Restriction Map of OLA1/YBR025C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

OLA1/YBR025C on chromosome II from coordinates 291865 to 290681.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.22947

EMBOSS_001 BssKI EcoRII | ScrFI MboII | BseBI MnlI TaqI |SetI | | SetI \ \ \\ \ \ \ ATGCCTCCAAAGAAGCAAGTCGAAGAAAAAAAGGTCTTATTGGGTCGTCCAGGTAATAAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGAGGTTTCTTCGTTCAGCTTCTTTTTTTCCAGAATAACCCAGCAGGTCCATTATTG / / / / // / MnlI TaqI | MboII || EcoRII SetI || BssKI |BseBI |ScrFI SetI M P P K K Q V E E K K V L L G R P G N N C L Q R S K S K K K R S Y W V V Q V I T A S K E A S R R K K G L I G S S R * * L ----:----|----:----|----:----|----:----|----:----|----:----| X G G F F C T S S F F T K N P R G P L L X A E L S A L R L F F P R I P D D L Y Y H R W L L L D F F F L D * Q T T W T I V CfrI | BalI | CviJI TstI CviJI | HaeIII AccI | CviJI Cfr10I | | FalI |Hpy166II | | FalI |HpaII | | FalI || SetI | | FalI \\ \ \ \ \\ \ \ \ \ TTGAAAGCCGGTATTGTCGGTTTGGCCAATGTTGGTAAGTCTACCTTTTTCCAAGCCATC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTCGGCCATAACAGCCAAACCGGTTACAACCATTCAGATGGAAAAAGGTTCGGTAG / // / / / // / / | |Cfr10I | | CfrI || TstI CviJI | HpaII | HaeIII |AccI FalI CviJI | CviJI |SetI FalI | BalI Hpy166II FalI FalI L K A G I V G L A N V G K S T F F Q A I * K P V L S V W P M L V S L P F S K P S E S R Y C R F G Q C W * V Y L F P S H H ----:----|----:----|----:----|----:----|----:----|----:----| K F A P I T P K A L T P L D V K K W A M S S L R Y Q R N P W H Q Y T * R K G L W Q F G T N D T Q G I N T L R G K E L G D MaeIII BstEII | BseYI BinI* | | TstI | MboI | | | AluI | | DpnI | | | GsaI | | |BstKTI MaeI | | | CviJI | | ||Hpy178III* | BccI | | | | SetI | | ||| BslFI \ \ \ \ \ \ \ \ \ \\\ \ ACTAGATGTCCATTGGGTAACCCAGCTAACTATCCATTCGCTACCATTGATCCAGAAGAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCTACAGGTAACCCATTGGGTCGATTGATAGGTAAGCGATGGTAACTAGGTCTTCTT // / / / / / // / / |BccI | | | BseYI | || | Hpy178III* MaeI | | | CviJI | || MboI | | | AluI | |DpnI | | SetI | BstKTI | BstEII BinI* | MaeIII | GsaI TstI T R C P L G N P A N Y P F A T I D P E E L D V H W V T Q L T I H S L P L I Q K K * M S I G * P S * L S I R Y H * S R R S ----:----|----:----|----:----|----:----|----:----|----:----| V L H G N P L G A L * G N A V M S G S S * * I D M P Y G L * S D M R * W Q D L L S S T W Q T V W S V I W E S G N I W F F CviJI MboII BccI \ \ \ GCCCGTGTTATTGTCCCATCTCCAAGATTTGATAAGTTGTGTGAAATCTACAAGAAGACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGCACAATAACAGGGTAGAGGTTCTAAACTATTCAACACACTTTAGATGTTCTTCTGT // / / / || MboII BccI SetI |BslFI CviJI A R V I V P S P R F D K L C E I Y K K T P V L L S H L Q D L I S C V K S T R R Q P C Y C P I S K I * * V V * N L Q E D S ----:----|----:----|----:----|----:----|----:----|----:----| A R T I T G D G L N S L N H S I * L F V L G H * Q G M E L I Q Y T T H F R C S S G T N N D W R W S K I L Q T F D V L L C AluI CviJI BbvII* | SetI AluI Tsp4CI* | | MboII CviJI | Hpy166II HgiCI* | | Hpy188I | SetI | | EcoP15I DdeI | NlaIV \ \ \ \ \ \ \ \ \ \ \ GCTTCGGAAGTTCCAGCTCATTTGACCGTTTACGATATTGCTGGTTTGACTAAGGGTGCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGCCTTCAAGGTCGAGTAAACTGGCAAATGCTATAACGACCAAACTGATTCCCACGG / / / / / / / / / / | Hpy188I | CviJI | | EcoP15I | | HgiCI* | BbvII* | AluI | Hpy166II | NlaIV | MboII SetI Tsp4CI* DdeI CviJI AluI A S E V P A H L T V Y D I A G L T K G A L R K F Q L I * P F T I L L V * L R V P F G S S S S F D R L R Y C W F D * G C L ----:----|----:----|----:----|----:----|----:----|----:----| A E S T G A * K V T * S I A P K V L P A L K P L E L E N S R K R Y Q Q N S * P H S R F N W S M Q G N V I N S T Q S L T G BsmAI | MboI | Hpy188I | | DpnI | | |BstKTI | | || TaqI Hin4II* SetI | | || | TfiI | MnlI | HphI | | || | HinfI \ \ \ \ \ \ \\ \ \ TCTGCTGGTGAAGGTTTGGGTAATGCTTTCTTGTCTCACATCAGATCAGTCGATTCTATC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGACCACTTCCAAACCCATTACGAAAGAACAGAGTGTAGTCTAGTCAGCTAAGATAG / / / / / // / / / | | SetI HphI | || MboI | HinfI | MnlI | |DpnI | TfiI Hin4II* | BstKTI TaqI Hpy188I BsmAI S A G E G L G N A F L S H I R S V D S I L L V K V W V M L S C L T S D Q S I L S C W * R F G * C F L V S H Q I S R F Y L ----:----|----:----|----:----|----:----|----:----|----:----| E A P S P K P L A K K D * M L D T S E I R Q Q H L N P Y H K R T E C * I L R N * R S T F T Q T I S E Q R V D S * D I R D MnlI | MaeII | | SetI | | TaiI | | |BsiYI* | | || MaeIII | | || Tsp45I | | || | BinI* | | || | |MaeII | | || | || SetI | | || | || TaiI | | || | || |MboI SfaNI | | || | || || DpnI | TaqI TspEI | | || | || || |BstKTI \ \ \ \ \ \\ \ \\ \\ \\ TACCAAGTCGTTCGTTGTTTCGATGATGCTGAAATTATCCACGTTGAGGGTGACGTTGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTTCAGCAAGCAACAAAGCTACTACGACTTTAATAGGTGCAACTCCCACTGCAACTA / / / / / // //// /// | TaqI | | | |MaeII |||| ||HphI SfaNI | | | BsiYI* |||| |DpnI | | TaiI |||| |BsrI | | SetI |||| BstKTI | MnlI |||MaeII TspEI ||Tsp45I ||MaeIII |BinI* TaiI SetI Y Q V V R C F D D A E I I H V E G D V D T K S F V V S M M L K L S T L R V T L I P S R S L F R * C * N Y P R * G * R * S ----:----|----:----|----:----|----:----|----:----|----:----| * W T T R Q K S S A S I I W T S P S T S R G L R E N N R H H Q F * G R Q P H R Q V L D N T T E I I S F N D V N L T V N I ApoI BsrI Hpy178III* TspEI HphI | TspEI MseI DdeI TsoI EcoRI \ \ \ \ \ \ \ CCAGTTCGTGATTTAGAAATTATTAACCAAGAACTAAGATTGAAAGATATTGAATTCGCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAAGCACTAAATCTTTAATAATTGGTTCTTGATTCTAACTTTCTATAACTTAAGCGT / / / / // / MboI Hpy178III* | MseI |TsoI EcoRI TspEI DdeI TspEI ApoI P V R D L E I I N Q E L R L K D I E F A Q F V I * K L L T K N * D * K I L N S H S S * F R N Y * P R T K I E R Y * I R T ----:----|----:----|----:----|----:----|----:----|----:----| G T R S K S I I L W S S L N F S I S N A D L E H N L F * * G L V L I S L Y Q I R W N T I * F N N V L F * S Q F I N F E C MwoI | CviJI SetI | Hin4II* | CspCI MnlI SetI CspCI \ \ \ \ \ \ \ CAAAAGGCTTTGGAAGGTGCTGAAAAGATTGCCAAAAGAGGTGGTCAATCTTTGGAAGTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCCGAAACCTTCCACGACTTTTCTAACGGTTTTCTCCACCAGTTAGAAACCTTCAG / // / / / / / MwoI |CviJI SetI CspCI MnlI SetI CspCI Hin4II* Q K A L E G A E K I A K R G G Q S L E V K R L W K V L K R L P K E V V N L W K S K G F G R C * K D C Q K R W S I F G S Q ----:----|----:----|----:----|----:----|----:----|----:----| C F A K S P A S F I A L L P P * D K S T V F P K P L H Q F S Q W F L H D I K P L L L S Q F T S F L N G F S T T L R Q F D MseI Hin4II* MboII | TspEI MaeI \ \ \ \ \ AAACAAAAGAAGGAAGAAATGGATTTGATTACGAAAATCATTAAATTGCTAGAGAGTGGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTTTTCTTCCTTCTTTACCTAAACTAATGCTTTTAGTAATTTAACGATCTCTCACCA / / / / / Hin4II* MboII | | MaeI | TspEI MseI K Q K K E E M D L I T K I I K L L E S G N K R R K K W I * L R K S L N C * R V V T K E G R N G F D Y E N H * I A R E W S ----:----|----:----|----:----|----:----|----:----|----:----| L C F F S S I S K I V F I M L N S S L P * V F S P L F P N S * S F * * I A L S H F L L L F F H I Q N R F D N F Q * L T T PfoI BssKI EcoRII FatI | ScrFI |CviAII | BseBI TspEI || NlaIII \ \ \ \\ \ CAAAGAGTTGCTAATCACTCCTGGACTTCAAAAGAAGTTGAAATTATCAACTCCATGTTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCTCAACGATTAGTGAGGACCTGAAGTTTTCTTCAACTTTAATAGTTGAGGTACAAG / / / / // | EcoRII TspEI | |FatI | BssKI | CviAII | PfoI NlaIII BseBI ScrFI Q R V A N H S W T S K E V E I I N S M F K E L L I T P G L Q K K L K L S T P C S K S C * S L L D F K R S * N Y Q L H V L ----:----|----:----|----:----|----:----|----:----|----:----| * L T A L * E Q V E F S T S I I L E M N D F L Q * D S R S K L L L Q F * * S W T L S N S I V G P S * F F N F N D V G H E HindII Hpy166II | DdeI | EspI* MseI | | CviJI VspI | | |FatI |TspEI | | ||CviAII || Hin4I | | ||| NlaIII || | Hpy188I Hpy188I \ \ \\\ \ \\ \ \ \ TTGTTGACTGCTAAGCCATGTATCTATTTGATTAATTTATCTGAAAGAGATTACATCAGA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AACAACTGACGATTCGGTACATAGATAAACTAATTAAATAGACTTTCTCTAATGTAGTCT / /// // // / / / Hpy166II ||| |FatI || | Hpy188I Hpy188I HindII ||| CviAII || TspEI ||NlaIII |VspI |CviJI |MseI EspI* Hin4I DdeI L L T A K P C I Y L I N L S E R D Y I R C * L L S H V S I * L I Y L K E I T S E V D C * A M Y L F D * F I * K R L H Q K ----:----|----:----|----:----|----:----|----:----|----:----| K N V A L G H I * K I L K D S L S * M L R T S Q * A M Y R N S * N I Q F L N C * Q Q S S L W T D I Q N I * R F S I V D S Hin4I | GsuI | Eco57MI BssKI | | AccI EcoRII | | |Hpy166II | ScrFI DdeI | | || TatI | BseBI | SfaNI | | || |Csp6I | | MaeIII | | TfiI | | || ||RsaI | | Tsp45I Hin4I | | HinfI | | || ||ScaI | | | SetI \ \ \ \ \ \ \\ \\\ \ \ \ \ AAGAAAAACAAGCATCTGCTAAGAATCAAGGAATGGGTAGACAAGTACTCTCCAGGTGAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTTGTTCGTAGACGATTCTTAGTTCCTTACCCATCTGTTCATGAGAGGTCCACTG / / // / // /// // / / / Hin4I | |HinfI | |AccI ||TatI || | | Tsp45I | |Hin4I | | |Csp6I || | | MaeIII | |TfiI | | ScaI || | Hin4I | SfaNI | | RsaI || EcoRII DdeI | Hpy166II || BssKI Eco57MI |BseBI GsuI |ScrFI SetI K K N K H L L R I K E W V D K Y S P G D R K T S I C * E S R N G * T S T L Q V T E K Q A S A K N Q G M G R Q V L S R * L ----:----|----:----|----:----|----:----|----:----|----:----| F F F L C R S L I L S H T S L Y E G P S F S F C A D A L F * P I P L C T S E L H L F V L M Q * S D L F P Y V L V R W T V MboI BclI TspRI |Hin4I | XbaI ||DpnI | |MaeI MboII |||BstKTI | |Hpy178III* | NdeI |||| HphI | || BslFI | | SfaNI \\\\ \ \ \\ \ \ \ \ TTGATCATTCCATTCAGTGTTTCTCTAGAAGAAAGACTATCTCATATGTCCCCAGAAGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAGTAAGGTAAGTCACAAAGAGATCTTCTTTCTGATAGAGTATACAGGGGTCTTCTA // / / // / / / / || HphI TspRI |XbaI | MboII NdeI SfaNI || BclI | BslFI || MboI Hpy178III* |DpnI MaeI BstKTI L I I P F S V S L E E R L S H M S P E D * S F H S V F L * K K D Y L I C P Q K M D H S I Q C F S R R K T I S Y V P R R C ----:----|----:----|----:----|----:----|----:----|----:----| K I M G N L T E R S S L S D * I D G S S S S * E M * H K E L L F V I E Y T G L L Q D N W E T N R * F F S * R M H G W F I MboII | MboII | | SfeI* | | |Eco57I | | |Eco57MI BsmAI | | ||CviRI* |MslI MboII | | ||| PstI ||FatI | TspEI | | ||| |MboII |||CviAII \ \ \ \ \\\ \\ \\\\ GCTGAAGAAGAATTGAAGAAACTGCAGACAATATCTGCCTTGCCAAAGATTATCACTACC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTCTTCTTAACTTCTTTGACGTCTGTTATAGACGGAACGGTTTCTAATAGTGATGG / // / // / / // MboII || | || | MboII |NlaIII || | || | SfeI* MslI || | || CviRI* || | |PstI || | Eco57MI || | Eco57I || MboII |MboII TspEI A E E E L K K L Q T I S A L P K I I T T L K K N * R N C R Q Y L P C Q R L S L P * R R I E E T A D N I C L A K D Y H Y H ----:----|----:----|----:----|----:----|----:----|----:----| A S S S N F F S C V I D A K G F I I V V H Q L L I S S V A S L I Q R A L S * * * S F F F Q L F Q L C Y R G Q W L N D S G SetI |AciI || AsuI* || AvaII || |BmgT120I || || AarI HphI || || BspMI Hpy178III* NlaIII TstI || || Hpy178III* |TstI \ \ \\ \\ \ \\ ATGAGACAAAAGTTAGATTTGATTTCCTTTTTCACCTGCGGTCCAGATGAAGTTCGTGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCTGTTTTCAATCTAAACTAAAGGAAAAAGTGGACGCCAGGTCTACTTCAAGCACTT /// / / / / // / / / / / ||FatI | HphI SetI | || | | TstI | TspDTI |CviAII TstI | || | BspMI Hpy178III* BsmAI | || | AarI | || Hpy178III* | |AvaII | |AsuI* | BmgT120I AciI M R Q K L D L I S F F T C G P D E V R E * D K S * I * F P F S P A V Q M K F V N E T K V R F D F L F H L R S R * S S * M ----:----|----:----|----:----|----:----|----:----|----:----| M L C F N S K I E K K V Q P G S S T R S W S V F T L N S K R K * R R D L H L E H H S L L * I Q N G K E G A T W I F N T F AsuI* AvaII TspDTI |BmgT120I || Ksp632I* || |MnlI || |EcoP15I || || BsaXI || || |Hpy188I || || || BccI || || || | Csp6I || || || | |RsaI || || || | |SetI || || || | || BbvI || || || | || | MboII || || || | || | | AluI || || || | || | | CviJI || || || | || | | | SetI || || || | || | | | | MwoI || || || | || | | | | | TseI || || || | || | | | | | AluI || || || | || | | | | | CviJI || || || | || | | | | | |BisI || || || | || | | | | | ||BlsI || || || | || | | | | | ||SetI || || || | || | | | | | |||TspDTI || || || | || | | | | | |||| BsaXI MseI \\ \\ \\ \ \\ \ \ \ \ \ \\\\ \ \ TGGACCATCAGAAGAGGTACTAAAGCTCCACAAGCTGCTGGTGTTATTCATAACGATTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTGGTAGTCTTCTCCATGATTTCGAGGTGTTCGACGACCACAATAAGTATTGCTAAAT /// / / // // / / / //// / ||| | | || || | | | |||TseI MseI ||| | | || || | | | ||BsaXI ||| | | || || | | | ||BisI ||| | | || || | | | |TspDTI ||| | | || || | | | |BlsI ||| | | || || | | | CviJI ||| | | || || | | | AluI ||| | | || || | | SetI ||| | | || || | MwoI ||| | | || || CviJI ||| | | || || AluI ||| | | || || BbvI ||| | | || |SetI ||| | | || MboII ||| | | |Csp6I ||| | | RsaI ||| | BccI ||| | SetI ||| Ksp632I* ||| Hpy188I ||| EcoP15I ||BsaXI ||MnlI |AvaII |AsuI* BmgT120I W T I R R G T K A P Q A A G V I H N D L G P S E E V L K L H K L L V L F I T I * D H Q K R Y * S S T S C W C Y S * R F N ----:----|----:----|----:----|----:----|----:----|----:----| H V M L L P V L A G C A A P T I * L S K I S W * F L Y * L E V L Q Q H * E Y R N P G D S S T S F S W L S S T N N M V I * TspDTI TspDTI | TaqI Bce83I* | CviJI MboII | AsuII | SetI | |SmlI BbvII* | | MboII \ \ \ \\ \ \ \ \ ATGAATACCTTTATTTTGGCTCAAGTTATGAAATGTGAAGATGTCTTCGAATATAAGGAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTATGGAAATAAAACCGAGTTCAATACTTTACACTTCTACAGAAGCTTATATTCCTG / / / / / / // // | SetI | | SmlI | |TspDTI |AsuII Bce83I* | CviJI | BbvII* |TaqI TspDTI MboII MboII M N T F I L A Q V M K C E D V F E Y K D * I P L F W L K L * N V K M S S N I R T E Y L Y F G S S Y E M * R C L R I * G R ----:----|----:----|----:----|----:----|----:----|----:----| I F V K I K A * T I F H S S T K S Y L S L S Y R * K P E L * S I H L H R R I Y P H I G K N Q S L N H F T F I D E F I L V BglI MwoI | BccI | CviJI | HaeIII | |AciI | |BisI | ||BlsI | |||TauI TfiI | |||NspBII* HinfI | ||||SfaNI CviRI* Tth111I \ \ \\\\\ \ \ GATTCTGCCATCAAGGCCGCTGGTAAGTTGATGCAAAAGGGTAAAGACTATGTCGTTGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGACGGTAGTTCCGGCGACCATTCAACTACGTTTTCCCATTTCTGATACAGCAACTT / / //// / / / HinfI MwoI |||| SfaNI CviRI* Tth111I TfiI BglI |||NspBII* |||AciI ||BisI |BccI |BlsI HaeIII CviJI TauI D S A I K A A G K L M Q K G K D Y V V E I L P S R P L V S * C K R V K T M S L K F C H Q G R W * V D A K G * R L C R * R ----:----|----:----|----:----|----:----|----:----|----:----| S E A M L A A P L N I C F P L S * T T S R N Q W * P R Q Y T S A F P Y L S H R Q I R G D L G S T L Q H L L T F V I D N F Eco57I Eco57MI |Tsp4CI* Hpy188I ||BbvII* | AluI ||| EcoRV | CviJI ||| |MboII HphI | | SetI TspEI \\\ \\ \ \ \ \ \ GACGGTGATATCATTTACTTCAGAGCTGGTGCTGGTAAGAATTGA 1150 1160 1170 1180 ----:----|----:----|----:----|----:----|----: CTGCCACTATAGTAAATGAAGTCTCGACCACGACCATTCTTAACT / / / / / / / / | | | HphI | | CviJI TspEI | | BbvII* | | AluI | | MboII | SetI | | EcoRV Hpy188I | Tsp4CI* Eco57MI Eco57I D G D I I Y F R A G A G K N * T V I S F T S E L V L V R I X R * Y H L L Q S W C W * E L X ----:----|----:----|----:----|----:----|----: S P S I M * K L A P A P L F Q L R H Y * K S * L Q H Q Y S N V T I D N V E S S T S T L I S # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 2 FblI,XmiI AciI 2 BspACI,SsiI AluI 6 AluBI ApoI 1 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 1 BpuEI BclI 1 FbaI,Ksp22I BglI 1 BinI* 2 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseYI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspMI 1 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 4 Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 2 CviQI,RsaNI CspCI 1 CviAII 3 CviJI 14 CviKI-1 CviRI* 2 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 4 MalI Eco57I 2 AcuI Eco57MI 3 EcoP15I 2 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 3 GsaI 1 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 2 Hin4II* 3 HpyAV HindII 1 HincII HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 6 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 13 MnlI 5 MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PfoI 1 PstI 1 RsaI 2 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SetI 18 SfaNI 4 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI TaiI 2 TaqI 4 TatI 1 TauI 1 TfiI 3 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 8 TasI,Tsp509I,Sse9I TspRI 1 TscAI TstI 2 Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XbaI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BamHI BarI BbvCI BceAI BcgI BciVI BdaI BetI* BfiI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BseGI BseMII BsePI BseRI BseSI BsgI BsiI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstF5I BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr9I ClaI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoT22I EgeI EheI Esp3I FauI FnuDII* FokI FseI FspAI GlaI HaeII HgaI HgiAI* HgiJII* HhaI Hin6I HindIII HinP1I HpaI Hpy99I HspAI KasI KpnI MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SchI SduI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TspGWI TspMI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769