Restriction Map of MIS1/YBR084W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

MIS1/YBR084W on chromosome II from coordinates 411054 to 413981.


MaeIII |MnlI || AvaI || XhoI || SmlI BsmAI || PspXI BccI Hin6I | TaqI || |TaqI | CviJI |GlaI | |Hpy178III* || |BmeT110I | HaeIII ||HhaI \ \\ \\ \\ \ \ \\\ ATGTTGTCGAGACTATCTTTATTGAGTAACTCGAGGGCGTTCCAACAGGCCAGATGGCGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACAGCTCTGATAGAAATAACTCATTGAGCTCCCGCAAGGTTGTCCGGTCTACCGCG / // / / // // /// | |Hpy178III* MnlI | |PspXI |HaeIII ||Hin6I | TaqI | |SmlI |CviJI |GlaI BsmAI | |XhoI BccI HhaI | |AvaI | BmeT110I | TaqI MaeIII M L S R L S L L S N S R A F Q Q A R W R C C R D Y L Y * V T R G R S N R P D G A V V E T I F I E * L E G V P T G Q M A H ----:----|----:----|----:----|----:----|----:----|----:----| X N D L S D K N L L E L A N W C A L H R X T T S V I K I S Y S S P T G V P W I A H Q R S * R * Q T V R P R E L L G S P A MwoI Tsp4CI* | FatI | CviRI* | |CviAII MwoI | ||Cac8I |AciI | ||| SphI |MmeI | ||| NspI || MseI | ||| NlaIII XcmI \\ \ \ \\\ \ \ ATTTACCGCTTAAAAGTTTCGCCAACTGTGCATGCTTCTCAATACCATATTCTTTCTGGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATGGCGAATTTTCAAAGCGGTTGACACGTACGAAGAGTTATGGTATAAGAAAGACCA / / / / / / / /// / | | | MseI | | | ||FatI XcmI | | AciI | | | |CviAII | MmeI | | | Cac8I MwoI | | CviRI* | | NlaIII | | NspI | | SphI | Tsp4CI* MwoI I Y R L K V S P T V H A S Q Y H I L S G F T A * K F R Q L C M L L N T I F F L V L P L K S F A N C A C F S I P Y S F W * ----:----|----:----|----:----|----:----|----:----|----:----| M * R K F T E G V T C A E * Y W I R E P C K G S L L K A L Q A H K E I G Y E K Q N V A * F N R W S H M S R L V M N K R T CviJI |FokI || MseI || | HindIII || | | AluI || | | CviJI || | | |SmlI TaqI || | | |AflII |Hpy178III* || | | ||MseI || CviJI || | | ||SetI \\ \ \\ \ \ \\\ AGGAAACTTGCTCAATCTATTCGAGAAAAAGCCAATGATGAGATACAAGCCATTAAGCTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTTGAACGAGTTAGATAAGCTCTTTTTCGGTTACTACTCTATGTTCGGTAATTCGAA // / / // / / || CviJI | || | HindIII |Hpy178III* | || CviJI TaqI | || AluI | |MseI | |SetI | FokI CviJI R K L A Q S I R E K A N D E I Q A I K L G N L L N L F E K K P M M R Y K P L S L E T C S I Y S R K S Q * * D T S H * A * ----:----|----:----|----:----|----:----|----:----|----:----| L F S A * D I R S F A L S S I C A M L S Y S V Q E I * E L F L W H H S V L W * A P F K S L R N S F F G I I L Y L G N L K AsuI* |NlaIV BseGI |BmgT120I | FalI ||CviJI | FalI ||HaeIII | | TspEI FalI ||| MlyI | | | SfaNI CviJI SetI FalI ||| PleI HinfI \ \ \ \ \ \ \ \\\ \ \ AAGCATCCTAATTTCAAGCCTACCTTGAAAATCATTCAAGTCGGGGCCAGACCAGACTCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGTAGGATTAAAGTTCGGATGGAACTTTTAGTAAGTTCAGCCCCGGTCTGGTCTGAGT // / / / / / /// // / |AflII | | | SetI FalI ||| |PleI HinfI |SmlI | | CviJI FalI ||| MlyI |FalI | SfaNI ||AsuI* |FalI TspEI |BmgT120I BseGI |HaeIII MseI |CviJI NlaIV K H P N F K P T L K I I Q V G A R P D S S I L I S S L P * K S F K S G P D Q T H A S * F Q A Y L E N H S S R G Q T R L I ----:----|----:----|----:----|----:----|----:----|----:----| L C G L K L G V K F I M * T P A L G S E * A D * N * A * R S F * E L R P W V L S L M R I E L R G Q F D N L D P G S W V * MaeII |MnlI |SplI* |BsaAI |SnaBI ||Csp6I |||RsaI |||SetI HindIII |||TaiI |FokI ||||MaeII ||AluI AccI |||||BsaAI ||CviJI |BsrDI |||||| SetI TspEI ||| SetI |Hpy166II |||||| TaiI |BseGI ||| |TspDTI || Tsp4CI* \\\\\\ \ \\ \\\ \\ \\ \ TCTACGTACGTGAGGATGAAATTGAAAGCTTCAAAGGACAGCAATGTAGACTGTATCATA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGCATGCACTCCTACTTTAACTTTCGAAGTTTCCTGTCGTTACATCTGACATAGTAT //////// / / / //// / // / |||||||MaeII | | | |||FokI | || Tsp4CI* ||||||SplI* | | | ||HindIII | |AccI ||||||BsaAI | | | |TspDTI | Hpy166II |||||Csp6I | | | CviJI BsrDI ||||RsaI | | | AluI ||||TaiI | | SetI ||||SetI | TspEI |||MaeII BseGI ||SnaBI ||BsaAI |MnlI TaiI SetI S T Y V R M K L K A S K D S N V D C I I L R T * G * N * K L Q R T A M * T V S * Y V R E D E I E S F K G Q Q C R L Y H R ----:----|----:----|----:----|----:----|----:----|----:----| D V Y T L I F N F A E F S L L T S Q I M M * T R S S S I S L K L P C C H L S Y * R R V H P H F Q F S * L V A I Y V T D Y EcoP15I | TspEI | Eco57I | Eco57MI | | FalI | | FalI | | MaeIII AluI | | Tsp45I FalI CviJI | | | MboII MaeIII FalI TspRI | SetI | | | |Hin4I \ \ \ \ \ \ \ \ \\ GAGAAGTTACCAGCAGAAATCACTGAAGTTGAGCTTTTGAAGAAAATTAGTGACATCAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCAATGGTCGTCTTTAGTGACTTCAACTCGAAAACTTCTTTTAATCACTGTAGTTA / / / / / /// // / / | FalI TspRI | CviJI ||| || | Tsp45I | FalI | AluI ||| || | MaeIII MaeIII SetI ||| || MboII ||| |TspEI ||| Hin4I ||FalI ||FalI |EcoP15I Eco57MI Eco57I E K L P A E I T E V E L L K K I S D I N R S Y Q Q K S L K L S F * R K L V T S M E V T S R N H * S * A F E E N * * H Q * ----:----|----:----|----:----|----:----|----:----|----:----| S F N G A S I V S T S S K F F I L S M L L S T V L L F * Q L Q A K S S F * H C * L L * W C F D S F N L K Q L F N T V D I FatI NcoI StyI SecI* SetI DsaI* | AciI |CviAII | | FnuDII* || NlaIII | | |MaeIII MlyI || | Hin4I | | |Tsp45I CspCI PleI HinfI || | | TspEI HgaI | | ||MnlI MslI |BseGI \ \ \\ \ \ \ \ \ \ \\\ \ \\ GATGATGACTCTATCCATGGGTTGCTAATTCAACTACCTCTACCGCGTCACTTGGATGAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACTGAGATAGGTACCCAACGATTAAGTTGATGGAGATGGCGCAGTGAACCTACTT // / / // / / / // / / // |PleI | | |Hin4I | | HgaI |MnlI | | |BseGI MlyI | | |DsaI* | SetI | | | CspCI | | |SecI* TspEI | | MslI | | |StyI | Tsp45I | | |NcoI | MaeIII | | |FatI FnuDII* | | CviAII AciI | NlaIII HinfI D D D S I H G L L I Q L P L P R H L D E M M T L S M G C * F N Y L Y R V T W M K * * L Y P W V A N S T T S T A S L G * N ----:----|----:----|----:----|----:----|----:----|----:----| S S S E I W P N S I * S G R G R * K S S H H H S * G H T A L E V V E V A D S P H I I V R D M P Q * N L * R * R T V Q I F Hpy166II | MseI | |AhaIII* | || BccI | || CspCI | || |MaeII FokI | || || SetI | TspDTI | || || TaiI NlaIV \ \ \ \\ \\ \ \ ACCACGATTACAAACGCTGTGGACTTTAAAAAGGACGTTGATGGGTTCCACAGATATAAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGCTAATGTTTGCGACACCTGAAATTTTTCCTGCAACTACCCAAGGTGTCTATATTA / / / // / // / / / | FokI | || | || MaeII NlaIV TsoI TspDTI | || | |BccI | || | TaiI | || | SetI | || CspCI | |MseI | AhaIII* Hpy166II T T I T N A V D F K K D V D G F H R Y N P R L Q T L W T L K R T L M G S T D I M H D Y K R C G L * K G R * W V P Q I * C ----:----|----:----|----:----|----:----|----:----|----:----| V V I V F A T S K L F S T S P N W L Y L F W S * L R Q P S * F P R Q H T G C I Y G R N C V S H V K F L V N I P E V S I I FatI |CviAII || TatI CviJI || |Csp6I | MnlI || |NlaIII TsoI TspEI | HphI TspDTI || ||RsaI \ \ \ \ \ \\ \\\ GCTGGTGAATTGGCTAAAAAAGGAGGGAAACCATACTTCATACCATGTACTCCTTATGGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGACCACTTAACCGATTTTTTCCTCCCTTTGGTATGAAGTATGGTACATGAGGAATACCA / / / / / ///// | | HphI TspDTI | ||||TatI | | MnlI | |||Csp6I | CviJI | ||RsaI TspEI | |FatI | CviAII NlaIII A G E L A K K G G K P Y F I P C T P Y G L V N W L K K E G N H T S Y H V L L M V W * I G * K R R E T I L H T M Y S L W L ----:----|----:----|----:----|----:----|----:----|----:----| A P S N A L F P P F G Y K M G H V G * P H Q H I P * F L L S V M S * V M Y E K H S T F Q S F F S P F W V E Y W T S R I T TspDTI | AluI | CviJI | | FatI | | SetI | | |CviAII FatI | | || MboII CviRI* | | || NlaIII |CviAII | | || |MseI ||BdaI | | || || BccI Hpy99I ||BdaI | | || || | BceAI |Hin4I ||| NlaIII | | || || | | BdaI |Hin4I ||| |TspEI | | || || | | BdaI ||MmeI \\\ \\ \ \ \\ \\ \ \ \ \\\ TGCATGAAATTACTTGAAGAAGCTCATGTTAAGTTAGATGGTAAGAACGCCGTCGTGTTA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTACTTTAATGAACTTCTTCGAGTACAATTCAATCTACCATTCTTGCGGCAGCACAAT / // / / / / / // // / // / | |FatI TspEI | | | | || || BceAI || MmeI | CviAII | | | | || || BdaI |Hin4I CviRI* | | | | || || BdaI |Hin4I NlaIII | | | | || |BccI Hpy99I BdaI | | | | || MseI BdaI | | | | |FatI | | | | CviAII | | | | MboII | | | NlaIII | | CviJI | | AluI | SetI TspDTI C M K L L E E A H V K L D G K N A V V L A * N Y L K K L M L S * M V R T P S C * H E I T * R S S C * V R W * E R R R V R ----:----|----:----|----:----|----:----|----:----|----:----| Q M F N S S S A * T L N S P L F A T T N N C S I V Q L L E H * T L H Y S R R R T A H F * K F F S M N L * I T L V G D H * Hpy99I Hpy188I | MfeI MboI | TspEI BsmI | DpnI | | Hin4I | MaeIII | |BstKTI | | Hin4I | Tsp4CI* \ \\ \ \ \ \ \ GGCAGATCAAGTATCGTCGGAAATCCAATTGCTTCGTTGTTGAAAAATGCGAATGCCACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTCTAGTTCATAGCAGCCTTTAGGTTAACGAAGCAACAACTTTTTACGCTTACGGTGA // / / / / / // / || MboI | | Hin4I TspEI || Tsp4CI* |DpnI | | Hin4I MfeI |BsmI BstKTI | Hpy188I TspRI Hpy99I G R S S I V G N P I A S L L K N A N A T A D Q V S S E I Q L L R C * K M R M P L Q I K Y R R K S N C F V V E K C E C H C ----:----|----:----|----:----|----:----|----:----|----:----| P L D L I T P F G I A E N N F F A F A V L C I L Y R R F D L Q K T T S F H S H W A S * T D D S I W N S R Q Q F I R I G S BsmAI Eco31I | AluI TspRI BsrDI | CviJI | Tsp4CI* | CviRI* | | SetI \ \ \ \ \ \ \ GTTACTGTCTGTCATAGTCATACAAGGAACATTGCAGAAGTGGTCTCCCAAGCTGATATA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGACAGACAGTATCAGTATGTTCCTTGTAACGTCTTCACCAGAGGGTTCGACTATAT / / / / / Tsp4CI* BsrDI CviRI* | Eco31I MaeIII | BsmAI | CviJI | AluI SetI V T V C H S H T R N I A E V V S Q A D I L L S V I V I Q G T L Q K W S P K L I * Y C L S * S Y K E H C R S G L P S * Y S ----:----|----:----|----:----|----:----|----:----|----:----| T V T Q * L * V L F M A S T T E W A S I Q * Q R D Y D Y L S C Q L L P R G L Q Y N S D T M T M C P V N C F H D G L S I Y Hpy188I | BceAI | | BsrI | | Hin4II* | | | TsoI | | | | KasI | | | | HgiCI* | | | | |AcyI | | | | |NarI TseI | | | | |Hin6I |BisI | | | | ||GlaI ||BlsI | | | | ||DinI |||AluI MaeII | | | | ||NlaIV |||CviJI | MseI | | | | |||HhaI |||| SetI | SetI | | | | ||||SecI* |||| Cac8I | TaiI | | | | ||||DsaI* |||| | AciI BbvI | MnlI | | |MseI | ||||HaeII \\\\ \ \ \ \ \ \ \ \\ \ \\\\\ GTTATCGCAGCTTGCGGTATTCCTCAATACGTTAAATCAGACTGGATTAAAGAAGGCGCC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAATAGCGTCGAACGCCATAAGGAGTTATGCAATTTAGTCTGACCTAATTTCTTCCGCGG /// / / / / / / / // // ///// ||| | AciI BbvI | | | | || |TsoI ||||HgiCI* ||| Cac8I | | | | || MseI ||||KasI ||CviJI | | | | |Hin4II* |||Hin6I ||TseI | | | | |BceAI |||NarI ||AluI | | | | BsrI |||AcyI |BisI | | | Hpy188I ||NlaIV BlsI | | MseI ||DinI SetI | MaeII ||GlaI | MnlI |HhaI TaiI HaeII SetI V I A A C G I P Q Y V K S D W I K E G A L S Q L A V F L N T L N Q T G L K K A P Y R S L R Y S S I R * I R L D * R R R R ----:----|----:----|----:----|----:----|----:----|----:----| T I A A Q P I G * Y T L D S Q I L S P A L * R L K R Y E E I R * I L S S * L L R N D C S A T N R L V N F * V P N F F A G MaeII |BsaAI |SnaBI ||Csp6I |||RsaI |||SetI |||TaiI |||| SetI SetI |||| | EcoRV TspEI \ \\\\ \ \ \ GTGGTTATTGATGTAGGTATCAACTACGTACCTGATATCAGTAAGAAAAGTGGGCAAAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CACCAATAACTACATCCATAGTTGATGCATGGACTATAGTCATTCTTTTCACCCGTTTTT / / / //// / DsaI* SetI | |||Csp6I EcoRV SecI* | ||RsaI | ||SetI | |MaeII | SnaBI | BsaAI TaiI SetI V V I D V G I N Y V P D I S K K S G Q K W L L M * V S T T Y L I S V R K V G K N G Y * C R Y Q L R T * Y Q * E K W A K I ----:----|----:----|----:----|----:----|----:----|----:----| T T I S T P I L * T G S I L L F L P C F R P * Q H L Y * S R V Q Y * Y S F H A F H N N I Y T D V V Y R I D T L F T P L F HphI | TfiI BssKI | HinfI EcoRII \ \ \ TTAGTTGGTGATGTTGATTTTGATTCTGTAAAGGAAAAGACATCTTATATTACCCCTGTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATCAACCACTACAACTAAAACTAAGACATTTCCTTTTCTGTAGAATATAATGGGGACAA / / / / TspEI HphI HinfI BsiYI* TfiI L V G D V D F D S V K E K T S Y I T P V * L V M L I L I L * R K R H L I L P L F S W * C * F * F C K G K D I L Y Y P C S ----:----|----:----|----:----|----:----|----:----|----:----| N T P S T S K S E T F S F V D * I V G T I L Q H H Q N Q N Q L P F S M K Y * G Q * N T I N I K I R Y L F L C R I N G R N TseI AluI AsuI* BbvI CviJI BsiYI* AvaII | TatI |BisI |ScrFI |NlaIV | |Csp6I ||BlsI |BseBI |BmgT120I Tsp4CI* | ||RsaI ||SetI \\ \\ \ \ \\\ \\\ CCTGGTGGAGTGGGTCCAATGACTGTCGCTATGCTTGTTTCCAATGTACTATTAGCTGCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGACCACCTCACCCAGGTTACTGACAGCGATACGAACAAAGGTTACATGATAATCGACGA / / /// / //// / //// | EcoRII ||AvaII Tsp4CI* |||| | |||TseI | BssKI ||AsuI* |||| | ||BisI BseBI |BmgT120I |||| | |BlsI ScrFI NlaIV |||| | CviJI |||| | AluI |||| SetI |||TatI ||Csp6I |RsaI BbvI P G G V G P M T V A M L V S N V L L A A L V E W V Q * L S L C L F P M Y Y * L L W W S G S N D C R Y A C F Q C T I S C * ----:----|----:----|----:----|----:----|----:----|----:----| G P P T P G I V T A I S T E L T S N A A E Q H L P D L S Q R * A Q K W H V I L Q R T S H T W H S D S H K N G I Y * * S S TfiI HinfI | Hpy188I | | HindIII | | |XmnI Ksp632I* | | ||AluI | MnlI | | ||CviJI | | DdeI | | ||| SetI | | | Eco57I TspEI | | ||| | BsrI MboII SetI | | | Eco57MI \ \ \ \\\ \ \ \ \ \ \ \ \ AAAAGGCAATTCGTGGAATCTGAAAAGCTTCCAGTTATCAAACCTCTTCCATTACACTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCCGTTAAGCACCTTAGACTTTTCGAAGGTCAATAGTTTGGAGAAGGTAATGTGAAT / // /// / / / // / / TspEI || ||| | | SetI || | DdeI || ||| | MboII || Eco57MI || ||| HindIII || Eco57I || ||| BsrI |Ksp632I* || ||CviJI MnlI || ||AluI || |XmnI || SetI |Hpy188I HinfI TfiI K R Q F V E S E K L P V I K P L P L H L K G N S W N L K S F Q L S N L F H Y T * K A I R G I * K A S S Y Q T S S I T L R ----:----|----:----|----:----|----:----|----:----|----:----| L L C N T S D S F S G T I L G R G N C K * F A I R P I Q F A E L * * V E E M V S F P L E H F R F L K W N D F R K W * V * Hpy178III* | AluI | CviJI | Ecl136II | |DdeI | ||SetI | ||SduI | ||SacI | ||HgiAI* | ||HgiJII* | ||| Hpy188I | ||| |HinfI | ||| || DdeI | ||| || Bpu10I | ||| || | PleI | ||| || | |MlyI TspRI | ||| || | |BspCNI | Hpy188I | ||| || | ||BseMII BsrI | | Hin4II* | ||| || | ||| MwoI \ \ \ \ \ \\\ \\ \ \\\ \ GAAAGTCCAGTGCCTTCAGATATTGATATATCAAGAGCTCAGAGTCCTAAGCATATCAAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCAGGTCACGGAAGTCTATAACTATATAGTTCTCGAGTCTCAGGATTCGTATAGTTC / / / // / // / /// / TspRI | Hin4II* || | || | ||| MwoI BsrI Hpy188I || | || | ||PleI || | || | ||MlyI || | || | |BseMII || | || | |Bpu10I || | || | |DdeI || | || | BspCNI || | || HinfI || | |DdeI || | Hpy188I || Ecl136II || CviJI || AluI |HgiJII* |HgiAI* |SacI |SduI |SetI Hpy178III* E S P V P S D I D I S R A Q S P K H I K K V Q C L Q I L I Y Q E L R V L S I S S K S S A F R Y * Y I K S S E S * A Y Q A ----:----|----:----|----:----|----:----|----:----|----:----| S L G T G E S I S I D L A * L G L C I L L F D L A K L Y Q Y I L L E S D * A Y * F T W H R * I N I Y * S S L T R L M D L TfiI Hpy178III* CfrI HinfI | NmeAIII | CviJI MnlI SecI* | BseRI | |TspEI TspEI | HaeIII BsiYI* \ \ \ \ \ \\ \ \ \ \ CAAGTTGCCGAGGAGTTGGGAATCCACTCTCACGAATTAGAATTATACGGCCACTATAAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCAACGGCTCCTCAACCCTTAGGTGAGAGTGCTTAATCTTAATATGCCGGTGATATTC / / / / / / / / / / MnlI SecI* BseRI | | TspEI TspEI | | BsiYI* HinfI | Hpy178III* | CfrI TfiI NmeAIII HaeIII CviJI Q V A E E L G I H S H E L E L Y G H Y K K L P R S W E S T L T N * N Y T A T I R S C R G V G N P L S R I R I I R P L * G ----:----|----:----|----:----|----:----|----:----|----:----| C T A S S N P I W E * S N S N Y P W * L A L Q R P T P F G S E R I L I I R G S Y L N G L L Q S D V R V F * F * V A V I L Tsp4CI* BsaBI | Csp6I |TfiI | |RsaI |HinfI | ||MaeII BceAI || XbaI | ||| BspMI | ApoI MseI || |MaeI | ||| |SetI | TspEI SspI |AhaIII* || |Hpy178III* | ||| |TaiI \ \ \ \\ \\ \\ \ \\\ \\ GCAAAAATTTCTCCAAATATTTTTAAAAGATTAGAATCTAGAGAAAACGGTAAGTACGTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTTTAAAGAGGTTTATAAAAATTTTCTAATCTTAGATCTCTTTTGCCATTCATGCAG / / / // / / // / // / | TspEI SspI |MseI | | |XbaI | || MaeII | ApoI AhaIII* | | | | |Csp6I BceAI | | | | RsaI | | | | TaiI | | | | SetI | | | Tsp4CI* | | Hpy178III* | | MaeI | HinfI | TfiI BsaBI A K I S P N I F K R L E S R E N G K Y V Q K F L Q I F L K D * N L E K T V S T S K N F S K Y F * K I R I * R K R * V R P ----:----|----:----|----:----|----:----|----:----|----:----| A F I E G F I K L L N S D L S F P L Y T P L F K E L Y K * F I L I * L F R Y T R C F N R W I N K F S * F R S F V T L V D BsaXI |CviRI* || SetI || | MlyI || | PleI BsaXI || | | TaqII | SetI || | | |Hpy188I | | HphI || | | ||HinfI Hin4II* | | MmeI XcmI \\ \ \ \\\ \ \ \ \ \ CTTGTTGCAGGTATTACTCCGACTCCATTGGGTGAAGGTAAATCCACTACGACTATGGGG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GAACAACGTCCATAATGAGGCTGAGGTAACCCACTTCCATTTAGGTGATGCTGATACCCC // // /// / / / / / // / || |SetI ||| | | | | SetI |HphI XcmI || CviRI* ||| | | | BsaXI MmeI |BsaXI ||| | | Hin4II* BspMI ||| | HinfI ||| Hpy188I ||TaqII |PleI MlyI L V A G I T P T P L G E G K S T T T M G L L Q V L L R L H W V K V N P L R L W G C C R Y Y S D S I G * R * I H Y D Y G V ----:----|----:----|----:----|----:----|----:----|----:----| R T A P I V G V G N P S P L D V V V I P G Q Q L Y * E S E M P H L Y I W * S * P K N C T N S R S W Q T F T F G S R S H P BccI Hpy178III* |NruI MwoI |FnuDII* |AciI || BccI || BsrBI || |AclI CviRI* || | FokI || |MaeII | Cac8I || | | BtgZI || || SetI | | CviJI || | | |BsgI BseGI || || TaiI \ \ \ \\ \ \ \\ \ \\ \\ \ TTGGTGCAGGCTTTATCCGCTCATTTAGGGAAACCATCCATCGCGAACGTTAGACAACCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AACCACGTCCGAAATAGGCGAGTAAATCCCTTTGGTAGGTAGCGCTTGCAATCTGTTGGT / / / / / / / / / // // / | | | MwoI | | | | BseGI || || MaeII | | CviJI | | | BtgZI || || AclI | Cac8I | | FokI || |BccI CviRI* | BsgI || TaiI BsrBI || SetI AciI |Hpy178III* FnuDII* BccI NruI L V Q A L S A H L G K P S I A N V R Q P W C R L Y P L I * G N H P S R T L D N H G A G F I R S F R E T I H R E R * T T I ----:----|----:----|----:----|----:----|----:----|----:----| N T C A K D A * K P F G D M A F T L C G T P A P K I R E N L S V M W R S R * V V Q H L S * G S M * P F W G D R V N S L W PflMI BsiYI* | BccI | |TaqII | |AsuI* | |EcoP15I | ||CviJI | ||HaeIII | ||BmgT120I | ||| BssKI | ||| SecI* | ||| EcoRII | ||| |PasI | ||| |SecI* | ||| |BsiYI* SetI | ||| ||ScrFI | TseI | ||| ||BseBI | |TsoI | ||| ||BsiYI* | |BisI | ||| ||| BbvI | ||BlsI \ \\\ \\\ \ \ \\\ TCTCTTGGCCCAACCCTGGGTGTCAAAGGTGGTGCTGCTGGTGGTGGTTATGCCCAAGTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGAACCGGGTTGGGACCCACAGTTTCCACCACGACGACCACCACCAATACGGGTTCAA / / //// // /// // / /// | | |||| || ||| |SetI | ||TseI | | |||| || ||| BbvI | |BisI | | |||| || ||EcoRII | BlsI | | |||| || ||BssKI TsoI | | |||| || ||SecI* | | |||| || |SecI* | | |||| || |PasI | | |||| || BseBI | | |||| || ScrFI | | |||| |BsiYI* | | |||| BsiYI* | | |||AsuI* | | ||BmgT120I | | ||EcoP15I | | |HaeIII | | |CviJI | | BccI | TaqII BsiYI* PflMI S L G P T L G V K G G A A G G G Y A Q V L L A Q P W V S K V V L L V V V M P K L S W P N P G C Q R W C C W W W L C P S Y ----:----|----:----|----:----|----:----|----:----|----:----| D R P G V R P T L P P A A P P P * A W T M E Q G L G P H * L H H Q Q H H N H G L R K A W G Q T D F T T S S T T T I G L N BbvI FatI |CviAII || NlaIII || | MwoI || | |Hin6I || | ||GlaI || | ||Eco47III BssKI || | |||TseI TspDTI || | |||HhaI |SecI* || | ||||BisI |HpaII || | ||||HaeII ||ScrFI || | |||||BlsI TspEI ||CauII* || | ||||||MboII \ \\\ \\ \ \\\\\\\ ATTCCTATGGACGAGTTCAATTTACATTTGACCGGGGATATTCATGCTATCAGCGCTGCG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGATACCTGCTCAAGTTAAATGTAAACTGGCCCCTATAAGTACGATAGTCGCGACGC / / / / / // / /////// TspEI | | BssKI | || | ||||||TseI | | SecI* | || | |||||MboII | CauII* | || | |||||BisI | HpaII | || | ||||BlsI | ScrFI | || | |||Hin6I TspDTI | || | ||Eco47III | || | ||GlaI | || | |HhaI | || | HaeII | || MwoI | |FatI | |BbvI | CviAII NlaIII I P M D E F N L H L T G D I H A I S A A F L W T S S I Y I * P G I F M L S A L R S Y G R V Q F T F D R G Y S C Y Q R C E ----:----|----:----|----:----|----:----|----:----|----:----| I G I S S N L K C K V P S I * A I L A A * E * P R T * N V N S R P Y E H * * R Q N R H V L E I * M Q G P I N M S D A S R TseI CviRI* |BisI ||BlsI |||TseI ||||BisI |||||BlsI ||||||AluI ||||||CviJI ||||||| SetI FatI ||||||| | TaqI |CviAII ||||||| | | BbvI || NlaIII ||||||| | | | BbvI || |EcoP15I ||||||| | | | |MaeI || || CviJI ||||||| | | | || BdaI || || | DdeI ||||||| | | | || BdaI || || | | Hpy188I ||||||| | | | || MslI || || | | | TspDTI \\\\\\\ \ \ \ \\ \ \\ \\ \ \ \ \ AACAATCTTCTTGCAGCAGCTATCGACACTAGAATGTTCCATGAAGCCACTCAGAAGAAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTAGAAGAACGTCGTCGATAGCTGTGATCTTACAAGGTACTTCGGTGAGTCTTCTTA /////// / / // / // / /// ||||||CviJI | | |BbvI | || | ||TspDTI ||||||TseI | | MslI | || | |DdeI ||||||AluI | | MaeI | || | Hpy188I |||||BisI | BbvI | || EcoP15I ||||BlsI | BdaI | || CviJI ||||SetI | BdaI | |FatI |||TseI TaqI | CviAII ||BisI NlaIII |BlsI CviRI* N N L L A A A I D T R M F H E A T Q K N T I F L Q Q L S T L E C S M K P L R R M Q S S C S S Y R H * N V P * S H S E E * ----:----|----:----|----:----|----:----|----:----|----:----| F L R R A A A I S V L I N W S A V * F F S C D E Q L L * R C * F T G H L W E S S V I K K C C S D V S S H E M F G S L L I BspCNI |TatI |BseMII ||BdaI FokI ||BdaI |Hpy188I ||Csp6I || SfaNI |||RsaI SpeI || | Hpy166II |||MboII BsmAI |MaeI || | | BseGI \\\\ \ \\ \\ \ \ \ GATAGTACATTTTACAAGAGACTAGTTCCAAGAAAAAAAGGCATCAGAAAGTTTACCCCA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCATGTAAAATGTTCTCTGATCAAGGTTCTTTTTTTCCGTAGTCTTTCAAATGGGGT /// //// / // / / // / ||| |||TatI BsmAI |SpeI | | || BseGI ||| ||Csp6I MaeI | | |SfaNI ||| |RsaI | | Hpy166II ||| MboII | FokI ||BdaI Hpy188I ||BdaI |BseMII BspCNI D S T F Y K R L V P R K K G I R K F T P I V H F T R D * F Q E K K A S E S L P H * Y I L Q E T S S K K K R H Q K V Y P I ----:----|----:----|----:----|----:----|----:----|----:----| S L V N * L L S T G L F F P M L F N V G H Y Y M K C S V L E L F F L C * F T * G I T C K V L S * N W S F F A D S L K G W FatI |CviAII || Hin4II* || |BccI || |CviRI* || |NlaIII || || MwoI BbvII* || || | CviJI | MboII || || | | MseI SfaNI | | MseI \\ \\ \ \ \ \ \ \ \ TCCATGCAGAGAAGGCTTAAAAGATTGGATATTGAAAAAGAAGACCCTGATGCTTTAACA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTACGTCTCTTCCGAATTTTCTAACCTATAACTTTTTCTTCTGGGACTACGAAATTGT / //// / / / / / / / | |||| MwoI | MseI SfaNI | | SetI | |||BccI CviJI | MseI | ||CviRI* BbvII* | ||FatI MboII | |CviAII | Hin4II* NlaIII S M Q R R L K R L D I E K E D P D A L T P C R E G L K D W I L K K K T L M L * H H A E K A * K I G Y * K R R P * C F N T ----:----|----:----|----:----|----:----|----:----|----:----| D M C L L S L L N S I S F S S G S A K V M W A S F A * F I P Y Q F L L G Q H K L G H L S P K F S Q I N F F F V R I S * C MaeI Eco57I Ksp632I* SetI MboII Eco57MI Hpy178III* | Hpy188I \ \ \ \ \ \ CCTGAAGAAGTCAAAAGATTTGCTAGATTGAACATAAATCCCGATACTATCACTATCAGA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTTCTTCAGTTTTCTAAACGATCTAACTTGTATTTAGGGCTATGATAGTGATAGTCT / / / / / MboII | MaeI Hpy178III* Ksp632I* Eco57MI Hpy188I Eco57I P E E V K R F A R L N I N P D T I T I R L K K S K D L L D * T * I P I L S L S E * R S Q K I C * I E H K S R Y Y H Y Q K ----:----|----:----|----:----|----:----|----:----|----:----| G S S T L L N A L N F M F G S V I V I L V Q L L * F I Q * I S C L D R Y * * * * R F F D F S K S S Q V Y I G I S D S D S SalI CviJI |TaqI |AciI |AccI |BisI ||HindII ||BlsI ||Hpy166II MseI TspEI |||TauI ||| MboII |BseGI |FokI |||| Hin4II* \\\ \ \\ \\ \\\\ \ AGAGTTGTCGACATCAATGACAGGATGTTAAGACAAATTACCATTGGCGAAGCCGCTACG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCAACAGCTGTAGTTACTGTCCTACAATTCTGTTTAATGGTAACCGCTTCGGCGATGC /// / / // ///// ||SalI | MseI |FokI ||||Hin4II* |MboII BseGI TspEI |||AciI |AccI ||BisI |TaqI |BlsI Hpy166II CviJI HindII TauI R V V D I N D R M L R Q I T I G E A A T E L S T S M T G C * D K L P L A K P L R S C R H Q * Q D V K T N Y H W R S R Y G ----:----|----:----|----:----|----:----|----:----|----:----| L T T S M L S L I N L C I V M P S A A V F L Q R C * H C S T L V F * W Q R L R * S N D V D I V P H * S L N G N A F G S R TspGWI | Hin4I Hpy188I | Hin4I |TspEI | AsuI* |Hin4I | AvaII |Hin4I | |BmgT120I || MseI | || TfiI || VspI | || HinfI || | MnlI | || |BsrI || | | CfrI | || |TspRI || | | | BalI | || || TaqI Tsp4CI* || | | | CviJI | || || | EcoRV | TspRI || | | | HaeIII \ \\ \\ \ \ \ \ \\ \ \ \ \ GAGAAGGGTTTTACAAGGACCACTGGATTCGATATCACTGTTGCCTCTGAATTAATGGCC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCCCAAAATGTTCCTGGTGACCTAAGCTATAGTGACAACGGAGACTTAATTACCGG // /// / / / / / / / // / / |Hin4I ||| | | | | | | | || | CfrI |Hin4I ||| | | | | | | | || HaeIII TspGWI ||| | | | | | | | || CviJI ||| | | | | | | | || BalI ||| | | | | | | | |VspI ||| | | | | | | | |MseI ||| | | | | | | | TspEI ||| | | | | | | | MnlI ||| | | | | | | Hpy188I ||| | | | | | Hin4I ||| | | | | | Hin4I ||| | | | | Tsp4CI* ||| | | | EcoRV ||| | | | TspRI ||| | | TaqI ||| | HinfI ||| | TfiI ||| BsrI ||AvaII ||AsuI* |BmgT120I TspRI E K G F T R T T G F D I T V A S E L M A R R V L Q G P L D S I S L L P L N * W P E G F Y K D H W I R Y H C C L * I N G H ----:----|----:----|----:----|----:----|----:----|----:----| S F P K V L V V P N S I V T A E S N I A P S P N * L S W Q I R Y * Q Q R Q I L P L L T K C P G S S E I D S N G R F * H G MaeII | SetI | TaiI HindIII | |TsoI | AluI | || TspDTI MwoI | CviJI | || | FatI | AluI | | SetI | || | |CviAII | CviJI | | | BsiI* | || | || NlaIII | | SetI | | | | Hin4II* | || | || | HgaI \ \ \ \ \ \ \ \ \ \\ \ \\ \ \ ATTTTAGCTCTATCTAAAAGCTTACACGAGATGAAGGAACGTATTGGACGCATGGTTATT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAATCGAGATAGATTTTCGAATGTGCTCTACTTCCTTGCATAACCTGCGTACCAATAA / / / / / / / / / / / / // | | CviJI | | | | BsiI* | | | | |FatI | | AluI | | | Hin4II* | | | | CviAII | SetI | | HindIII | | | NlaIII MwoI | CviJI | | TspDTI | AluI | MaeII SetI | TsoI TaiI SetI I L A L S K S L H E M K E R I G R M V I F * L Y L K A Y T R * R N V L D A W L L F S S I * K L T R D E G T Y W T H G Y W ----:----|----:----|----:----|----:----|----:----|----:----| M K A R D L L K C S I F S R I P R M T I W K L E I * F S V R S S P V Y Q V C P * N * S * R F A * V L H L F T N S A H N N CviJI | MboII | |Csp6I | ||RsaI | |||AgeI BsrI | |||BetI* SduI | MaeIII | |||Cfr10I HgiAI* | | Tsp4CI* | ||||HpaII | Hpy188I \ \ \ \ \\\\\ \ \ GGTGCTGATTATGATAACAAACCAGTAACAGTAGAAGATATTGGCTGTACCGGTGCTCTG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGACTAATACTATTGTTTGGTCATTGTCATCTTCTATAACCGACATGGCCACGAGAC / / / // // // / HgaI BsrI Tsp4CI* || || || Hpy188I MaeIII || || || MwoI || || |Cfr10I || || |HgiAI* || || |BetI* || || |AgeI || || |SduI || || HpaII || |Csp6I || RsaI |MboII CviJI G A D Y D N K P V T V E D I G C T G A L V L I M I T N Q * Q * K I L A V P V L * C * L * * Q T S N S R R Y W L Y R C S D ----:----|----:----|----:----|----:----|----:----|----:----| P A S * S L L G T V T S S I P Q V P A R Q H Q N H Y C V L L L L L Y Q S Y R H E T S I I I V F W Y C Y F I N A T G T S Q MaeII AsuI* |BsaAI AvaII |MaeIII DraII |Tsp45I PpuMI || SetI CviRI* SanDI || TaiI | Hin4II* |NlaIV MwoI || |FalI HgaI | | FalI |BmgT120I | CviRI* || |FalI | CviJI MseI | | FalI ||NlaIV \ \ \\ \\ \ \ \ \ \ \ \\\ ACTGCATTATTACGTGACGCTATAAAGCCTAACTTAATGCAAACTTTGGAAGGGACCCCC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGTAATAATGCACTGCGATATTTCGGATTGAATTACGTTTGAAACCTTCCCTGGGGG / / // / / / / / // /// / CviRI* | || Tsp45I | HgaI | | |FalI ||| BsiYI* | || MaeIII CviJI | | |FalI ||SanDI | |MaeII | | Hin4II* ||PpuMI | BsaAI | CviRI* ||DraII TaiI MseI ||AvaII SetI ||AsuI* FalI |BmgT120I FalI |NlaIV NlaIV T A L L R D A I K P N L M Q T L E G T P L H Y Y V T L * S L T * C K L W K G P P C I I T * R Y K A * L N A N F G R D P R ----:----|----:----|----:----|----:----|----:----|----:----| V A N N R S A I F G L K I C V K S P V G S Q M I V H R * L A * S L A F K P L S G S C * * T V S Y L R V * H L S Q F P G G BsiYI* | BslFI | | Hpy166II Hin6I | | | AsuI* |GlaI SfaNI | | | AvaII ||HhaI |TspEI | | | |BmgT120I ||BccI || CviRI* \ \ \ \\ \\\ \\ \ GTAATGGTTCACGCTGGTCCTTTCGCCAACATCTCCATCGGCGCATCATCAGTAATTGCA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CATTACCAAGTGCGACCAGGAAAGCGGTTGTAGAGGTAGCCGCGTAGTAGTCATTAACGT // // //// /// |BslFI |AvaII |||BccI ||CviRI* Hpy166II |AsuI* ||Hin6I |TspEI BmgT120I |GlaI SfaNI HhaI V M V H A G P F A N I S I G A S S V I A * W F T L V L S P T S P S A H H Q * L Q N G S R W S F R Q H L H R R I I S N C R ----:----|----:----|----:----|----:----|----:----|----:----| T I T * A P G K A L M E M P A D D T I A R L P E R Q D K R W C R W R R M M L L Q Y H N V S T R E G V D G D A C * * Y N C HindIII | AluI BseGI | CviJI FokI | TsoI MseI | | SetI Hpy188I MseI | |FatI \ \ \ \ \ \ \ \\ GACTTAATGGCATTGAAGCTTGTTGGTTCAGAAAAGAACCCGTTAAATGACAAGAACATC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAATTACCGTAACTTCGAACAACCAAGTCTTTTCTTGGGCAATTTACTGTTCTTGTAG / / / / / / / / / / MseI | | HindIII Hpy188I | FokI | | NlaIII | CviJI MseI | TsoI | AluI BseGI SetI D L M A L K L V G S E K N P L N D K N I T * W H * S L L V Q K R T R * M T R T S L N G I E A C W F R K E P V K * Q E H P ----:----|----:----|----:----|----:----|----:----|----:----| S K I A N F S T P E S F F G N F S L F M L S L P M S A Q Q N L F S G T L H C S C V * H C Q L K N T * F L V R * I V L V D CviAII FatI | NlaIII NcoI | | BssKI StyI | | SexAI SecI* | | EcoRII DsaI* | | |BstXI TfiI Eco57I | | ||ScrFI HinfI Eco57MI | | ||BseBI TspDTI | TaqI |CviAII TfiI | | |||SetI |MaeIII | | TaqII || NlaIII HinfI \ \ \\\\ \\ \ \ \ \\ \ \ CATGAACCTGGTTATGTAGTTACTGAAGCAGGATTCGATTTTGCCATGGGTGGTGAAAGA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTTGGACCAATACATCAATGACTTCGTCCTAAGCTAAAACGGTACCCACCACTTTCT /// / / / / / / / / // ||| | | TspDTI MaeIII | TaqI | | |DsaI* ||| | EcoRII HinfI | | |SecI* ||| | SexAI TaqII | | |StyI ||| | BssKI TfiI | | |NcoI ||| BseBI | | |FatI ||| ScrFI | | CviAII ||SetI | NlaIII |FatI Eco57MI CviAII Eco57I BstXI H E P G Y V V T E A G F D F A M G G E R M N L V M * L L K Q D S I L P W V V K D * T W L C S Y * S R I R F C H G W * K I ----:----|----:----|----:----|----:----|----:----|----:----| W S G P * T T V S A P N S K A M P P S L G H V Q N H L * Q L L I R N Q W P H H F M F R T I Y N S F C S E I K G H T T F S Hpy178III* | SfaNI | | MnlI | | HgiCI* HphI EcoRV | | | NlaIV CviRI* DdeI \ \ \ \ \ \ \ \ TTCTTTGATATCAAATGTCGTTCCTCTGGATTGGTGCCAGATGCAGTTGTCTTAGTCGCA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAAACTATAGTTTACAGCAAGGAGACCTAACCACGGTCTACGTCAACAGAATCAGCGT // / / / // / / / |HphI EcoRV | | || | CviRI* DdeI HinfI | | || HgiCI* TfiI | | |NlaIV | | SfaNI | MnlI Hpy178III* F F D I K C R S S G L V P D A V V L V A S L I S N V V P L D W C Q M Q L S * S Q L * Y Q M S F L W I G A R C S C L S R N ----:----|----:----|----:----|----:----|----:----|----:----| N K S I L H R E E P N T G S A T T K T A I R Q Y * I D N R Q I P A L H L Q R L R E K I D F T T G R S Q H W I C N D * D C MnlI | FatI | |CviAII MseI | || NlaIII | BssKI Tsp4CI* | || |MslI | CviJI | AluI | || || SetI | | HpaII | CviJI | || || | SduI | | ScrFI | | SetI | || || | HgiAI* | | CauII* \ \ \ \ \\ \\ \ \ \ \ \ ACCGTAAGAGCTTTGAAATCTCATGGAGGTGCTCCAAATGTTAAGCCCGGACAATCATTA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCATTCTCGAAACTTTAGAGTACCTCCACGAGGTTTACAATTCGGGCCTGTTAGTAAT / / / / / /// / / / /// | | CviJI | | ||| HgiAI* | | ||BssKI | | AluI | | ||| SduI | | |HpaII | SetI | | ||MslI | | CauII* Tsp4CI* | | ||SetI | | ScrFI | | |FatI | CviJI | | CviAII MseI | NlaIII MnlI T V R A L K S H G G A P N V K P G Q S L P * E L * N L M E V L Q M L S P D N H Y R K S F E I S W R C S K C * A R T I I T ----:----|----:----|----:----|----:----|----:----|----:----| V T L A K F D * P P A G F T L G P C D N L R L L K S I E H L H E L H * A R V I M G Y S S Q F R M S T S W I N L G S L * * TsoI TaqI StyI | BcgI MnlI BcgI ClaI SecI* | |TspEI MseI \ \ \ \ \ \\ \ CCAAAAGAATACACAGAGGAAAACATCGATTTTGTTGCCAAGGGTGTTAGTAATTTGGTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTTCTTATGTGTCTCCTTTTGTAGCTAAAACAACGGTTCCCACAATCATTAAACCAA / / / / / / / MnlI BcgI ClaI | | BcgI TspEI TaqI | TsoI SecI* StyI P K E Y T E E N I D F V A K G V S N L V Q K N T Q R K T S I L L P R V L V I W L K R I H R G K H R F C C Q G C * * F G * ----:----|----:----|----:----|----:----|----:----|----:----| G F S Y V S S F M S K T A L P T L L K T V L L I C L P F C R N Q Q W P H * Y N P W F F V C L F V D I K N G L T N T I Q N AclI MaeII | SetI | TaiI BsrI \ \ \ AAGCAGATTGAAAACATCAAAACGTTTGGAATACCAGTCGTTGTAGCAATCAACAGATTT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGTCTAACTTTTGTAGTTTTGCAAACCTTATGGTCAGCAACATCGTTAGTTGTCTAAA / / / / MseI | MaeII BsrI | AclI TaiI SetI K Q I E N I K T F G I P V V V A I N R F S R L K T S K R L E Y Q S L * Q S T D L A D * K H Q N V W N T S R C S N Q Q I * ----:----|----:----|----:----|----:----|----:----|----:----| L C I S F M L V N P I G T T T A I L L N * A S Q F C * F T Q F V L R Q L L * C I L L N F V D F R K S Y W D N Y C D V S K MwoI | BbvI SetI | BceAI | Hpy178III* | | BsmI | | TseI | | Cac8I | | |BisI | | | Hin6I MlyI | | ||BlsI | | | |GlaI PleI HinfI MnlI | | |||CviJI | | | ||HhaI \ \ \ \ \ \\\\ \ \ \ \\\ GAAACAGACTCACAGGCAGAGATTGAGGTAATCAAGAAAGCAGCCTTGAATGCTGGCGCA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGTCTGAGTGTCCGTCTCTAACTCCATTAGTTCTTTCGTCGGAACTTACGACCGCGT // / / / / /// / / / /// |PleI HinfI MnlI SetI | ||| MwoI | | ||Hin6I MlyI | ||CviJI | | |GlaI | ||TseI | | BbvI | |BisI | | HhaI | BlsI | Cac8I Hpy178III* | BceAI BsmI E T D S Q A E I E V I K K A A L N A G A K Q T H R Q R L R * S R K Q P * M L A H N R L T G R D * G N Q E S S L E C W R I ----:----|----:----|----:----|----:----|----:----|----:----| S V S E C A S I S T I L F A A K F A P A Q F L S V P L S Q P L * S L L R S H Q R F C V * L C L N L Y D L F C G Q I S A C TstI FatI | BccI |MwoI | | Hin4II* |CviAII | | | BsrI |BstAPI | | | TspRI SetI || SfaNI | | | | BseGI |CviRI* || NlaIII | | | | | SetI || TstI || | MaeIII | | | | | | FokI || | TspEI FatI \\ \ \ \ \ \ \ \ \ \ \\ \ \ \ TCTCATGCCGTTACTTCTAATCACTGGATGGAAGGTGGTAAAGGTGCAGTAGAATTAGCA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTACGGCAATGAAGATTAGTGACCTACCTTCCACCATTTCCACGTCATCTTAATCGT / / // / // / / / / / / / / // / / | | || | || | | | | | SetI | | |CviRI* | NlaIII | | || | || | | | | BseGI | | TstI | NspI | | || | || | | | BsrI | FokI TspEI | | || | || | | Hin4II* SetI | | || | || | BccI | | || | || TspRI | | || | |MaeIII | | || | TstI | | || SfaNI | | |FatI | | CviAII | NlaIII BstAPI MwoI S H A V T S N H W M E G G K G A V E L A L M P L L L I T G W K V V K V Q * N * H S C R Y F * S L D G R W * R C S R I S T ----:----|----:----|----:----|----:----|----:----|----:----| D * A T V E L * Q I S P P L P A T S N A M E H R * K * D S S P L H Y L H L L I L R M G N S R I V P H F T T F T C Y F * C Csp6I |RsaI || AcyI || MaeII CviAII || |ZraI | SfaNI || ||Hpy99I | |NspI || |||SetI | |NlaIII || |||TaiI | ||BsgI CviRI* MseI || |||AatII \ \\\ \ \ \\ \\\\ CATGCTGTGGTAGATGCAACGAAAGAACCAAAGAACTTTAACTTTTTGTACGACGTCAAT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| GTACGACACCATCTACGTTGCTTTCTTGGTTTCTTGAAATTGAAAAACATGCTGCAGTTA // / / / // / // / || SfaNI CviRI* MseI || | || SetI |FatI || | |MaeII CviAII || | |AcyI BsgI || | ZraI || AatII || TaiI || SetI |Hpy99I |Csp6I RsaI H A V V D A T K E P K N F N F L Y D V N M L W * M Q R K N Q R T L T F C T T S I C C G R C N E R T K E L * L F V R R Q * ----:----|----:----|----:----|----:----|----:----|----:----| C A T T S A V F S G F F K L K K Y S T L V H Q P L H L S L V L S S * S K T R R * M S H Y I C R F F W L V K V K Q V V D I AluI BccI CviJI | HindIII |MnlI | | AluI ||SetI | | CviJI SfaNI HphI ||| TaqI | | | SetI | XcmI TaqI \\\ \ \ \ \ \ \ \ \ AGCTCCATCGAGGACAAGCTTACCAGCATCGTCCAAAAAATGTATGGTGGGGCAAAAATC 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGGTAGCTCCTGTTCGAATGGTCGTAGCAGGTTTTTTACATACCACCCCGTTTTTAG / / / / / / / / CviJI | | | | HindIII SfaNI HphI AluI | | | CviJI XcmI MnlI | | | AluI | | SetI | BccI TaqI S S I E D K L T S I V Q K M Y G G A K I A P S R T S L P A S S K K C M V G Q K S L H R G Q A Y Q H R P K N V W W G K N R ----:----|----:----|----:----|----:----|----:----|----:----| L E M S S L S V L M T W F I Y P P A F I Y S W R P C A * W C R G F F T H H P L F A G D L V L K G A D D L F H I T P C F D CviJI CviJI SetI | MboII \ \ \ \ GAAGTATCACCAGAAGCCCAAAAAAAGATAGACACCTACAAAAAACAAGGCTTCGGTAAT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCATAGTGGTCTTCGGGTTTTTTTCTATCTGTGGATGTTTTTTGTTCCGAAGCCATTA / / / // TaqI CviJI SetI |MboII CviJI E V S P E A Q K K I D T Y K K Q G F G N K Y H Q K P K K R * T P T K N K A S V I S I T R S P K K D R H L Q K T R L R * S ----:----|----:----|----:----|----:----|----:----|----:----| S T D G S A W F F I S V * L F C P K P L R L I V L L G F F S L C R C F V L S R Y F Y * W F G L F L Y V G V F F L A E T I BinI* | FatI | |CviAII | || MboI BccI | || |NlaIII | DdeI | || ||DpnI MseI | | TspDTI SspI | || |||BstKTI | BccI \ \ \ \ \ \\ \\\\ \ \ CTTCCCATCTGTATTGCTAAGACACAATATTCATTATCCCATGATCCATCATTAAAGGGT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGGGTAGACATAACGATTCTGTGTTATAAGTAATAGGGTACTAGGTAGTAATTTCCCA / / / / // /// / // / | | DdeI SspI || ||| MboI |BccI MnlI | TspDTI || ||DpnI MseI BccI || |BstKTI || |FatI || CviAII |NlaIII BinI* L P I C I A K T Q Y S L S H D P S L K G F P S V L L R H N I H Y P M I H H * R V S H L Y C * D T I F I I P * S I I K G C ----:----|----:----|----:----|----:----|----:----|----:----| R G M Q I A L V C Y E N D W S G D N F P D E W R Y Q * S V I N M I G H D M M L P K G D T N S L C L I * * G M I W * * L T BseGI | AluI SetI | CviJI SetI | MaeII | | SetI |CviRI* MnlI | | SetI BsiYI* | | |FokI || SetI | MaeI | | TaiI | BccI | | |BspMI || | BbvI \ \ \ \ \ \ \ \ \ \\ \\ \ \ GTTCCTAGAGGTTTTACGTTCCCCATCAGGGATGTGAGAGCTTCAATAGGTGCAGGTTAT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGATCTCCAAAATGCAAGGGGTAGTCCCTACACTCTCGAAGTTATCCACGTCCAATA // / / / / / / / / // |SetI | MaeII BsiYI* | | | CviJI | |SetI MaeI TaiI | | | AluI | CviRI* SetI | | SetI BspMI | BseGI FokI BccI SetI V P R G F T F P I R D V R A S I G A G Y F L E V L R S P S G M * E L Q * V Q V I S * R F Y V P H Q G C E S F N R C R L F ----:----|----:----|----:----|----:----|----:----|----:----| T G L P K V N G M L S T L A E I P A P * H E * L N * T G W * P H S L K L L H L N N R S T K R E G D P I H S S * Y T C T I BsgI | TseI | MwoI | CviJI | |BisI | |SfeI* | ||BlsI | |||CviRI* BssKI | |||| PstI |HpaII TaqI MaeIII | |||| | ApoI ||ScrFI |TsoI | FatI | |||| | TspEI ||CauII* || NdeI | |CviAII \ \\\\ \ \ \\\ \\ \ \ \\ TTATACGCTTTGGCTGCAGAAATTCAAACCATACCGGGTCTATCGACATATGCTGGTTAC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| AATATGCGAAACCGACGTCTTTAAGTTTGGTATGGCCCAGATAGCTGTATACGACCAATG / // //// / / / / / / / // BbvI || |||| SfeI* TspEI | | | TaqI NdeI |MaeIII || |||CviRI* ApoI | | TsoI NlaIII || |||TseI | BssKI || ||BisI CauII* || |BlsI HpaII || |PstI ScrFI || CviJI |MwoI BsgI L Y A L A A E I Q T I P G L S T Y A G Y Y T L W L Q K F K P Y R V Y R H M L V T I R F G C R N S N H T G S I D I C W L H ----:----|----:----|----:----|----:----|----:----|----:----| K Y A K A A S I * V M G P R D V Y A P * N I R K P Q L F E F W V P D I S M H Q N * V S Q S C F N L G Y R T * R C I S T V SalI |TaqI |AccI ||HindII ||Hpy166II ||| Hpy99I ||| | Hpy99I ||| | | Hpy99I ||| | | Tsp4CI* ||| | | | Hin4II* HphI NlaIII ||| | | | |TspEI | SetI MseI \ \\\ \ \ \ \\ \ \ \ ATGGCAGTAGAAGTCGACGACGACGGTGAAATTGAAGGTCTATTTTAA 2890 2900 2910 2920 ----:----|----:----|----:----|----:----|----:--- TACCGTCATCTTCAGCTGCTGCTGCCACTTTAACTTCCAGATAAAATT // //// / / / / // / |FatI |||| | | | | |HphI MseI CviAII |||| | | | | SetI |||| | | | TspEI |||| | | Hin4II* |||| | Tsp4CI* |||| Hpy99I |||Hpy99I |||SalI ||AccI ||TaqI |Hpy166II |HindII Hpy99I M A V E V D D D G E I E G L F * W Q * K S T T T V K L K V Y F X G S R S R R R R * N * R S I L X ----:----|----:----|----:----|----:----|----:--- M A T S T S S S P S I S P R N * C P L L L R R R R H F Q L D I K H C Y F D V V V T F N F T * K L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 3 FblI,XmiI AciI 5 BspACI,SsiI AclI 2 Psp1406I AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AluI 17 AluBI ApoI 2 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 8 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 13 BceAI 4 BcgI 1 BdaI 4 BetI* 1 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmeT110I 1 BmgT120I 6 Bpu10I 1 BsaAI 4 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 9 BstF5I,BtsCI BseMII 2 BseRI 1 BsgI 3 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 2 BspMI 2 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 7 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstAPI 1 BstKTI 2 BstXI 1 BtgZI 1 Cac8I 4 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 8 CviQI,RsaNI CspCI 1 CviAII 16 CviJI 37 CviKI-1 CviRI* 15 HpyCH4V DdeI 6 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 2 MalI DraII 1 EcoO109I DsaI* 3 BtgI,BstDSI Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 4 AcuI Eco57MI 4 EcoP15I 3 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 3 Eco32I FalI 6 FatI 16 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 9 GlaI 5 HaeII 2 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 5 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 9 HpyAV Hin6I 5 HinP1I,HspAI HindII 2 HincII HindIII 6 HinfI 12 HpaII 4 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 12 Hpy99I 6 KasI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 12 HpyCH4IV MaeIII 10 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 MfeI 1 MunI MlyI 5 SchI MmeI 3 MnlI 14 MseI 20 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 11 HpyF10VI,BstMWI NarI 1 Mly113I NcoI 2 Bsp19I NdeI 1 FauNDI NlaIII 16 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NmeAIII 1 NruI 1 BtuMI,Bsp68I NspI 2 BstNSI,XceI PasI 1 PflMI 1 BasI,AccB7I,Van91I PleI 5 PpsI PpuMI 1 Psp5II,PspPPI PspXI 1 PstI 1 RsaI 8 AfaI SacI 1 Psp124BI,SstI SalI 2 SanDI 1 ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 48 SexAI 1 MabI SfaNI 8 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SnaBI 2 Eco105I,BstSNI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 2 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 12 TaqI 12 TaqII 3 TatI 3 TauI 1 TfiI 7 PfeI TseI 8 ApeKI TsoI 7 Tsp45I 3 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 20 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 6 TscAI TstI 1 VspI 1 PshBI,AseI XbaI 1 XcmI 3 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflIII AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BamHI BarI BbvCI Bce83I* BciVI BclI BfiI BglI BglII BmtI BplI BsePI BseSI BseYI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BssNAI Bst1107I BstEII BstZ17I BtrI BtsI Cfr9I DraIII DrdI Eam1105I EciI EcoNI EcoRI EcoT22I Esp3I EspI* FauI FseI FspAI GsaI GsuI HpaI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NgoMIV NheI NotI NsiI NspBII* OliI PacI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PsrI PvuI PvuII RsrII SacII SapI SauI* ScaI SfiI SgfI SgrAI SgrDI SmaI SrfI Sse232I* Sse8387I StuI SwaI TspMI Tth111I XhoII XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769