AjuI DdeI Hin4I |||BclI || Hin4I Hin4I |||MboI |AvaII ||BslFI |AsuI* |DpnI BmgT120I BstKTI NlaIV L I T F M V P R F D K P D D L S K F Q S * S H L W S Q D L T S Q M T C L S S K V D H I Y G P K I * Q A R * L V * V P K * ----:----|----:----|----:----|----:----|----:----|----:----| N I V N I T G L N S L G S S K D L N W L M S * M * P G L I Q C A L H S T * T G F Q D C K H D W S K V L W I V Q R L E L T SetI CviJI MaeIII MnlI | AjuI SfeI* MseI | MseI BstEII \ \ \ \ \ \ \ \ GATGTTCCAAAGGAGGTTGAAACTGACCCTATAGTTAAGGGCTTAATCGGTTACCATCTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAAGGTTTCCTCCAACTTTGACTGGGATATCAATTCCCGAATTAGCCAATGGTAGAA / // / / / / / MnlI |AjuI | | | MseI BstEII SetI | | CviJI MaeIII | MseI SfeI* D V P K E V E T D P I V K G L I G Y H L M F Q R R L K L T L * L R A * S V T I F C S K G G * N * P Y S * G L N R L P S F ----:----|----:----|----:----|----:----|----:----|----:----| S T G F S T S V S G I T L P K I P * W R H H E L P P Q F Q G * L * P S L R N G D I N W L L N F S V R Y N L A * D T V M K NheI CviJI |MaeI ||Cac8I ||| AluI ||| BmtI BccI Hpy178III* ||| CviJI | StyI | MseI ||| | SetI | SecI* | | TsoI ||| | MwoI TsoI \ \ \ \ \ \\\ \ \ \ TTATCCAAGGACATCAGGACTTTCTTAAAGAAAAGATTGGCTAGCTATGCTATGCCTTCC 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGGTTCCTGTAGTCCTGAAAGAATTTCTTTTCTAACCGATCGATACGATACGGAAGG / / / // / /// / BccI SecI* | |MseI | ||CviJI TsoI StyI | TsoI | ||NheI Hpy178III* | ||AluI | |MwoI | |MaeI | Cac8I | SetI CviJI BmtI L S K D I R T F L K K R L A S Y A M P S Y P R T S G L S * R K D W L A M L C L P I Q G H Q D F L K E K I G * L C Y A F L ----:----|----:----|----:----|----:----|----:----|----:----| K D L S M L V K K F F L N A L * A I G E K I W P C * S K R L S F I P * S H * A K * G L V D P S E * L F S Q S A I S H R G TfiI Hin4II* HinfI CviJI \ \ \ TTGATTGTGGTTATGGATAAACTACCATTGAATCCAAATGGTAAAGTTGATAAGCCTAAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAACACCAATACCTATTTGATGGTAACTTAGGTTTACCATTTCAACTATTCGGATTT / / / Hin4II* HinfI CviJI TfiI L I V V M D K L P L N P N G K V D K P K * L W L W I N Y H * I Q M V K L I S L N D C G Y G * T T I E S K W * S * * A * T ----:----|----:----|----:----|----:----|----:----|----:----| K I T T I S L S G N F G F P L T S L G L R S Q P * P Y V V M S D L H Y L Q Y A * Q N H N H I F * W Q I W I T F N I L R F Tsp4CI* |BdaI |BdaI TspEI || AlwNI | MseI AluI || | Hpy188I | | ApoI CviJI || | | MlyI TspEI | | TspEI | SetI || | | PleI \ \ \ \ \ \ \\ \ \ \ CTTCAATTCCCAACTCCCAAGCAATTAAATTTGGTAGCTGAAAATACAGTTTCTGAAACT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGTTAAGGGTTGAGGGTTCGTTAATTTAAACCATCGACTTTTATGTCAAAGACTTTGA / // / / / / / / // TspEI || | | CviJI | | | |PleI || | | AluI | | | MlyI || | SetI | | Hpy188I || TspEI | AlwNI || ApoI Tsp4CI* |MseI BdaI TspEI BdaI L Q F P T P K Q L N L V A E N T V S E T F N S Q L P S N * I W * L K I Q F L K L S I P N S Q A I K F G S * K Y S F * N * ----:----|----:----|----:----|----:----|----:----|----:----| S * N G V G L C N F K T A S F V T E S V V E I G L E W A I L N P L Q F Y L K Q F K L E W S G L L * I Q Y S F I C N R F S Hpy166II | BspCNI | |BseMII | ||BdaI | ||BdaI | |||MnlI | |||| Hin6I | |||| |GlaI | |||| ||HhaI | |||| ||FnuDII* | |||| ||| BsmAI HinfI | |||| ||| | SetI | DdeI | |||| ||| | |TsoI MseI \ \ \ \\\\ \\\ \ \\ \ GACGACTCTCAGTTTACCAATGTTGAGCGCGAGGTTAGAGACTTATGGTTAAGTATATTA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGAGAGTCAAATGGTTACAACTCGCGCTCCAATCTCTGAATACCAATTCATATAAT / / / /// / /// / / / / / | | | ||| | ||| | | BsmAI MseI SetI | | | ||| | ||| | TsoI | | | ||| | ||| SetI | | | ||| | ||FnuDII* | | | ||| | ||Hin6I | | | ||| | |GlaI | | | ||| | HhaI | | | ||| MnlI | | | ||BdaI | | | ||BdaI | | | |BseMII | | | BspCNI | | Hpy166II | DdeI HinfI D D S Q F T N V E R E V R D L W L S I L T T L S L P M L S A R L E T Y G * V Y Y R L S V Y Q C * A R G * R L M V K Y I T ----:----|----:----|----:----|----:----|----:----|----:----| S S E * N V L T S R S T L S K H N L I N Q R S E T * W H Q A R P * L S I T L Y I V V R L K G I N L A L N S V * P * T Y * CviJI | Cac8I | | HphI TfiI SetI SetI | | | AlwNI SfaNI HinfI TaqI | TsoI \ \ \ \ \ \ \ \ \ \ CCTACCAAGCCAGCATCTGTATCACCAGATGATTCGTTTTTCGATTTAGGTGGTCATTCT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GGATGGTTCGGTCGTAGACATAGTGGTCTACTAAGCAAAAAGCTAAATCCACCAGTAAGA / / / / / / / / | | AlwNI SfaNI HinfI | SetI TsoI | | HphI TfiI TaqI | Cac8I CviJI P T K P A S V S P D D S F F D L G G H S L P S Q H L Y H Q M I R F S I * V V I L Y Q A S I C I T R * F V F R F R W S F Y ----:----|----:----|----:----|----:----|----:----|----:----| G V L G A D T D G S S E N K S K P P * E V * W A L M Q I V L H N T K R N L H D N R G L W C R Y * W I I R K E I * T T M R TseI AluI CviJI |BisI BbvI ||BlsI | MseI ||SetI CviJI | SetI |||CviRI* \ \ \ \\\\ ATCTTGGCTACCAAAATGATTTTTACCTTAAAGAAAAAGCTGCAAGTTGATTTACCATTG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAACCGATGGTTTTACTAAAAATGGAATTTCTTTTTCGACGTTCAACTAAATGGTAAC / / / / //// / CviJI SetI MseI | |||CviRI* BseSI BbvI | |||TseI SduI | ||BisI | |BlsI | CviJI | AluI SetI I L A T K M I F T L K K K L Q V D L P L S W L P K * F L P * R K S C K L I Y H W L G Y Q N D F Y L K E K A A S * F T I G ----:----|----:----|----:----|----:----|----:----|----:----| I K A V L I I K V K F F F S C T S K G N * R P * W F S K * R L S F A A L Q N V M D Q S G F H N K G * L F L Q L N I * W Q BciVI | StuI | CviJI | HaeIII | | MwoI | | |AciI | | |BisI | | |SecI* | | |DsaI* | | ||BlsI | | |||AciI | | |||TauI | | |||FnuDII* | | |||NspBII* SduI | | ||||SacII BseSI | | ||||| MmeI TspEI |TspEI | | ||||| |TspEI | MseI \\ \ \ \\\\\ \\ \ \ GGCACAATTTTCAAGTATCCAACGATAAAGGCCTTTGCCGCGGAAATTGACAGAATTAAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTGTTAAAAGTTCATAGGTTGCTATTTCCGGAAACGGCGCCTTTAACTGTCTTAATTT / / / / ////// / // / TspEI BciVI | | |||||DsaI* TspEI || Bce83I* | | |||||SecI* |MseI | | |||||AciI TspEI | | ||||MmeI | | |||NspBII* | | |||FnuDII* | | |||AciI | | ||SacII | | ||BisI | | |BlsI | | TauI | MwoI HaeIII CviJI StuI G T I F K Y P T I K A F A A E I D R I K A Q F S S I Q R * R P L P R K L T E L N H N F Q V S N D K G L C R G N * Q N * I ----:----|----:----|----:----|----:----|----:----|----:----| P V I K L Y G V I F A K A A S I S L I L P C L K * T D L S L P R Q R P F Q C F * A C N E L I W R Y L G K G R F N V S N F SetI MboI | TaqI CviRI* | DpnI | | HphI | TspEI | |BstKTI | | Hpy99I | TspRI | || SmlI | | | MaeIII | | MwoI | || |MnlI | | | Tsp45I | | BstAPI Bce83I* | || |BinI* SetI | | | | BtsI | | | AciI \ \ \\ \\ \ \ \ \ \ \ \ \ \ \ TCATCGGGTGGATCATCTCAAGGTGAGGTCGTCGAAAATGTCACTGCAAATTATGCGGAA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGCCCACCTAGTAGAGTTCCACTCCAGCAGCTTTTACAGTGACGTTTAATACGCCTT // / / /// / / // / / / / / // || | | ||| | | |TaqI | | | | | |MwoI || | | ||| | | HphI | | | | | AciI || | | ||| | Hpy99I | | | | TspEI || | | ||| SetI | | | BstAPI || | | ||SmlI | | | MwoI || | | |SetI | | CviRI* || | | BinI* | Tsp45I || | MnlI | MaeIII || MboI TspRI |DpnI BtsI BstKTI S S G G S S Q G E V V E N V T A N Y A E H R V D H L K V R S S K M S L Q I M R K I G W I I S R * G R R K C H C K L C G R ----:----|----:----|----:----|----:----|----:----|----:----| D D P P D D * P S T T S F T V A F * A S I M P H I M E L H P R R F H * Q L N H P * R T S * R L T L D D F I D S C I I R F MwoI AvaI |AcyI XhoI || BbvII* SmlI || | HgaI Hpy178III* || | TspEI |TaqI || | MboII |BmeT110I || | | BstXI ||Hpy178III* || | | |Esp3I Csp6I ||| MnlI || | | |BsmAI HgaI |RsaI ||| |SspI \\ \ \ \\ \ \\ \\\ \\ GACGCCAAGAAATTGGTTGAGACGCTACCAAGTTCGTACCCCTCTCGAGAATATTTTGTT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGGTTCTTTAACCAACTCTGCGATGGTTCAAGCATGGGGAGAGCTCTTATAAAACAA / // // / / // /// / / | || || BsmAI | |Csp6I ||| | SspI | || || Esp3I | RsaI ||| MnlI | || |HgaI HgaI ||Hpy178III* | || TspEI ||SmlI | |BbvII* ||XhoI | |MboII ||AvaI | BstXI |BmeT110I AcyI |TaqI Hpy178III* D A K K L V E T L P S S Y P S R E Y F V T P R N W L R R Y Q V R T P L E N I L L R Q E I G * D A T K F V P L S R I F C * ----:----|----:----|----:----|----:----|----:----|----:----| S A L F N T S V S G L E Y G E R S Y K T L R W S I P Q S A V L N T G R E L I N Q V G L F Q N L R * W T R V G R S F I K N MaeIII | AgeI | BetI* | Cfr10I TspEI | |HpaII SetI | MseI | || MaeIII | Hin4II* | VspI | || Tsp45I \ \ \ \ \ \\ \ GAACCTAATAGTGCCGAAGGAAAAACAACAATTAATGTGTTTGTTACCGGTGTCACAGGA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGATTATCACGGCTTCCTTTTTGTTGTTAATTACACAAACAATGGCCACAGTGTCCT / / // / // / SetI Hin4II* |VspI | || Tsp45I |MseI | || MaeIII TspEI | |Cfr10I | |BetI* | |AgeI | HpaII MaeIII E P N S A E G K T T I N V F V T G V T G N L I V P K E K Q Q L M C L L P V S Q D T * * C R R K N N N * C V C Y R C H R I ----:----|----:----|----:----|----:----|----:----|----:----| S G L L A S P F V V I L T N T V P T V P Q V * Y H R L F F L L * H T Q * R H * L F R I T G F S F C C N I H K N G T D C S CviJI |NlaIV ||SduI MaeII ||HgiJII* | SetI SfeI* FokI ||| BseGI CviRI* | TaiI | Tsp4CI* \ \\\ \ \ \ \ \ \ TTTCTGGGCTCCTACATCCTTGCAGATTTGTTAGGACGTTCTCCAAAGAACTACAGTTTC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGACCCGAGGATGTAGGAACGTCTAAACAATCCTGCAAGAGGTTTCTTGATGTCAAAG // // / / / / // || || BseGI CviRI* | MaeII |SfeI* || |NlaIV TaiI Tsp4CI* || CviJI SetI |HgiJII* |SduI FokI F L G S Y I L A D L L G R S P K N Y S F F W A P T S L Q I C * D V L Q R T T V S S G L L H P C R F V R T F S K E L Q F Q ----:----|----:----|----:----|----:----|----:----|----:----| N R P E * M R A S K N P R E G F F * L K I E P S R C G Q L N T L V N E L S S C N K Q A G V D K C I Q * S T R W L V V T E BseGI MaeII | TseI |BtrI | AluI || SetI | CviJI || TaiI | |BisI || BsiYI* | ||BlsI || |BsiYI* | ||SetI || || AsuI* | |||FokI || || |BmgT120I | |||CviRI* || || ||CviJI | |||| MwoI || || ||HaeIII | |||| MboII || || |||StyI | |||| |TspDTI || || |||SecI* | |||| || CviRI* || || ||||BbvI | |||| || | BspMI HphI \\ \\ \\\\\ \ \\\\ \\ \ \ \ AAAGTGTTTGCCCACGTCAGGGCCAAGGATGAAGAAGCTGCATTTGCAAGATTACAAAAG 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCACAAACGGGTGCAGTCCCGGTTCCTACTTCTTCGACGTAAACGTTCTAATGTTTTC //// // // / / //// / / / / / |||MaeII || || | | |||| | | CviRI* | HphI ||BsiYI* || || | | |||| | FokI BspMI ||BtrI || || | | |||| TspDTI |BsiYI* || || | | |||| MboII TaiI || || | | |||CviRI* SetI || || | | |||MwoI || || | | |||TseI || || | | ||BisI || || | | |BlsI || || | | CviJI || || | | AluI || || | SetI || || BseGI || |BbvI || SecI* || StyI |AsuI* BmgT120I HaeIII CviJI K V F A H V R A K D E E A A F A R L Q K K C L P T S G P R M K K L H L Q D Y K R S V C P R Q G Q G * R S C I C K I T K G ----:----|----:----|----:----|----:----|----:----|----:----| L T N A W T L A L S S S A A N A L N C F * L T Q G R * P W P H L L Q M Q L I V F F H K G V D P G L I F F S C K C S * L L SetI SspI | BcgI | MseI | |Csp6I ApoI | |MnlI SetI | ||RsaI TspEI | || BcgI \ \ \\\ \ \ \\ \ GCAGGTATCACCTATGGTACTTGGAACGAAAAATTTGCCTCAAATATTAAAGTTGTATTA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCCATAGTGGATACCATGAACCTTGCTTTTTAAACGGAGTTTATAATTTCAACATAAT / / / // / / /// SetI SetI | |Csp6I TspEI | ||MseI | RsaI ApoI | |BcgI BcgI | MnlI SspI A G I T Y G T W N E K F A S N I K V V L Q V S P M V L G T K N L P Q I L K L Y * R Y H L W Y L E R K I C L K Y * S C I R ----:----|----:----|----:----|----:----|----:----|----:----| A P I V * P V Q F S F N A E F I L T T N P L Y * R H Y K S R F I Q R L Y * L Q I C T D G I T S P V F F K G * I N F N Y * CviJI Hpy188I | TspEI | BccI BseGI FokI \ \ \ \ \ \ GGCGATTTATCTAAAAGCCAATTTGGTCTTTCAGATGAGAAGTGGATGGATTTGGCAAAC 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTAAATAGATTTTCGGTTAAACCAGAAAGTCTACTCTTCACCTACCTAAACCGTTTG / / / / / CviJI TspEI Hpy188I BccI BseGI G D L S K S Q F G L S D E K W M D L A N A I Y L K A N L V F Q M R S G W I W Q T R F I * K P I W S F R * E V D G F G K H ----:----|----:----|----:----|----:----|----:----|----:----| P S K D L L W N P R E S S F H I S K A F L R N I * F G I Q D K L H S T S P N P L A I * R F A L K T K * I L L P H I Q C V Hpy166II | BsrI | TspRI | | BfiI MnlI Tsp4CI* TspEI MslI | | | NdeI | TspEI \ \ \ \ \ \ \ \ \ ACAGTTGATATAATTATCCATAATGGTGCGTTAGTTCACTGGGTTTATCCATATGCCAAA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCAACTATATTAATAGGTATTACCACGCAATCAAGTGACCCAAATAGGTATACGGTTT // / / / / / / / / // |Tsp4CI* TspEI MslI | | BsrI BfiI | | |BsiYI* FokI | Hpy166II | | AjuI TspRI | MnlI NdeI T V D I I I H N G A L V H W V Y P Y A K Q L I * L S I M V R * F T G F I H M P N S * Y N Y P * W C V S S L G L S I C Q I ----:----|----:----|----:----|----:----|----:----|----:----| V T S I I I W L P A N T * Q T * G Y A L C L Q Y L * G Y H H T L E S P K D M H W C N I Y N D M I T R * N V P N I W I G F BinI* AluI |BsiYI* CviJI ||AjuI |DdeI ||| MboI |EspI* ||| BamHI ||SetI ||| XhoII ||| CviJI ||| | DpnI ||| |AciI ||| | NlaIV ||| |BisI Hpy99I ||| | |BstKTI BceAI ||| ||BlsI | Cac8I ||| | || BinI* |AjuI ||| |||TauI | | CviJI \\\ \ \\ \ \\ \\\ \\\\ \ \ \ TTGAGGGATCCAAATGTTATTTCAACTATCAATGTTATGAGCTTAGCCGCCGTCGGCAAG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCCCTAGGTTTACAATAAAGTTGATAGTTACAATACTCGAATCGGCGGCAGCCGTTC / // / / / / / / ////// / / | || | BinI* AjuI | | | |||||Hpy99I | CviJI | || XhoII | | | ||||AciI Cac8I | || BamHI | | | |||BisI | || MboI | | | ||BlsI | |NlaIV | | | |CviJI | |DpnI | | | |TauI | BstKTI | | | EspI* TspEI | | | DdeI BinI* | | CviJI | | AluI | SetI BceAI L R D P N V I S T I N V M S L A A V G K * G I Q M L F Q L S M L * A * P P S A S E G S K C Y F N Y Q C Y E L S R R R Q A ----:----|----:----|----:----|----:----|----:----|----:----| N L S G F T I E V I L T I L K A A T P L I S P D L H * K L * * H * S S L R R R C Q P I W I N N * S D I N H A * G G D A L MnlI MseI | Hpy178III* TspRI |TspEI \ \ \ \\ CCAAAGTTCTTTGACTTTGTTTCCTCCACTTCTACTCTTGACACTGAATACTACTTTAAT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTCAAGAAACTGAAACAAAGGAGGTGAAGATGAGAACTGTGACTTATGATGAAATTA / / / MnlI Hpy178III* MseI TspRI P K F F D F V S S T S T L D T E Y Y F N Q S S L T L F P P L L L L T L N T T L I K V L * L C F L H F Y S * H * I L L * F ----:----|----:----|----:----|----:----|----:----|----:----| G F N K S K T E E V E V R S V S Y * K L A L T R Q S Q K R W K * E Q C Q I S S * W L E K V K N G G S R S K V S F V V K I BssKI CviJI TfiI EcoRII HinfI | ScrFI | Hpy188I Hpy188I Hin4II* | BseBI | | MseI \ \ \ \ \ \ \ TTGTCAGATAAACTTGTTAGCGAAGGGAAGCCAGGCATTTTAGAATCAGACGATTTAATG 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| AACAGTCTATTTGAACAATCGCTTCCCTTCGGTCCGTAAAATCTTAGTCTGCTAAATTAC / / / / / / // / | Hpy188I Hin4II* | | EcoRII |Hpy188I MseI TspEI | | BssKI HinfI | BseBI TfiI | ScrFI CviJI L S D K L V S E G K P G I L E S D D L M C Q I N L L A K G S Q A F * N Q T I * * V R * T C * R R E A R H F R I R R F N E ----:----|----:----|----:----|----:----|----:----|----:----| K D S L S T L S P F G P M K S D S S K I N T L Y V Q * R L S A L C K L I L R N L Q * I F K N A F P L W A N * F * V I * H FauI | CviRI* | | Cac8I BseMII | | | AciI |BspCNI | | | | Cac8I || TseI | | | | TspDTI || CviJI | | | | | CviJI || |BisI | | | | | | SduI || ||BlsI | | | | | | HgiJII* || ||| DdeI | | | | | | | EcoP15I || ||| | TatI | | | | | | | | BsrI || ||| | |Csp6I | | | | | | | | TspRI BbvI || ||| | ||RsaI \ \ \ \ \ \ \ \ \ \ \\ \\\ \ \\\ AACTCTGCAAGCGGGCTCACTGGTGGATATGGTCAGTCCAAATGGGCTGCTGAGTACATC 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGACGTTCGCCCGAGTGACCACCTATACCAGTCAGGTTTACCCGACGACTCATGTAG // / / / / // / // //// / /// || | | | CviJI |BsrI | || |||| | ||TatI || | | | TspRI EcoP15I | || |||| | |Csp6I || | | HgiJII* | || |||| | RsaI || | | Cac8I | || |||| DdeI || | | SduI | || |||TseI || | | AciI | || ||BisI || | TspDTI | || |BlsI || Cac8I | || CviJI |CviRI* | |BspCNI FauI | BseMII BbvI N S A S G L T G G Y G Q S K W A A E Y I T L Q A G S L V D M V S P N G L L S T S L C K R A H W W I W S V Q M G C * V H H ----:----|----:----|----:----|----:----|----:----|----:----| F E A L P S V P P Y P * D L H A A S Y M S S Q L R A * Q H I H D T W I P Q Q T C V R C A P E S T S I T L G F P S S L V D Hpy188I TaqII | BssKI |AsuI* | SexAI |DraII | EcoRII ||NlaIV | | ScrFI ||BmgT120I | | BseBI AarI |||CviJI | | | MaeIII BspMI |||HaeIII | | | | SetI | MaeII |||| HphI | | | | | MaeII | |BtrI |||| | MaeII | | | | | |BsaAI | || SetI |||| | |BsaAI | | | | | |SnaBI | || TaiI |||| | ||BsgI | | | | | |MaeIII | || |CviRI* |||| | |||SetI | | | | | || SetI | || || SetI |||| | |||TaiI | | | | | || TaiI \ \\ \\ \ \\\\ \ \\\\ \ \ \ \ \ \\ \ ATTAGACGTGCAGGTGAAAGGGGCCTACGTGGGTGTATTGTCAGACCAGGTTACGTAACA 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| TAATCTGCACGTCCACTTTCCCCGGATGCACCCACATAACAGTCTGGTCCAATGCATTGT / // // / /// //// / // / / // / | || |SetI | ||| |||MaeII | || | | || MaeIII | || CviRI* | ||| ||BsaAI | || | | || SetI | |MaeII | ||| |BsgI | || | | |MaeII | BtrI | ||| TaiI | || | | MaeIII BspMI | ||| SetI | || | | SnaBI TaiI | ||DraII | || | | BsaAI SetI | ||AsuI* | || | TaiI AarI | ||HphI | || | SetI | |BmgT120I | || EcoRII | |HaeIII | || SexAI | |CviJI | || BssKI | NlaIV | |BseBI TaqII | |ScrFI | SetI Hpy188I I R R A G E R G L R G C I V R P G Y V T L D V Q V K G A Y V G V L S D Q V T * Q * T C R * K G P T W V Y C Q T R L R N R ----:----|----:----|----:----|----:----|----:----|----:----| M L R A P S L P R R P H I T L G P * T V * * V H L H F P G V H T Y Q * V L N R L N S T C T F P A * T P T N D S W T V Y C HgiCI* | SetI MboII | NlaIV | MnlI SetI \ \ \ \ \ GGTGCCTCTGCCAATGGTTCTTCAAACACAGATGATTTCTTATTGAGATTTTTGAAAGGT 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGGAGACGGTTACCAAGAAGTTTGTGTCTACTAAAGAATAACTCTAAAAACTTTCCA / / / / / | | | MnlI SetI | | MboII | HgiCI* NlaIV G A S A N G S S N T D D F L L R F L K G V P L P M V L Q T Q M I S Y * D F * K V C L C Q W F F K H R * F L I E I F E R F ----:----|----:----|----:----|----:----|----:----|----:----| P A E A L P E E F V S S K K N L N K F P L H R Q W H N K L C L H N R I S I K S L T G R G I T R * V C I I E * Q S K Q F T SetI | TfiI | HinfI | | Hpy178III* | | | EcoRV | | | TspGWI MboI | | | | TaqI | DpnI | | | | | ApoI NlaIV | |FatI TspEI | | | | | TspEI | BsrI | |BstKTI \ \ \ \ \ \ \ \ \ \ \\ TCAGTCCAATTAGGTAAGATTCCAGATATCGAAAATTCCGTGAATATGGTTCCAGTAGAT 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCAGGTTAATCCATTCTAAGGTCTATAGCTTTTAAGGCACTTATACCAAGGTCATCTA / / // / / / / /// TspEI | || | TaqI TspEI NlaIV ||NlaIII SetI | || EcoRV ApoI BsrI |DpnI | |TspGWI BstKTI | Hpy178III* HinfI TfiI S V Q L G K I P D I E N S V N M V P V D Q S N * V R F Q I S K I P * I W F Q * I S P I R * D S R Y R K F R E Y G S S R S ----:----|----:----|----:----|----:----|----:----|----:----| E T W N P L I G S I S F E T F I T G T S N L G I L Y S E L Y R F N R S Y P E L L * D L * T L N W I D F I G H I H N W Y I BceAI | MnlI | | Bce83I* | | | TspEI CviAII MaeII | | | | CfrI | NlaIII | SetI TfiI | | | | | CviJI | | BsiI* | TaiI HinfI | | | | | HaeIII \ \ \ \ \ \ \ \ \ \ \ \ CATGTTGCTCGTGTTGTTGTTGCTACGTCTTTGAATCCTCCCAAAGAAAATGAATTGGCC 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| GTACAACGAGCACAACAACAACGATGCAGAAACTTAGGAGGGTTTCTTTTACTTAACCGG / // / / / / // / / / / | |FatI BsiI* | MaeII HinfI || Bce83I* | | CfrI | CviAII TaiI TfiI |MnlI | HaeIII MboI SetI BceAI | CviJI TspEI H V A R V V V A T S L N P P K E N E L A M L L V L L L L R L * I L P K K M N W P C C S C C C C Y V F E S S Q R K * I G R ----:----|----:----|----:----|----:----|----:----|----:----| * T A R T T T A V D K F G G L S F S N A D H Q E H Q Q Q * T K S D E W L F H I P M N S T N N N S R R Q I R G F F I F Q G SmlI AccI TspDTI MaeIII |BssNAI | MaeIII Tsp45I |Hpy166II | |HphI BstEII SspI TaqII || TsoI \ \\ \ \ \ \\ \ GTTGCTCAAGTAACGGGTCACCCAAGAATATTATTCAAAGACTACTTGTATACTTTACAC 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGAGTTCATTGCCCAGTGGGTTCTTATAATAAGTTTCTGATGAACATATGAAATGTG / / / / / / // / | SmlI MaeIII BstEII | TaqII || TsoI | HphI Tsp45I SspI |AccI TspDTI MaeIII Hpy166II BssNAI V A Q V T G H P R I L F K D Y L Y T L H L L K * R V T Q E Y Y S K T T C I L Y T C S S N G S P K N I I Q R L L V Y F T R ----:----|----:----|----:----|----:----|----:----|----:----| T A * T V P * G L I N N L S * K Y V K C R Q E L L P D G L F I I * L S S T Y K V N S L Y R T V W S Y * E F V V Q I S * V AluI CviJI | SetI HgaI MboII MslI MaeIII TaqI TaqI | | AjuI |MnlI | AcyI \ \ \ \ \ \ \ \\ \ \ GATTATGGTTACGATGTCGAAATCGAAAGCTATTCTAAATGGAAGAAATCATTGGAGGCG 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATACCAATGCTACAGCTTTAGCTTTCGATAAGATTTACCTTCTTTAGTAACCTCCGC / / / / / / / // / MslI MaeIII TaqI | | CviJI MnlI |MboII AcyI | | AluI HgaI | | AjuI | SetI TaqI D Y G Y D V E I E S Y S K W K K S L E A I M V T M S K S K A I L N G R N H W R R L W L R C R N R K L F * M E E I I G G V ----:----|----:----|----:----|----:----|----:----|----:----| S * P * S T S I S L * E L H F F D N S A R N H N R H R F R F S N * I S S I M P P I I T V I D F D F A I R F P L F * Q L R BciVI | FatI | |CviAII MboII | || NlaIII AjuI |TspDTI | || | DdeI \ \\ \ \\ \ \ TCTGTTATTGACAGGAATGAAGAAAATGCGTTGTATCCTTTGCTACACATGGTCTTAGAC 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| AGACAATAACTGTCCTTACTTCTTTTACGCAACATAGGAAACGATGTGTACCAGAATCTG / / / / // / AjuI TspDTI | | |FatI DdeI MboII | | CviAII | NlaIII BciVI S V I D R N E E N A L Y P L L H M V L D L L L T G M K K M R C I L C Y T W S * T C Y * Q E * R K C V V S F A T H G L R Q ----:----|----:----|----:----|----:----|----:----|----:----| D T I S L F S S F A N Y G K S C M T K S T Q * Q C S H L F H T T D K A V C P R L R N N V P I F F I R Q I R Q * V H D * V AluI CviJI | SetI | BetI* | BspMII* | |HpaII | |Hpy178III* | || MaeI BsaXI Csp6I | || BceAI SecI* MseI | SetI |RsaI | || | BsaXI DsaI* |AhaIII* \ \ \\ \ \\ \ \ \ \\ AACTTACCTGAAAGTACCAAAGCTCCGGAACTAGACGATAGGAACGCCGTGGCATCTTTA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAATGGACTTTCATGGTTTCGAGGCCTTGATCTGCTATCCTTGCGGCACCGTAGAAAT / / // / / // / / // | SetI || | | || BsaXI DsaI* |MseI BsaXI || | | || BceAI SecI* AhaIII* || | | || MaeI || | | |BspMII* || | | |BetI* || | | Hpy178III* || | | HpaII || | CviJI || | AluI || SetI |Csp6I RsaI N L P E S T K A P E L D D R N A V A S L T Y L K V P K L R N * T I G T P W H L * L T * K Y Q S S G T R R * E R R G I F K ----:----|----:----|----:----|----:----|----:----|----:----| L K G S L V L A G S S S S L F A T A D K C S V Q F Y W L E P V L R Y S R R P M K V * R F T G F S R F * V I P V G H C R * SetI AciI MaeIII | FatI | Ksp632I* | |CviAII GsuI | |MnlI SfaNI | || NlaIII SetI Eco57MI | ||Hpy178III* \ \ \\ \ \ \ \ \\\ AAGAAAGACACCGCATGGACAGGTGTTGATTGGTCTAATGGAATAGGTGTTACTCCAGAA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTCTGTGGCGTACCTGTCCACAACTAACCAGATTACCTTATCCACAATGAGGTCTT / / // / / / / // SfaNI | || SetI Eco57MI SetI | |Hpy178III* | |FatI GsuI | Ksp632I* | CviAII MaeIII NlaIII MnlI AciI K K D T A W T G V D W S N G I G V T P E R K T P H G Q V L I G L M E * V L L Q K E R H R M D R C * L V * W N R C Y S R R ----:----|----:----|----:----|----:----|----:----|----:----| F F S V A H V P T S Q D L P I P T V G S L S L C R M S L H Q N T * H F L H * E L L F V G C P C T N I P R I S Y T N S W F MboII | MmeI | | CviRI* | | | MseI SetI | | | |AhaIII* SetI SetI MnlI \ \ \ \ \\ \ \ \ GAGGTTGGTATATATATTGCATTTTTAAACAAGGTTGGATTTTTACCTCCACCAACTCAT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCAACCATATATATAACGTAAAAATTTGTTCCAACCTAAAAATGGAGGTGGTTGAGTA / / / / // / / / SetI | MmeI CviRI* || SetI SetI MnlI MboII |MseI AhaIII* E V G I Y I A F L N K V G F L P P P T H R L V Y I L H F * T R L D F Y L H Q L I G W Y I Y C I F K Q G W I F T S T N S * ----:----|----:----|----:----|----:----|----:----|----:----| S T P I Y I A N K F L T P N K G G G V * L P Q Y I Y Q M K L C P Q I K V E V L E L N T Y I N C K * V L N S K * R W W S M Hin6I |GlaI ||HhaI TspRI ||| Eco57I BtsI Bce83I* SmlI ||| Eco57MI MaeI \ \ \ \\\ \ \ AATGACAAACTTCCACTGCCAAGTATAGAACTAACTCAAGCGCAAATAAGTCTAGTTGCT 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTGTTTGAAGGTGACGGTTCATATCTTGATTGAGTTCGCGTTTATTCAGATCAACGA / / //// / TspRI Bce83I* |||Eco57MI MaeI BtsI |||Eco57I |||Hin6I ||GlaI |HhaI SmlI N D K L P L P S I E L T Q A Q I S L V A M T N F H C Q V * N * L K R K * V * L L * Q T S T A K Y R T N S S A N K S S C F ----:----|----:----|----:----|----:----|----:----|----:----| L S L S G S G L I S S V * A C I L R T A Y H C V E V A L Y L V L E L A F L D L Q I V F K W Q W T Y F * S L R L Y T * N S AluI CviJI | SetI | |AciI | || TseI | || |BisI | || ||BlsI | || |||TseI | || ||||BisI | || |||||BlsI | || ||||||AluI MwoI BsiI* | || ||||||CviJI | SetI |SduI | || ||||||| MseI | |AlwNI |HgiAI* | || ||||||| SetI \ \\ \\ \ \\ \\\\\\\ \ TCAGGTGCTGGTGCTCGTGGAAGCTCCGCAGCAGCTTAA 4150 4160 4170 ----:----|----:----|----:----|----:---- AGTCCACGACCACGAGCACCTTCGAGGCGTCGTCGAATT // / / / / / /////// / || AlwNI HgiAI* | | | ||||||| MseI |SetI SduI | | | ||||||CviJI MwoI | | | ||||||TseI | | | ||||||AluI | | | |||||BisI | | | ||||BlsI | | | ||||SetI | | | |||TseI | | | ||BisI | | | |BlsI | | | AciI | | CviJI | | AluI | SetI BsiI* S G A G A R G S S A A A * Q V L V L V E A P Q Q L X R C W C S W K L R S S L X ----:----|----:----|----:----|----:---- E P A P A R P L E A A A * K L H Q H E H F S R L L K * T S T S T S A G C C S L # Enzymes that cut Frequency Isoschizomers AarI 3 Acc65I 2 Asp718I AccI 2 FblI,XmiI AciI 13 BspACI,SsiI AclI 1 Psp1406I AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AgeI 2 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 4 AlfI 2 AluI 20 AluBI AlwNI 3 CaiI ApoI 9 AcsI,XapI AsuI* 8 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 5 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvCI 1 BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 4 BpuEI BceAI 5 BcgI 1 BciVI 3 BfuI BclI 4 FbaI,Ksp22I BdaI 12 BetI* 3 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 8 AlwI,BspPI,AclWI BisI 10 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 10 BmeT110I 1 BmgT120I 8 BmtI 2 BspOI Bpu10I 1 BsaAI 3 BstBAI,Ppu21I BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 9 BstF5I,BtsCI BseMII 6 BseSI 2 BaeGI,BstSLI BseYI 1 BsgI 3 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 6 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 6 BspHI 1 CciI,PagI,RcaI BspMI 4 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrI 6 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 16 BstXI 1 BtgZI 1 BtrI 2 BmgBI,AjiI BtsI 2 Cac8I 9 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 10 CviQI,RsaNI CspCI 2 CviAII 10 CviJI 50 CviKI-1 CviRI* 15 HpyCH4V DdeI 14 BstDEI,HpyF3I DpnI 16 MalI DraII 2 EcoO109I DraIII 1 AdeI DsaI* 3 BtgI,BstDSI Eco57I 2 AcuI Eco57MI 3 EcoP15I 4 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI EspI* 3 Bpu1102I,Bsp1720I,CelII,BlpI FatI 10 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 9 FspAI 1 GlaI 5 GsaI 1 GsuI 1 BpmI HaeIII 8 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 5 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 7 HpyAV Hin6I 5 HinP1I,HspAI HindII 1 HincII HinfI 11 HpaI 1 KspAI HpaII 5 HapII,BsiSI,MspI HphI 13 AsuHPI Hpy166II 11 Hpy8I Hpy178III* 16 Hpy188III Hpy188I 10 Hpy99I 2 KpnI 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 7 FspBI,BfaI,XspI MaeII 10 HpyCH4IV MaeIII 20 MboI 16 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 4 MunI MlyI 2 SchI MmeI 9 MnlI 20 MroNI 1 NgoMIV MseI 26 Tru1I,Tru9I MslI 3 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 8 HpyF10VI,BstMWI NaeI 1 PdiI NcoI 1 Bsp19I NdeI 2 FauNDI NheI 2 AsuNHI NlaIII 10 Hin1II,Hsp92II,FaeI NlaIV 12 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 2 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PvuI 1 MvrI,Ple19I,BpvUI RsaI 10 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 9 BseDI,BssECI,BsaJI SetI 76 SexAI 1 MabI SfaNI 4 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 6 SmoI SnaBI 1 Eco105I,BstSNI SpeI 2 BcuI,AhlI SspI 5 StuI 1 Eco147I,PceI,SseBI,AatI StyI 7 Eco130I,EcoT14I,ErhI,BssT1I TaiI 10 TaqI 11 TaqII 4 TatI 2 TauI 2 TfiI 9 PfeI TseI 8 ApeKI TsoI 7 Tsp45I 6 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 44 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 8 TscAI VspI 1 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AflIII AloI ApaI ApaLI AscI AvrII BaeI BalI BarI BglI BplI BsaBI BsePI BseRI BsmI Bsp120I BspLU11I* BsrDI Cfr9I ClaI DinI DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoT22I EgeI EheI FalI FseI HaeII HindIII KasI MauBI MluI Mph1103I NarI NmeAIII NotI NsiI OliI PacI PasI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuII RsrII SacI SalI SanDI SapI ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI TstI Tth111I XbaI XcmI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769