Restriction Map of IML3/YBR107C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

IML3/YBR107C on chromosome II from coordinates 454530 to 453793.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.13088

EMBOSS_001 TfiI BsrI HinfI Cac8I TspRI \ \ \ ATGCCTTATACTTGGAAGTTTTTAGGAATCAGCAAGCAACTTTCACTGGAAAATGGTATA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGAATATGAACCTTCAAAAATCCTTAGTCGTTCGTTGAAAGTGACCTTTTACCATAT / / / / | Cac8I TspRI BsrI HinfI TfiI M P Y T W K F L G I S K Q L S L E N G I C L I L G S F * E S A S N F H W K M V * A L Y L E V F R N Q Q A T F T G K W Y S ----:----|----:----|----:----|----:----|----:----|----:----| X G * V Q F N K P I L L C S E S S F P I X A K Y K S T K L F * C A V K V P F H Y H R I S P L K * S D A L L K * Q F I T Y BssKI EcoRII TaqI | ScrFI | BfiI MfeI | BseBI | | Csp6I TspEI | |SetI | | |RsaI \ \ \\ \ \ \\ GCAAAGTTGAACCAATTGCTAAACCTGGAAGTAGATTTAGACATTCAAACCATTCGAGTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTCAACTTGGTTAACGATTTGGACCTTCATCTAAATCTGTAAGTTTGGTAAGCTCAT / / / / // // | | | EcoRII || |Csp6I | | | BssKI || |TspRI | | BseBI || |BsrI | | ScrFI || RsaI | SetI |TaqI TspEI BfiI MfeI A K L N Q L L N L E V D L D I Q T I R V Q S * T N C * T W K * I * T F K P F E Y K V E P I A K P G S R F R H S N H S S T ----:----|----:----|----:----|----:----|----:----|----:----| A F N F W N S F R S T S K S M * V M R T L L T S G I A L G P L L N L C E F W E L C L Q V L Q * V Q F Y I * V N L G N S Y BinI* |BsrI || MboI || |BccI || ||DpnI || |||TspRI || |||BstKTI || ||||Hpy178III* || ||||| BsiYI* || ||||| | Acc65I || ||||| | HgiCI* || ||||| | |Csp6I || ||||| | ||RsaI || ||||| | ||NlaIV || ||||| | ||| AciI || ||||| | ||| KpnI || ||||| | ||| | AciI || ||||| | ||| | BisI || ||||| | ||| | |BlsI || ||||| | ||| | ||TauI || ||||| | ||| | ||NspBII* MaeIII || ||||| | ||| | ||| TspGWI MmeI | MnlI SetI \\ \\\\\ \ \\\ \ \\\ \ \ \ \ \ CCCAGTGATCCTGATGGTGGTACCGCCGCTGACGAGTATATCCGTTACGAAATGAGGTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTCACTAGGACTACCACCATGGCGGCGACTGCTCATATAGGCAATGCTTTACTCCAAC / // / // / /// ///// / / / / | || | || | ||| ||||TspGWI MmeI | | SetI | || | || | ||| |||NspBII* | MaeIII | || | || | ||| |||AciI MnlI | || | || | ||| ||BisI | || | || | ||| |BlsI | || | || | ||| AciI | || | || | ||| TauI | || | || | ||HgiCI* | || | || | ||Acc65I | || | || | |Csp6I | || | || | NlaIV | || | || | RsaI | || | || KpnI | || | |BsiYI* | || | Hpy178III* | || MboI | |DpnI | |BccI | BstKTI BinI* P S D P D G G T A A D E Y I R Y E M R L P V I L M V V P P L T S I S V T K * G W Q * S * W W Y R R * R V Y P L R N E V G ----:----|----:----|----:----|----:----|----:----|----:----| G L S G S P P V A A S S Y I R * S I L N V W H D Q H H Y R R Q R T Y G N R F S T G T I R I T T G G S V L I D T V F H P Q SduI BseSI TspEI | TspDTI | MnlI | | DdeI MnlI \ \ \ \ \ \ GACATCTCTAATTTAGATGAGGGCACTTACTCTAAGTTCATTTTCTTGGGGAACTCAAAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAGAGATTAAATCTACTCCCGTGAATGAGATTCAAGTAAAAGAACCCCTTGAGTTTT / / / / / / | TspEI | TspDTI DdeI MnlI MnlI BseSI SduI D I S N L D E G T Y S K F I F L G N S K T S L I * M R A L T L S S F S W G T Q K H L * F R * G H L L * V H F L G E L K N ----:----|----:----|----:----|----:----|----:----|----:----| S M E L K S S P V * E L N M K K P F E F P C R * N L H P C K S * T * K R P S S L V D R I * I L A S V R L E N E Q P V * F HgiCI* | SetI AciI | NlaIV FauI AciI | BslFI BsrDI CviRI* \ \ \ \ \ \ \ \ ATGGAGGTGCCGATGTTTTTGTGCTATTGCGGGACAGATAACCGCAATGAAGTGGTATTG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTCCACGGCTACAAAAACACGATAACGCCCTGTCTATTGGCGTTACTTCACCATAAC / / / / / / / / / / | | HgiCI* FauI AciI AciI BslFI | | TspDTI | NlaIV BsrDI | | CviRI* SetI | TspRI BarI M E V P M F L C Y C G T D N R N E V V L W R C R C F C A I A G Q I T A M K W Y C G G A D V F V L L R D R * P Q * S G I A ----:----|----:----|----:----|----:----|----:----|----:----| I S T G I N K H * Q P V S L R L S T T N F P P A S T K T S N R S L Y G C H L P I H L H R H K Q A I A P C I V A I F H Y Q Csp6I |RsaI BarI || Tsp4CI* |TspDTI || | Eco57I ||Hin4II* || | Eco57MI ||| CviJI || | | BarI ||| AlwNI || | | |CfrI ||| |BtsI || | | || CviJI ApoI FatI ||| |TspRI || | | || HaeIII TspEI |CviAII \\\ \\ \\ \ \ \\ \ \ \\ CAGTGGCTGAAGGCAGAGTACGGTGTCATTATGTGGCCGATAAAATTTGAACAGAAGACC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTCACCGACTTCCGTCTCATGCCACAGTAATACACCGGCTATTTTAAACTTGTCTTCTGG // // /// / / / / / / || |CviJI ||| | BarI | CfrI TspEI NlaIII || BtsI ||| Eco57MI HaeIII ApoI |AlwNI ||| Eco57I CviJI Hin4II* ||Tsp4CI* |Csp6I RsaI Q W L K A E Y G V I M W P I K F E Q K T S G * R Q S T V S L C G R * N L N R R P V A E G R V R C H Y V A D K I * T E D H ----:----|----:----|----:----|----:----|----:----|----:----| C H S F A S Y P T M I H G I F N S C F V A T A S P L T R H * * T A S L I Q V S S L P Q L C L V T D N H P R Y F K F L L G AluI CviJI | SetI | | AcyI | | | Cac8I | | | | HgaI | | | | | ApaLI | | | | | | CviRI* | | | | | | Hpy166II | | | | | | | SduI | | | | | | | MaeII | | | | | | | BseSI | | | | | | | HgiAI* | | | | | | | |BsaAI BbvII* | | | | | | | |MaeIII | NlaIII | | | | | | | || SetI | | MboII | | | | | | | || TaiI TaqI TspEI \ \ \ \ \ \ \ \ \ \ \\ \ \ \ ATGATAAAGTTAGCTGACGCCAGCATTGTGCACGTAACGAAAGAGAACATCGAACAAATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TACTATTTCAATCGACTGCGGTCGTAACACGTGCATTGCTTTCTCTTGTAGCTTGTTTAA // / / / / / / ///// / / / || | | CviJI | Cac8I | ||||| MaeIII TaqI TspEI || | | AluI AcyI | ||||MaeII SetI || | SetI | |||BsaAI || BbvII* | ||ApaLI || MboII | |TaiI |FatI | |SetI CviAII | Hpy166II | CviRI* | HgaI HgiAI* BseSI SduI M I K L A D A S I V H V T K E N I E Q I * * S * L T P A L C T * R K R T S N K L D K V S * R Q H C A R N E R E H R T N Y ----:----|----:----|----:----|----:----|----:----|----:----| M I F N A S A L M T C T V F S F M S C I W S L T L Q R W C Q A R L S L S C R V F H Y L * S V G A N H V Y R F L V D F L N BssKI SexAI AciI EcoRII |BisI | ScrFI AluI ||BlsI | BseBI CviJI |||TauI | |SetI | SetI ||||TspEI \ \\ \ \ \\\\\ ACCTGGTTTAGCTCAAAGTTATATTTTGAACCAGAAACACAAGACAAAAACTTGCGGCAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGGACCAAATCGAGTTTCAATATAAAACTTGGTCTTTGTGTTCTGTTTTTGAACGCCGTT / / / / /// | | | CviJI ||BisI | | | AluI ||AciI | | SetI |BlsI | EcoRII TauI | SexAI | BssKI BseBI ScrFI T W F S S K L Y F E P E T Q D K N L R Q P G L A Q S Y I L N Q K H K T K T C G N L V * L K V I F * T R N T R Q K L A A I ----:----|----:----|----:----|----:----|----:----|----:----| V Q N L E F N Y K S G S V C S L F K R C * R T * S L T I N Q V L F V L C F S A A G P K A * L * I K F W F C L V F V Q P L MnlI | AluI | CviJI | | SetI TsoI CviJI CviJI \ \ \ \ \ \ TTCAGTATAGAAATACCGAGAGAAAGCTGTGAGGGTTTGGCTCTTGGCTATGGTAATACT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTCATATCTTTATGGCTCTCTTTCGACACTCCCAAACCGAGAACCGATACCATTATGA / // / / / / TspEI || CviJI TsoI CviJI CviJI || AluI |SetI MnlI F S I E I P R E S C E G L A L G Y G N T S V * K Y R E K A V R V W L L A M V I L Q Y R N T E R K L * G F G S W L W * Y Y ----:----|----:----|----:----|----:----|----:----|----:----| N L I S I G L S L Q S P K A R P * P L V I * Y L F V S L F S H P N P E Q S H Y Y E T Y F Y R S F A T L T Q S K A I T I S CviRI* |MfeI |TspEI AciI CviRI* || Csp6I |BseGI | SfaNI || |RsaI PsiI BccI |TspDTI \ \ \\ \\ \ \ \\ ATGCACCCGTATAACGATGCAATTGTACCCTACATTTATAATGAAACGGGGATGGCGGTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTGGGCATATTGCTACGTTAACATGGGATGTAAATATTACTTTGCCCCTACCGCCAC / / / / // / / / / CviRI* SfaNI | | |Csp6I PsiI BccI | AciI | | RsaI TspDTI | TspEI BseGI | MfeI CviRI* M H P Y N D A I V P Y I Y N E T G M A V C T R I T M Q L Y P T F I M K R G W R W A P V * R C N C T L H L * * N G D G G G ----:----|----:----|----:----|----:----|----:----|----:----| I C G Y L S A I T G * M * L S V P I A T * A G T Y R H L Q V R C K Y H F P S P P H V R I V I C N Y G V N I I F R P H R H TspGWI | Tsp4CI* BdaI BdaI | | HindII BdaI BdaI | | Hpy166II |SduI TfiI FokI | | | PshAI |BseSI HinfI \ \ \ \ \ \\ \ GAAAGATTACCGTTGACTTCCGTCATATTGGCAGGGCACACGAAAATAATGAGAGAATCC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCTAATGGCAACTGAAGGCAGTATAACCGTCCCGTGTGCTTTTATTACTCTCTTAGG / / / / / // / BdaI | | | PshAI |BdaI HinfI BdaI | | Hpy166II |BdaI TfiI | | HindII BseSI | Tsp4CI* SduI TspGWI FokI E R L P L T S V I L A G H T K I M R E S K D Y R * L P S Y W Q G T R K * * E N P K I T V D F R H I G R A H E N N E R I H ----:----|----:----|----:----|----:----|----:----|----:----| S L N G N V E T M N A P C V F I I L S D P F I V T S K R * I P L A C S F L S L I F S * R Q S G D Y Q C P V R F Y H S F G TaqI DdeI BspCNI TatI ClaI MaeIII | Hpy178III* |BseMII |Csp6I | TfiI Tsp45I | |BsmAI ||MaeI ||RsaI | HinfI \ \ \\ \\\ \\\ \ \ ATTGTCACTTCAACACGAAGTCTCAGGAACAGAGTTCTAGCAGTTGTACTCCAATCGATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAGTGAAGTTGTGCTTCAGAGTCCTTGTCTCAAGATCGTCAACATGAGGTTAGCTAA / // / // / /// / / Tsp45I || | || MaeI ||TatI | HinfI MaeIII || | |BseMII |Csp6I | TfiI || | BspCNI RsaI ClaI || BsmAI TaqI |Hpy178III* DdeI I V T S T R S L R N R V L A V V L Q S I L S L Q H E V S G T E F * Q L Y S N R F C H F N T K S Q E Q S S S S C T P I D S ----:----|----:----|----:----|----:----|----:----|----:----| M T V E V R L R L F L T R A T T S W D I W Q * K L V F D * S C L E L L Q V G I S N D S * C S T E P V S N * C N Y E L R N Hpy166II \ CAGTTTACCAGCGAGTAA 730 ----:----|----:--- GTCAAATGGTCGCTCATT / Hpy166II Q F T S E * S L P A S X V Y Q R V X ----:----|----:--- * N V L S Y E T * W R T L K G A L L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 6 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 3 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 1 AcsI,XapI BarI 1 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 BdaI 2 BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BsaAI 1 BstBAI,Ppu21I BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 1 BseSI 3 BaeGI,BstSLI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspCNI 1 BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 1 BtsI 1 Cac8I 2 BstC8I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 5 CviQI,RsaNI CviAII 1 CviJI 7 CviKI-1 CviRI* 4 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 1 MalI Eco57I 1 AcuI Eco57MI 1 EcoRII 2 AjnI,Psp6I,PspGI FatI 1 FauI 1 SmuI FokI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I Hin4II* 1 HpyAV HindII 1 HincII HinfI 3 Hpy166II 3 Hpy8I Hpy178III* 2 Hpy188III KpnI 1 MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 3 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 MfeI 2 MunI MmeI 1 MnlI 4 NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PshAI 1 BstPAI,BoxI PsiI 1 AanI RsaI 5 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SetI 8 SexAI 1 MabI SfaNI 1 LweI TaiI 1 TaqI 3 TatI 1 TauI 2 TfiI 3 PfeI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 6 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI ApaI AscI AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BbvCI BbvI Bce83I* BceAI BcgI BciVI BclI BetI* BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaBI BsaXI BsePI BseRI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgiJII* HhaI Hin4I Hin6I HindIII HinP1I HpaI HpaII HphI Hpy188I Hpy99I HspAI KasI Ksp632I* MauBI McrI* MluI MlyI Mph1103I MroNI MseI MslI MstI* MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SecI* SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TseI TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769