Restriction Map of CHS3/YBR023C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

CHS3/YBR023C on chromosome II from coordinates 287925 to 284428.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Hpy188I | Hin4I | Hin4I BinI* | |MseI | MboI | |SetI Cfr10I | | DpnI | || BarI |HpaII | | |BstKTI | || | Hpy178III* || CviJI | | ||Hpy178III* | || | |Ksp632I* \\ \ \ \ \\\ \ \\ \ \\ ATGACCGGCTTGAATGGAGATGATCCTGATGACTACTATCTGAACCTTAATCAAGATGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGGCCGAACTTACCTCTACTAGGACTACTGATGATAGACTTGGAATTAGTTCTACTT // / // / / // / / / / / |Cfr10I | || | Hpy178III* || | | MseI | Ksp632I* |CviJI | || MboI || | BarI Hpy178III* HpaII | |DpnI || SetI | BstKTI |Hin4I BinI* |Hin4I Hpy188I M T G L N G D D P D D Y Y L N L N Q D E * P A * M E M I L M T T I * T L I K M K D R L E W R * S * * L L S E P * S R * R ----:----|----:----|----:----|----:----|----:----|----:----| X V P K F P S S G S S * * R F R L * S S X S R S S H L H D Q H S S D S G * D L H H G A Q I S I I R I V V I Q V K I L I F BsmAI |PleI ||DdeI ||MlyI ||MboII |||Hin4I |||Hin4I |||TspDTI |||| SetI |||| |Hpy178III* |||| ||Hin4I |||| ||Hin4I |||| ||| BarI |||| ||| | Tsp4CI* |||| ||| | Eam1105I |||| ||| | | TspRI |||| ||| | | | CviJI |||| ||| | | | |DdeI |||| ||| | | | |Bpu10I |||| ||| | | | || Hpy178III* |||| ||| | | | || | SduI |||| ||| | | | || | HgiAI* |||| ||| | | | || | |Hin4I |||| ||| | | | || | |Hin4I |||| ||| | | | || | || SetI |||| ||| | | | || | || |BspCNI |||| ||| | | | || | || ||BseMII |||| ||| | | | || | || ||| MnlI HinfI |||| ||| | | | || | || ||| | CviJI \ \\\\ \\\ \ \ \ \\ \ \\ \\\ \ \ GAGTCTCTACTTAGGTCAAGACACAGTGTCGGCTCAGGAGCACCTCATAGACAAGGCTCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAGAGATGAATCCAGTTCTGTGTCACAGCCGAGTCCTCGTGGAGTATCTGTTCCGAGA / / // // / / / / / /// / // / / | | || || | | | | | ||| | |BseMII | CviJI | | || || | | | | | ||| | BspCNI MnlI | | || || | | | | | ||| SetI | | || || | | | | | ||HgiAI* | | || || | | | | | ||Hin4I | | || || | | | | | ||Hin4I | | || || | | | | | ||SduI | | || || | | | | | |Hpy178III* | | || || | | | | | Bpu10I | | || || | | | | | DdeI | | || || | | | | CviJI | | || || | | | Eam1105I | | || || | | | Tsp4CI* | | || || | | TspRI | | || || | Hpy178III* | | || || BarI | | || |Hin4I | | || |Hin4I | | || |DdeI | | || BsmAI | | || SetI | | |PleI | | |MlyI | | TspDTI | | MboII | Hin4I | Hin4I HinfI E S L L R S R H S V G S G A P H R Q G S S L Y L G Q D T V S A Q E H L I D K A L V S T * V K T Q C R L R S T S * T R L F ----:----|----:----|----:----|----:----|----:----|----:----| S D R S L D L C L T P E P A G * L C P E L T E V * T L V C H R S L L V E Y V L S L R * K P * S V T D A * S C R M S L A R AciI |BisI ||BlsI ||AsuI* |||TauI Hin6I |||CviJI |GlaI |||HaeIII |MstI* |||BmgT120I CviJI Hpy178III* ||HhaI \\\\ \ \ \\\ TTAGTGCGGCCCGAAAGAAGCCGACTGAACAATCCTGATAATCCACATTTTTATTATGCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AATCACGCCGGGCTTTCTTCGGCTGACTTGTTAGGACTATTAGGTGTAAAAATAATACGC ////// / / /// |||||AsuI* CviJI Hpy178III* ||Hin6I ||||BmgT120I |MstI* |||HaeIII |GlaI |||CviJI HhaI ||BisI ||AciI |BlsI TauI L V R P E R S R L N N P D N P H F Y Y A * C G P K E A D * T I L I I H I F I M R S A A R K K P T E Q S * * S T F L L C A ----:----|----:----|----:----|----:----|----:----|----:----| K T R G S L L R S F L G S L G C K * * A K L A A R F F G V S C D Q Y D V N K N H * H P G F S A S Q V I R I I W M K I I R FokI | Csp6I TfiI | |RsaI HinfI | |BccI | BssKI | ||AgeI | EcoRII | ||BetI* | | ScrFI | ||Cfr10I | | BseBI | |||HpaII | | |SetI TspDTI | |||| MmeI MwoI HphI | | |MslI | BseGI | |||| | Hpy166II \ \ \ \ \\ \ \ \ \\\\ \ \ CAGAAAACGCAGGAGCAGATGAATCACCTGGATGTTTTACCATCAAGTACCGGTGTAAAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTTTGCGTCCTCGTCTACTTAGTGGACCTACAAAATGGTAGTTCATGGCCACATTTG / / // / // / /// // / MwoI HphI || | || BseGI ||| || Hpy166II || | |TspDTI ||| |Cfr10I || | EcoRII ||| |BetI* || | BssKI ||| |AgeI || BseBI ||| |MmeI || ScrFI ||| HpaII || MslI ||Csp6I |SetI ||BccI HinfI |RsaI TfiI FokI Q K T Q E Q M N H L D V L P S S T G V N R K R R S R * I T W M F Y H Q V P V * T E N A G A D E S P G C F T I K Y R C K P ----:----|----:----|----:----|----:----|----:----|----:----| C F V C S C I F * R S T K G D L V P T F A S F A P A S S D G P H K V M L Y R H L L F R L L L H I V Q I N * W * T G T Y V Hpy99I Hpy188I | CviJI | |NlaIV TspRI | || MwoI MwoI | ApoI | || |Hin6I | CviJI | TspEI | || ||GlaI | |DdeI | BspCNI CviRI* | || |||HhaI | |CspCI | |BseMII \ \ \\ \\\\ \ \\ \ \\ CCAAATGCAACTCGTCGGAGTGGCTCCCTGCGCTCCAAAGGCTCAGTGAGAAGCAAATTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTACGTTGAGCAGCCTCACCGAGGGACGCGAGGTTTCCGAGTCACTCTTCGTTTAAA / / / // / /// / // / // / | | | || | ||| MwoI || DdeI || TspEI | | | || | ||Hin6I |CviJI || ApoI | | | || | |GlaI |TspRI |BseMII | | | || | HhaI CspCI BspCNI | | | || MwoI | | | |NlaIV | | | CviJI | | Hpy188I | Hpy99I CviRI* P N A T R R S G S L R S K G S V R S K F Q M Q L V G V A P C A P K A Q * E A N L K C N S S E W L P A L Q R L S E K Q I * ----:----|----:----|----:----|----:----|----:----|----:----| G F A V R R L P E R R E L P E T L L L N G L H L E D S H S G A S W L S L S F C I W I C S T P T A G Q A G F A * H S A F K CfrI | CviJI | HaeIII | |AciI | |BisI | ||BlsI | |||TauI | |||FnuDII* | |||| BsiYI* | |||| | CspCI | |||| | | AluI Hin4II* | |||| | | CviJI | TspGWI | |||| | | BsaBI | |TspDTI | |||| | | | SetI TspGWI | || CviJI \ \\\\ \ \ \ \ \ \ \\ \ AGTGGCCGCGAAACGGATAGCTATCTTTTACAAGATATGAATACTACTGACAAGAAGGCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCACCGGCGCTTTGCCTATCGATAGAAAATGTTCTATACTTATGATGACTGTTCTTCCGA ///// / / / / / // / ||||| | | BsaBI TspGWI | |TspDTI CviJI ||||| | | CviJI | TspGWI ||||| | | AluI Hin4II* ||||| | SetI ||||| CspCI ||||BsiYI* |||FnuDII* |||AciI ||CfrI ||BisI |BlsI HaeIII CviJI TauI S G R E T D S Y L L Q D M N T T D K K A V A A K R I A I F Y K I * I L L T R R L W P R N G * L S F T R Y E Y Y * Q E G F ----:----|----:----|----:----|----:----|----:----|----:----| L P R S V S L * R K C S I F V V S L F A * H G R F P Y S D K V L Y S Y * Q C S P T A A F R I A I K * L I H I S S V L L S SetI | AciI | | TspDTI | | | ApoI | | | TspEI | | | |BbvII* | | | || BccI MseI Hin4II* | | | || MboII Hpy166II \ \ \ \ \ \\ \ \ TCCGTTAAAATAAGTGATGAAGGTGTTGCGGAAGACGAATTTGATAAAGATGGTGATGTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCAATTTTATTCACTACTTCCACAACGCCTTCTGCTTAAACTATTTCTACCACTACAC / / / / // / / MseI Hin4II* SetI TspDTI || BccI Hpy166II AciI |BbvII* |MboII TspEI ApoI S V K I S D E G V A E D E F D K D G D V P L K * V M K V L R K T N L I K M V M W R * N K * * R C C G R R I * * R W * C G ----:----|----:----|----:----|----:----|----:----|----:----| E T L I L S S P T A S S S N S L S P S T K R * F L H H L H Q P L R I Q Y L H H H G N F Y T I F T N R F V F K I F I T I H AluI CviJI | SetI | | MboII TspEI | | | TseI |HphI | | | |BisI || TaqI | | | ||BlsI || AsuII | | | |||CviJI BbvI MseI \\ \ \ \ \ \\\\ \ \ GACAATTTCGAAGAAAGCTCCACGCAGCCCATAAATAAGTCTATCAAACCATTAAGAAAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTAAAGCTTCTTTCGAGGTGCGTCGGGTATTTATTCAGATAGTTTGGTAATTCTTTC / / / / / / /// / / / | | | | | | ||CviJI BbvI | Hin4I | | | | | | ||TseI | Hin4I | | | | | | |BisI MseI | | | | | | BlsI | | | | | MboII | | | | CviJI | | | | AluI | | | SetI | | AsuII | | TaqI | TspEI HphI D N F E E S S T Q P I N K S I K P L R K T I S K K A P R S P * I S L S N H * E R Q F R R K L H A A H K * V Y Q T I K K G ----:----|----:----|----:----|----:----|----:----|----:----| S L K S S L E V C G M F L D I L G N L F P C N R L F S W A A W L Y T * * V M L F V I E F F A G R L G Y I L R D F W * S L TatI |Csp6I |Hin4I |Hin4I HgiCI* |TspDTI MaeII | NlaIV Hin4I ||RsaI | SetI | |SduI Hin4I ||| Tsp4CI* | TaiI | |BseSI \ \\\ \ \ \ \ \\ GAAACGAATGATACATTGTCATTTTGGCAGATGTACTGTTATTTCATTACGTTTTGGGCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGCTTACTATGTAACAGTAAAACCGTCTACATGACAATAAAGTAATGCAAAACCCGT / / /// / / / / | | ||Tsp4CI* | | | NlaIV | | ||TatI | | | SetI | | |Csp6I | | BseSI | | RsaI | | SduI | TspDTI | MaeII Hin4I TaiI Hin4I SetI E T N D T L S F W Q M Y C Y F I T F W A K R M I H C H F G R C T V I S L R F G H N E * Y I V I L A D V L L F H Y V L G T ----:----|----:----|----:----|----:----|----:----|----:----| S V F S V N D N Q C I Y Q * K M V N Q A P F S H Y M T M K A S T S N N * * T K P F R I I C Q * K P L H V T I E N R K P C Hin4II* TspEI | BseGI |AarI FauI | | CspCI SetI |BspMI |SfaNI AciI | | | FokI \ \\ \\ \ \ \ \ \ CCTGCTCCAATTCTTGCTTTCTGCGGGATGCCAAAGAAGGAAAGACAAATGGCGTGGAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGAGGTTAAGAACGAAAGACGCCCTACGGTTTCTTCCTTTCTGTTTACCGCACCTCT / // / / / // / / HgiCI* || | | | || CspCI FokI || | | | |BseGI || | | | Hin4II* || | | AciI || | SfaNI || FauI |BspMI |AarI TspEI P A P I L A F C G M P K K E R Q M A W R L L Q F L L S A G C Q R R K D K W R G E C S N S C F L R D A K E G K T N G V E R ----:----|----:----|----:----|----:----|----:----|----:----| G A G I R A K Q P I G F F S L C I A H L V Q E L E Q K R R S A L S P F V F P T S R S W N K S E A P H W L L F S L H R P S SetI TatI |CspCI Bsp1407I MwoI || MseI |Csp6I | CviJI || |TspEI ||RsaI | | Hpy178III* \\ \\ \\\ \ \ \ GAAAAGGTTGCTTTAATTTCTGTCATCTTGTACATTGGTGCGATTGTGGCTTTCCTGACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCCAACGAAATTAAAGACAGTAGAACATGTAACCACGCTAACACCGAAAGGACTGA / / / / /// / / / | CspCI | TspEI ||Bsp1407I MwoI CviJI Hpy178III* SetI MseI ||TatI |Csp6I RsaI E K V A L I S V I L Y I G A I V A F L T K R L L * F L S S C T L V R L W L S * L K G C F N F C H L V H W C D C G F P D F ----:----|----:----|----:----|----:----|----:----|----:----| S F T A K I E T M K Y M P A I T A K R V L F P Q K L K Q * R T C Q H S Q P K G S F L N S * N R D D Q V N T R N H S E Q S MaeII TaqI | SetI Tsp4CI* AsuII | TaiI \ \ \ \ TTTGGTTTCACTAAAACCGTTTGTAGTAGTTCGAAACTACGTTTGAAAAACAACGAAGTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCAAAGTGATTTTGGCAAACATCATCAAGCTTTGATGCAAACTTTTTGTTGCTTCAT / / / / Tsp4CI* | | MaeII | TaiI | SetI AsuII TaqI F G F T K T V C S S S K L R L K N N E V L V S L K P F V V V R N Y V * K T T K Y W F H * N R L * * F E T T F E K Q R S I ----:----|----:----|----:----|----:----|----:----|----:----| K P K V L V T Q L L E F S R K F F L S T K Q N * * F R K Y Y N S V V N S F C R L K T E S F G N T T T R F * T Q F V V F Y Tsp4CI* TspDTI | CviJI | FnuDII* | | Hin4I | | BetI* ApoI TspEI | | | BciVI | | |HpaII TspEI | MseI | | | |TspEI | | ||MnlI \ \ \ \ \ \ \\ \ \ \\\ TCAACAGAATTTGTCGTAATTAACGGTAAGGCTTATGAATTGGATACTTCCTCGCGTTCC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGTCTTAAACAGCATTAATTGCCATTCCGAATACTTAACCTATGAAGGAGCGCAAGG / // / / / / / / / / TspEI || | | | BciVI TspEI | | MnlI ApoI || | | CviJI | FnuDII* || | Hin4I TspDTI || Tsp4CI* |MseI TspEI S T E F V V I N G K A Y E L D T S S R S Q Q N L S * L T V R L M N W I L P R V P N R I C R N * R * G L * I G Y F L A F R ----:----|----:----|----:----|----:----|----:----|----:----| D V S N T T I L P L A * S N S V E E R E I L L I Q R L * R Y P K H I P Y K R A N * C F K D Y N V T L S I F Q I S G R T G BsiYI* | AsuI* | Bsp120I | |AsuI* | |DraII | |BmgT120I | ||SfaNI | ||CviJI | ||NlaIV | ||HaeIII | ||BmgT120I | |||BssKI | |||SecI* | |||EcoRII | ||||ApaI AccI | ||||SduI |BssNAI | ||||BseSI |Hpy166II | ||||HgiJII* || Hin4I | ||||| BarI || | MaeII TfiI | ||||| Hpy188I || | | SetI HinfI | |||||ScrFI | SfaNI || | | TaiI | Hpy188I | |||||BseBI | |AlwNI \\ \ \ \ \ \ \ \\\\\\ \ \\ GGTATACAAGACGTTGAAGTAGATTCAGACACCCTTTATGGGCCCTGGTCAGATGCTGGT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCATATGTTCTGCAACTTCATCTAAGTCTGTGGGAAATACCCGGGACCAGTCTACGACCA // // / / // / / /// /// / / / || |AccI | MaeII |Hpy188I | | ||| ||| | AlwNI SfaNI || | TaiI HinfI | | ||| ||| Hpy188I || | SetI TfiI | | ||| ||EcoRII || Hpy166II | | ||| ||BssKI || BssNAI | | ||| |SecI* |BetI* | | ||| BseBI Hin4I | | ||| ScrFI HpaII | | ||| SfaNI | | ||| BarI | | ||Bsp120I | | ||DraII | | ||AsuI* | | |BmgT120I | | |AsuI* | | BmgT120I | | HaeIII | | NlaIV | | CviJI | HgiJII* | BseSI | SduI | ApaI BsiYI* G I Q D V E V D S D T L Y G P W S D A G V Y K T L K * I Q T P F M G P G Q M L V Y T R R * S R F R H P L W A L V R C W * ----:----|----:----|----:----|----:----|----:----|----:----| P I C S T S T S E S V R * P G Q D S A P R Y V L R Q L L N L C G K H A R T L H Q T Y L V N F Y I * V G K I P G P * I S T SetI MaeIII |AjuI BarI | Tsp4CI* ||PsiI \ \ \ \\\ AAAGATGCTTCGTTCTTGTTTCAAAATGTGAATGGTAACTGTCATAACCTTATAACTCCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTACGAAGCAAGAACAAAGTTTTACACTTACCATTGACAGTATTGGAATATTGAGGT / / / / BarI | SetI PsiI | AjuI Tsp4CI* MaeIII K D A S F L F Q N V N G N C H N L I T P K M L R S C F K M * M V T V I T L * L Q R C F V L V S K C E W * L S * P Y N S K ----:----|----:----|----:----|----:----|----:----|----:----| L S A E N K N * F T F P L Q * L R I V G Y L H K T R T E F H S H Y S D Y G * L E F I S R E Q K L I H I T V T M V K Y S W FatI |CviAII ||AjuI FatI MboII ||| NlaIII |CviAII | TspEI ||| |MslI TspEI || NlaIII \ \ \\\ \\ \ \\ \ AAGAGTAATTCTTCCATTCCCCATGACGATGATAATAATTTAGCATGGTATTTTCCTTGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCATTAAGAAGGTAAGGGGTACTGCTACTATTATTAAATCGTACCATAAAAGGAACA / / / / /// / / // MboII TspEI | | ||MslI | | |FatI | | |FatI | | CviAII | | CviAII | NlaIII | NlaIII TspEI AjuI K S N S S I P H D D D N N L A W Y F P C R V I L P F P M T M I I I * H G I F L V E * F F H S P * R * * * F S M V F S L * ----:----|----:----|----:----|----:----|----:----|----:----| F L L E E M G W S S S L L K A H Y K G Q L S Y N K W E G H R H Y Y N L M T N E K L T I R G N G M V I I I I * C P I K R T TfiI HinfI |BccI || Hpy178III* || |MboII || || FalI || || FalI || || |CviJI || || || TaqI Tsp4CI* || || || AsuII | TspEI || || || | SapI | | FalI || || || | Ksp632I* | | FalI MseI || || || | | CviJI | | | BccI \ \\ \\ \\ \ \ \ \ \ \ \ AAGTTAAAGAATCAAGATGGCTCTTCGAAGCCAAACTTCACAGTTGAAAATTACGCAGGA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAATTTCTTAGTTCTACCGAGAAGCTTCGGTTTGAAGTGTCAACTTTTAATGCGTCCT / ///// / / / / / / / MseI ||||| CviJI | Ksp632I* | FalI | BccI ||||Hpy178III* | CviJI | FalI TspEI |||FalI | SapI Tsp4CI* |||FalI AsuII ||MboII TaqI |HinfI |TfiI BccI K L K N Q D G S S K P N F T V E N Y A G S * R I K M A L R S Q T S Q L K I T Q D V K E S R W L F E A K L H S * K L R R M ----:----|----:----|----:----|----:----|----:----|----:----| L N F F * S P E E F G F K V T S F * A P Y T L S D L H S K S A L S * L Q F N R L L * L I L I A R R L W V E C N F I V C S BseGI HgaI | Tsp4CI* | BslFI | | FokI | Tsp4CI* | | | MaeII | | MseI AluI | | | | SetI | | |AhaIII* CviJI | | | | TaiI MboII | | || TaqI | SetI \ \ \ \ \ \ \ \ \\ \ \ \ TGGAACTGTCATACGTCTAAAGAAGATAGGGACGCATTTTACGGTTTAAAGTCGAAAGCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTTGACAGTATGCAGATTTCTTCTATCCCTGCGTAAAATGCCAAATTTCAGCTTTCGA / / / / / / / // / / / | | | MaeII MboII | | |MseI | | CviJI | | | FokI | | | | | AluI | | TaiI | | | | SetI | | SetI | | | TaqI | Tsp4CI* | | AhaIII* BseGI | | BslFI | HgaI Tsp4CI* W N C H T S K E D R D A F Y G L K S K A G T V I R L K K I G T H F T V * S R K L E L S Y V * R R * G R I L R F K V E S * ----:----|----:----|----:----|----:----|----:----|----:----| H F Q * V D L S S L S A N * P K F D F A I S S D Y T * L L Y P R M K R N L T S L P V T M R R F F I P V C K V T * L R F S XbaI BseGI |MaeI Hpy166II | MboII |Hpy178III* | BccI | | FokI ||Ksp632I* PsiI \ \ \ \ \ \\\ \ GATGTTTACTTCACTTGGGATGGTATAAAGAACTCTTCTAGAAACTTGATTGTTTATAAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAAATGAAGTGAACCCTACCATATTTCTTGAGAAGATCTTTGAACTAACAAATATTA / / / / / /// / | BccI | MboII FokI ||Ksp632I* PsiI Hpy166II BseGI |XbaI Hpy178III* MaeI D V Y F T W D G I K N S S R N L I V Y N M F T S L G M V * R T L L E T * L F I M C L L H L G W Y K E L F * K L D C L * W ----:----|----:----|----:----|----:----|----:----|----:----| S T * K V Q S P I F F E E L F K I T * L Q H K S * K P H Y L S S K * F S S Q K Y I N V E S P I T Y L V R R S V Q N N I I MaeII | Hpy99I | | MboII | | |MmeI | | || BsaBI MaeII | | || |MboI |BseGI | | || |BglII || SetI | | || |XhoII || TaiI | | || || DpnI || |HindII | |SetI || || |BstKTI || |Hpy166II | |TaiI || || || Hpy178III* || || FokI \ \\ \\ \\ \\ \ \\ \\ \ GGCGACGTTTTGGATTTAGATCTTCTTGATTGGTTGGAAAAGGATGACGTTGACTATCCC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTGCAAAACCTAAATCTAGAAGAACTAACCAACCTTTTCCTACTGCAACTGATAGGG / / / / / // / / / / / / | | | | | || | Hpy178III* | | | FokI | | | | | || XhoII | | Hpy166II | | | | | || BglII | | HindII | | | | | || MboI | MaeII | | | | | |DpnI BseGI | | | | | BstKTI TaiI | | | | BsaBI SetI | | | MboII | | | MmeI | | MaeII | TaiI | SetI Hpy99I G D V L D L D L L D W L E K D D V D Y P A T F W I * I F L I G W K R M T L T I P R R F G F R S S * L V G K G * R * L S R ----:----|----:----|----:----|----:----|----:----|----:----| P S T K S K S R R S Q N S F S S T S * G H R R K P N L D E Q N T P F P H R Q S D A V N Q I * I K K I P Q F L I V N V I G BbvII* SetI | ApoI | MboI | TspEI | | DpnI TaqI | | MboII | | |BstKTI \ \ \ \ \ \ \\ GTTGTATTCGATGACTTGAAGACTTCAAATTTACAAGGTTATGATCTTTCGTTGGTTTTG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAACATAAGCTACTGAACTTCTGAAGTTTAAATGTTCCAATACTAGAAAGCAACCAAAAC / / / / // / TaqI | | SetI || MboI | TspEI |DpnI | ApoI BstKTI BbvII* MboII V V F D D L K T S N L Q G Y D L S L V L L Y S M T * R L Q I Y K V M I F R W F C C I R * L E D F K F T R L * S F V G F V ----:----|----:----|----:----|----:----|----:----|----:----| T T N S S K F V E F K C P * S R E N T K R Q I R H S S S K L N V L N H D K T P K N Y E I V Q L S * I * L T I I K R Q N Q FatI |CviAII MlyI || NlaIII TspEI TspDTI TspEI MseI PleI \\ \ \ \ \ \ \ TCAAATGGGCATGAAAGAAAAATTGCGAGATGTTTGAGCGAAATTATTAAAGTTGGTGAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTTACCCGTACTTTCTTTTTAACGCTCTACAAACTCGCTTTAATAATTTCAACCACTT / // / / / // | |FatI TspDTI | MseI |PleI | CviAII TspEI TspEI MlyI NlaIII S N G H E R K I A R C L S E I I K V G E Q M G M K E K L R D V * A K L L K L V K K W A * K K N C E M F E R N Y * S W * S ----:----|----:----|----:----|----:----|----:----|----:----| D F P C S L F I A L H K L S I I L T P S T L H A H F F F Q S I N S R F * * L Q H * I P M F S F N R S T Q A F N N F N T F AccI |Hpy166II ||HinfI Tsp4CI* Hpy188I ||| HphI | Hpy99I | MnlI \\\ \ \ \ \ \ GTAGACTCCAAAACCGTCGGTTGTATTGCCTCTGATGTCGTTTTGTATGTTTCTCTGGTA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTGAGGTTTTGGCAGCCAACATAACGGAGACTACAGCAAAACATACAAAGAGACCAT // // / / / || |HinfI Tsp4CI* | MnlI || HphI Hpy99I Hpy188I |AccI Hpy166II V D S K T V G C I A S D V V L Y V S L V * T P K P S V V L P L M S F C M F L W Y R L Q N R R L Y C L * C R F V C F S G I ----:----|----:----|----:----|----:----|----:----|----:----| T S E L V T P Q I A E S T T K Y T E R T L L S W F R R N Y Q R Q H R K T H K E P Y V G F G D T T N G R I D N Q I N R Q Y TspRI |TspDTI || TspEI || | MseI || | | ApoI || | | TspEI || | | | HphI || | | | | MmeI || | | | | |TspEI SfeI* || | | | | || TspGWI |TstI || | | | | || | Cac8I |Tsp4CI* \\ \ \ \ \ \\ \ \ \\ TTTATTCTTTCAGTGGTGATAATTAAATTCATAATTGCCTGCTACTTCCGTTGGACTGTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAAGAAAGTCACCACTATTAATTTAAGTATTAACGGACGATGAAGGCAACCTGACAT / / /// / // / / / // TspRI TspDTI ||| TspEI || Cac8I | | |SfeI* ||| ApoI |TspEI | | SetI ||| MmeI TspGWI | Tsp4CI* ||HphI TstI |MseI TspEI F I L S V V I I K F I I A C Y F R W T V L F F Q W * * L N S * L P A T S V G L * Y S F S G D N * I H N C L L L P L D C S ----:----|----:----|----:----|----:----|----:----|----:----| N I R E T T I I L N M I A Q * K R Q V T I * E K L P S L * I * L Q R S S G N S Q K N K * H H Y N F E Y N G A V E T P S Y AluI CviJI Hin4I |MaeI SetI Hpy166II | MnlI ||SetI |CviRI* | TstI | | EcoRV \\\ \\ \ \ \ \ \ GCTAGGAAACAAGGTGCATATATCGTGGACAATAAAACAATGGATAAACACACAAACGAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CGATCCTTTGTTCCACGTATATAGCACCTGTTATTTTGTTACCTATTTGTGTGTTTGCTA / / / / / / / / / | MaeI SetI CviRI* | Hpy166II Hin4I | EcoRV CviJI TstI MnlI AluI A R K Q G A Y I V D N K T M D K H T N D L G N K V H I S W T I K Q W I N T Q T I * E T R C I Y R G Q * N N G * T H K R Y ----:----|----:----|----:----|----:----|----:----|----:----| A L F C P A Y I T S L L V I S L C V F S L * S V L H M Y R P C Y F L P Y V C L R S P F L T C I D H V I F C H I F V C V I BinI* |MnlI ||BsaXI ||| MboI ||| XhoII AluI ||| | DpnI BsaXI BseRI CviJI ||| | |BstKTI TaqI | SspI |Hin4I | SetI ||| | || MnlI \ \ \ \\ \ \ \\\ \ \\ \ ATCGAGGATTGGTCTAATAATATTCAAACAAAAGCTCCTCTAAAGGAAGTAGATCCTCAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTCCTAACCAGATTATTATAAGTTTGTTTTCGAGGAGATTTCCTTCATCTAGGAGTA / / // / / / /// // / TaqI BsaXI || BseRI | CviJI ||| || XhoII |Hin4I | AluI ||| || MboI SspI SetI ||| || MnlI ||| |DpnI ||| BstKTI ||BinI* |MnlI BsaXI I E D W S N N I Q T K A P L K E V D P H S R I G L I I F K Q K L L * R K * I L I R G L V * * Y S N K S S S K G S R S S F ----:----|----:----|----:----|----:----|----:----|----:----| I S S Q D L L I * V F A G R F S T S G * Y R P N T * Y Y E F L L E E L P L L D E D L I P R I I N L C F S R * L F Y I R M OliI MnlI MslI |CviJI | Cac8I |HaeIII | | BslFI SetI \\ \ \ \ \ TTGAGGCCAAAGAAATACTCAAAAAAGTCGTTGGGACACAAGCGTGCTTCAACCTTTGAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCCGGTTTCTTTATGAGTTTTTTCAGCAACCCTGTGTTCGCACGAAGTTGGAAACTG / / / / / | HaeIII | Cac8I BslFI | CviJI MslI SetI MnlI OliI L R P K K Y S K K S L G H K R A S T F D * G Q R N T Q K S R W D T S V L Q P L T E A K E I L K K V V G T Q A C F N L * L ----:----|----:----|----:----|----:----|----:----|----:----| K L G F F Y E F F D N P C L R A E V K S N S A L S I S L F T T P V C A H K L R Q Q P W L F V * F L R Q S V L T S * G K V MboI BglII XhoII | DpnI | |XbaI AluI | |BstKTI CviJI TspEI TfiI | ||MaeI | SetI | MseI HinfI | ||Hpy178III* \ \ \ \ \ \ \\\ TTGCTGAAAAAACACAGCTCCAAAATGTTTCAATTTAACGAATCTGTGATAGATCTAGAC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AACGACTTTTTTGTGTCGAGGTTTTACAAAGTTAAATTGCTTAGACACTATCTAGATCTG / / / / / // / // / | CviJI | MseI HinfI || | || SetI | AluI TspEI TfiI || | |XbaI SetI || | Hpy178III* || | MaeI || XhoII || BglII || MboI |DpnI BstKTI L L K K H S S K M F Q F N E S V I D L D C * K N T A P K C F N L T N L * * I * T A E K T Q L Q N V S I * R I C D R S R H ----:----|----:----|----:----|----:----|----:----|----:----| K S F F C L E L I N * N L S D T I S R S S A S F V C S W F T E I * R I Q S L D L Q Q F F V A G F H K L K V F R H Y I * V SetI MslI |FatI ||CviAII ||| NlaIII ||| | MnlI ||| | | Hpy166II ||| | | |MboII TspDTI MnlI \\\ \ \ \\ \ \ ACCTCCATGAGCAGTTCACTACAATCTTCTGGTTCATACAGAGGAATGACAACAATGACC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGGTACTCGTCAAGTGATGTTAGAAGACCAAGTATGTCTCCTTACTGTTGTTACTGG // // / / / / || || MnlI | TspDTI MnlI || |FatI Hpy166II || CviAII MboII |NlaIII MslI T S M S S S L Q S S G S Y R G M T T M T P P * A V H Y N L L V H T E E * Q Q * P L H E Q F T T I F W F I Q R N D N N D H ----:----|----:----|----:----|----:----|----:----|----:----| V E M L L E S C D E P E Y L P I V V I V C R W S C N V V I K Q N M C L F S L L S G G H A T * * L R R T * V S S H C C H G AluI CviJI | TatI | SetI | Bsp1407I | |Csp6I Hpy178III* | ||RsaI |TaqI | ||TspDTI FokI \\ \ \\\ \ ACTCAAAATGCTTGGAAACTCTCGAATGAAAACAAAGCTGTACATTCCCGTAATCCATCT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGTTTTACGAACCTTTGAGAGCTTACTTTTGTTTCGACATGTAAGGGCATTAGGTAGA // / / / /// |TaqI | | | ||Bsp1407I Hpy178III* | | | ||TatI | | | |Csp6I | | | RsaI | | TspDTI | CviJI | AluI SetI T Q N A W K L S N E N K A V H S R N P S L K M L G N S R M K T K L Y I P V I H L S K C L E T L E * K Q S C T F P * S I Y ----:----|----:----|----:----|----:----|----:----|----:----| V * F A Q F S E F S F L A T C E R L G D W E F H K S V R S H F C L Q V N G Y D M S L I S P F E R I F V F S Y M G T I W R BtgZI | Csp6I | |RsaI | |EcoNI | ||MnlI | ||BssKI | ||EcoRII | |||BsiYI* | ||||ScrFI | ||||BseBI | ||||| MboI | ||||| | DpnI MnlI | ||||| | Hin4I | BsaXI | ||||| | Hin4I BccI BseGI TaqI | Hin4I | ||||| | BsaXI \ \ \ \ \ \ \\\\\ \ \ ACTTTGTTGCCTACATCCTCGATGTTTTGGAATAAAGCGACTTCCTCTCCTGTACCAGGA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAACAACGGATGTAGGAGCTACAAAACCTTATTTCGCTGAAGGAGAGGACATGGTCCT / / / /// ///// / // BccI BseGI | ||BsaXI ||||| | |DpnI FokI | |MnlI ||||| | EcoRII | Hin4I ||||| | BstKTI TaqI ||||| | BssKI ||||| Hin4I ||||| BsaXI ||||| BseBI ||||| ScrFI ||||Hin4I ||||Hin4I |||EcoNI |||Csp6I ||MnlI ||RsaI |BsiYI* BtgZI T L L P T S S M F W N K A T S S P V P G L C C L H P R C F G I K R L P L L Y Q D F V A Y I L D V L E * S D F L S C T R I ----:----|----:----|----:----|----:----|----:----|----:----| V K N G V D E I N Q F L A V E E G T G P * K T A * M R S T K S Y L S K R E Q V L S Q Q R C G R H K P I F R S G R R Y W S BstKTI |Hin4I || BinI* || | TfiI || | HinfI || | | Hpy188I || | | |HinfI || | | || Hpy178III* || | | || | Hin4I || | | || | Hin4I || | | || | |TfiI Hpy99I || | | || | |HinfI | Hin4I || | | || | ||FokI | Hin4I || | | || | ||PleI | | BseGI || | | || | |||MlyI | | | Hpy178III* Hin4I || | | || | ||||TaqI | | | | EcoRV Hin4I \\ \ \ \\ \ \\\\\ \ \ \ \ \ \ TCATCGCTGATTCAGAGTCTTGATTCGACGATTATACATCCCGATATCGTTCAACAACCA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGCGACTAAGTCTCAGAACTAAGCTGCTAATATGTAGGGCTATAGCAAGTTGTTGGT / / // / / / // / / / / / / MboI | || | | | || Hin4I BseGI | | Hin4I TspRI | || | | | || Hin4I | | Hin4I | || | | | || TaqI | EcoRV | || | | | || FokI Hpy178III* | || | | | |Hpy99I | || | | | |HinfI | || | | | |TfiI | || | | | PleI | || | | | MlyI | || | | Hpy178III* | || | HinfI | || Hin4I | || Hin4I | |Hpy188I | HinfI | TfiI BinI* S S L I Q S L D S T I I H P D I V Q Q P H R * F R V L I R R L Y I P I S F N N H I A D S E S * F D D Y T S R Y R S T T T ----:----|----:----|----:----|----:----|----:----|----:----| D D S I * L R S E V I I C G S I T * C G I M A S E S D Q N S S * V D R Y R E V V * R Q N L T K I R R N Y M G I D N L L W MaeIII | BseMII BsrI NlaIV TfiI | |BspCNI TspRI TspDTI HinfI | || MnlI \ \ \ \ \\ \ CCACTGGATTTTATGCCATACGGGTTCCCATTGATTCATACTATCTGTTTTGTTACTTGT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGACCTAAAATACGGTATGCCCAAGGGTAACTAAGTATGATAGACAAAACAATGAACA / / / / /// / BsrI | NlaIV HinfI ||| MnlI TspDTI TfiI ||MaeIII |BspCNI BseMII P L D F M P Y G F P L I H T I C F V T C H W I L C H T G S H * F I L S V L L L V T G F Y A I R V P I D S Y Y L F C Y L L ----:----|----:----|----:----|----:----|----:----|----:----| G S S K I G Y P N G N I * V I Q K T V Q V V P N * A M R T G M S E Y * R N Q * K W Q I K H W V P E W Q N M S D T K N S T DdeI MseI |Hpy188I FokI || Ksp632I* | MboII || | FalI | |TspDTI || | FalI | || MlyI HinfI FalI || |MnlI BseGI | || PleI | TstI FalI \\ \\ \ \ \\ \ \ \ \ TATTCTGAGGATGAAGAGGGTTTAAGAACCACTTTAGACTCTCTTTCTACCACAGATTAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGACTCCTACTTCTCCCAAATTCTTGGTGAAATCTGAGAGAAAGATGGTGTCTAATA / / // / / / // / / / | | || BseGI | FokI |PleI | | FalI | | |Ksp632I* TspDTI MlyI | | FalI | | FalI MboII | HinfI | | FalI MseI TstI | DdeI | MnlI Hpy188I Y S E D E E G L R T T L D S L S T T D Y I L R M K R V * E P L * T L F L P Q I I F * G * R G F K N H F R L S F Y H R L S ----:----|----:----|----:----|----:----|----:----|----:----| * E S S S S P K L V V K S E R E V V S * N N Q P H L P N L F W K L S E K * W L N I R L I F L T * S G S * V R K R G C I I CviJI |AvaI ||SduI MseI ||HgiJII* |TspEI ||BmeT110I ApoI TstI || MseI ||| GsuI TspEI |BccI BccI || PacI ||| Eco57MI \ \\ \ \\ \ \\\ \ CCAAATTCCCATAAACTACTGATGGTTGTTTGTGATGGTTTAATTAAGGGCTCGGGCAAC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTAAGGGTATTTGATGACTACCAACAAACACTACCAAATTAATTCCCGAGCCCGTTG / / / / / // / / // | TstI BccI BccI | || | | |AvaI TspEI | || | | BmeT110I ApoI | || | | Eco57MI | || | | GsuI | || | CviJI | || HgiJII* | || SduI | |MseI | TspEI PacI MseI P N S H K L L M V V C D G L I K G S G N Q I P I N Y * W L F V M V * L R A R A T K F P * T T D G C L * W F N * G L G Q R ----:----|----:----|----:----|----:----|----:----|----:----| G F E W L S S I T T Q S P K I L P E P L D L N G Y V V S P Q K H H N L * P S P C W I G M F * Q H N N T I T * N L A R A V HphI | DrdI | Tth111I | | MaeIII Hpy178III* BccI | | Tsp45I SetI \ \ \ \ \ \ GATAAGACTACTCCAGAGATAGCGTTAGGAATGATGGACGACTTTGTCACCCCACCTGAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCTGATGAGGTCTCTATCGCAATCCTTACTACCTGCTGAAACAGTGGGGTGGACTA / / / / / / / Hpy178III* BccI | | | | SetI | | | Tsp45I | | | MaeIII | | Tth111I | DrdI HphI D K T T P E I A L G M M D D F V T P P D I R L L Q R * R * E * W T T L S P H L M * D Y S R D S V R N D G R L C H P T * * ----:----|----:----|----:----|----:----|----:----|----:----| S L V V G S I A N P I I S S K T V G G S R Y S * E L S L T L F S P R S Q * G V Q I L S S W L Y R * S H H V V K D G W R I CfrI | BalI SetI BtsI CviJI | CviJI MseI | TspDTI TspRI | SfaNI | HaeIII \ \ \ \ \ \ \ \ GAAGTTAAACCTTACTCCTATGTGGCAGTGGCATCAGGCTCTAAAAGACACAATATGGCC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAATTTGGAATGAGGATACACCGTCACCGTAGTCCGAGATTTTCTGTGTTATACCGG // / / / / / / / || TspDTI TspRI BtsI CviJI SfaNI | CfrI |SetI HaeIII MseI CviJI BalI E V K P Y S Y V A V A S G S K R H N M A K L N L T P M W Q W H Q A L K D T I W P S * T L L L C G S G I R L * K T Q Y G Q ----:----|----:----|----:----|----:----|----:----|----:----| S T L G * E * T A T A D P E L L C L I A H L * V K S R H P L P M L S * F V C Y P F N F R V G I H C H C * A R F S V I H G TfiI MaeII FauI AciI HinfI TspEI BslFI AflIII \ \ \ \ \ \ AAGATATATGCGGGTTTTTACAAATATGACGATTCTACAATTCCACCAGAAAATCAACAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTATATACGCCCAAAAATGTTTATACTGCTAAGATGTTAAGGTGGTCTTTTAGTTGTT / / / / / / FauI AciI HinfI TspEI BslFI TaiI TfiI SetI K I Y A G F Y K Y D D S T I P P E N Q Q R Y M R V F T N M T I L Q F H Q K I N N D I C G F L Q I * R F Y N S T R K S T T ----:----|----:----|----:----|----:----|----:----|----:----| L I Y A P K * L Y S S E V I G G S F * C W S I H P N K C I H R N * L E V L F D V L Y I R T K V F I V I R C N W W F I L L AsuI* |NlaIV |BmgT120I ||CviJI ||HaeIII |||AciI AciI SfeI* |||BisI SetI MfeI | Csp6I | CviRI* ||||BlsI TaiI TspEI | |RsaI | | PstI |||||TauI BssKI \ \ \ \\ \ \ \ \\\\\\ \ CGTGTCCCAATCATTACAATTGTGAAGTGCGGTACTCCTGCAGAGCAGGGGGCCGCCAAA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GCACAGGGTTAGTAATGTTAACACTTCACGCCATGAGGACGTCTCGTCCCCCGGCGGTTT / / / / // / / / ///// | AflIII TspEI | || | | SfeI* ||||AciI MaeII MfeI | || | CviRI* |||BisI | || PstI ||AsuI* | |Csp6I ||BlsI | RsaI |BmgT120I AciI |HaeIII |CviJI |TauI NlaIV R V P I I T I V K C G T P A E Q G A A K V S Q S L Q L * S A V L L Q S R G P P N C P N H Y N C E V R Y S C R A G G R Q T ----:----|----:----|----:----|----:----|----:----|----:----| R T G I M V I T F H P V G A S C P A A L V H G L * * L Q S T R Y E Q L A P P R W T D W D N C N H L A T S R C L L P G G F HpaII ScrFI CauII* | MnlI TfiI | MaeIII SetI HinfI TspEI Hpy188I \ \ \ \ \ \ CCCGGTAACAGAGGTAAGCGTGATTCTCAAATTATTCTGATGTCCTTTTTAGAAAAAATA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCCATTGTCTCCATTCGCACTAAGAGTTTAATAAGACTACAGGAAAAATCTTTTTTAT /// / / / / / ||| | SetI HinfI | Hpy188I ||| MaeIII TfiI TspEI ||BssKI |HpaII CauII* ScrFI MnlI P G N R G K R D S Q I I L M S F L E K I P V T E V S V I L K L F * C P F * K K * R * Q R * A * F S N Y S D V L F R K N N ----:----|----:----|----:----|----:----|----:----|----:----| G P L L P L R S E * I I R I D K K S F I V R Y C L Y A H N E F * E S T R K L F F G T V S T L T I R L N N Q H G K * F F Y HinfI AluI | MfeI CviJI | TspEI | SetI | |TspDTI | | MseI MlyI | || ApoI | | |AhaIII* PleI | || TspEI | | || SspI \ \ \\ \ \ \ \\ \ ACATTTGATGAAAGAATGACTCAATTGGAATTTCAGCTTTTAAAAAATATTTGGCAGATT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAAACTACTTTCTTACTGAGTTAACCTTAAAGTCGAAAATTTTTTATAAACCGTCTAA // / / / / / // / |PleI | TspEI | | | |MseI SspI MlyI | MfeI | | | AhaIII* TspDTI | | CviJI HinfI | | AluI | SetI TspEI ApoI T F D E R M T Q L E F Q L L K N I W Q I H L M K E * L N W N F S F * K I F G R L I * * K N D S I G I S A F K K Y L A D Y ----:----|----:----|----:----|----:----|----:----|----:----| V N S S L I V * N S N * S K F F I Q C I L M Q H F F S E I P I E A K L F Y K A S C K I F S H S L Q F K L K * F I N P L N Tsp4CI* |Csp6I ||RsaI CviJI |||SfaNI BaeI SfaNI \ \\\\ \ \ ACGGGGCTAATGGCAGACTTCTACGAAACGGTACTTATGGTTGATGCTGATACTAAAGTC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCCCGATTACCGTCTGAAGATGCTTTGCCATGAATACCAACTACGACTATGATTTCAG / / // // CviJI | || |SfaNI | || BaeI | |Csp6I | RsaI Tsp4CI* T G L M A D F Y E T V L M V D A D T K V R G * W Q T S T K R Y L W L M L I L K S G A N G R L L R N G T Y G * C * Y * S L ----:----|----:----|----:----|----:----|----:----|----:----| V P S I A S K * S V T S I T S A S V L T * P A L P L S R R F P V * P Q H Q Y * L R P * H C V E V F R Y K H N I S I S F D BinI* |MseI || MboI || Hin4I || Hin4I Hpy178III* || XhoII | MseI || | DpnI | |BaeI NdeI TsoI || | |BstKTI \ \\ \ \ \\ \ \\ TTTCCCGATGCTTTAACTCATATGGTCGCTGAAATGGTTAAAGATCCTTTGATTATGGGT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGGCTACGAAATTGAGTATACCAGCGACTTTACCAATTTCTAGGAAACTAATACCCA / / / / // // / // / | | BaeI MseI |TsoI || | || XhoII | Hpy178III* NdeI || | || MboI SfaNI || | |DpnI || | BstKTI || MseI |BinI* Hin4I Hin4I F P D A L T H M V A E M V K D P L I M G F P M L * L I W S L K W L K I L * L W V S R C F N S Y G R * N G * R S F D Y G S ----:----|----:----|----:----|----:----|----:----|----:----| K G S A K V * I T A S I T L S G K I I P R E R H K L E Y P R Q F P * L D K S * P K G I S * S M H D S F H N F I R Q N H T Hin4I Hin4I | MboI | | DpnI BsmAI | | HphI CviRI* Eco31I | | |BstKTI MwoI MaeIII |TspEI \ \ \ \\ \ \ \\ CTTTGTGGTGAGACCAAGATCGCTAATAAGGCACAATCTTGGGTAACTGCAATTCAAGTG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GAAACACCACTCTGGTTCTAGCGATTATTCCGTGTTAGAACCCATTGACGTTAAGTTCAC // // / / / / / |Hin4I || | MwoI | | TspEI |Hin4I || MboI | CviRI* Eco31I |DpnI MaeIII BsmAI BstKTI HphI L C G E T K I A N K A Q S W V T A I Q V F V V R P R S L I R H N L G * L Q F K C L W * D Q D R * * G T I L G N C N S S V ----:----|----:----|----:----|----:----|----:----|----:----| R Q P S V L I A L L A C D Q T V A I * T D K H H S W S R * Y P V I K P L Q L E L K T T L G L D S I L C L R P Y S C N L H SfaNI |CviJI || HindIII || | AluI || | CviJI || | | SetI TatI || | | | MboII |Csp6I || | | | BbvII* ||RsaI || | | | |TfiI ||ScaI || | | | |HinfI MaeIII \\\ \\ \ \ \ \\ \ TTTGAGTACTATATTTCGCATCATCAGGCTAAAGCTTTTGAATCTGTCTTCGGTTCGGTA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTCATGATATAAAGCGTAGTAGTCCGATTTCGAAAACTTAGACAGAAGCCAAGCCAT /// / // / / / / ||TatI | || | | | BbvII* |Csp6I | || | | | HinfI ScaI | || | | | TfiI RsaI | || | | MboII | || | HindIII | || CviJI | || AluI | |SetI | SfaNI CviJI F E Y Y I S H H Q A K A F E S V F G S V L S T I F R I I R L K L L N L S S V R * * V L Y F A S S G * S F * I C L R F G N ----:----|----:----|----:----|----:----|----:----|----:----| N S Y * I E C * * A L A K S D T K P E T T Q T S Y K A D D P * L K Q I Q R R N P K L V I N R M M L S F S K F R D E T R Y BssKI TsoI |HpaII | BccI ||ScrFI | | SetI ||CauII* BseGI FokI | | | Hpy188I \\\ \ \ \ \ \ \ ACTTGTTTGCCGGGATGTTTCTCAATGTATCGTATAAAATCTCCTAAAGGTTCAGATGGT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TGAACAAACGGCCCTACAAAGAGTTACATAGCATATTTTAGAGGATTTCCAAGTCTACCA / / / / / / / / / MaeIII | | BseGI FokI | | | Hpy188I | BssKI | | BccI CauII* | SetI HpaII TsoI ScrFI T C L P G C F S M Y R I K S P K G S D G L V C R D V S Q C I V * N L L K V Q M V L F A G M F L N V S Y K I S * R F R W L ----:----|----:----|----:----|----:----|----:----|----:----| V Q K G P H K E I Y R I F D G L P E S P L K N A P I N R L T D Y L I E * L N L H S T Q R S T E * H I T Y F R R F T * I T Acc65I HgiCI* |Csp6I ||RsaI ||NlaIV ||| KpnI Hpy188I ||| | SetI Hpy178III* | MaeIII \\\ \ \ \ \ \ TATTGGGTACCTGTATTGGCAAATCCAGATATTGTTGAAAGATATTCGGATAATGTTACA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| ATAACCCATGGACATAACCGTTTAGGTCTATAACAACTTTCTATAAGCCTATTACAATGT / /// / / / | ||HgiCI* Hpy178III* Hpy188I MaeIII | ||Acc65I FalI | |Csp6I FalI | NlaIV | RsaI | SetI KpnI Y W V P V L A N P D I V E R Y S D N V T I G Y L Y W Q I Q I L L K D I R I M L Q L G T C I G K S R Y C * K I F G * C Y K ----:----|----:----|----:----|----:----|----:----|----:----| * Q T G T N A F G S I T S L Y E S L T V N N P V Q I P L D L Y Q Q F I N P Y H * I P Y R Y Q C I W I N N F S I R I I N C MboII TspDTI | HphI FalI FalI | | BsaBI MseI FalI CviRI* MboII FalI | | |MboII VspI \ \ \ \ \ \ \\ \ AACACTTTGCATAAGAAGAACTTATTATTACTTGGTGAAGATAGATTTTTATCTTCATTA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGAAACGTATTCTTCTTGAATAATAATGAACCACTTCTATCTAAAAATAGAAGTAAT / / / // / / / CviRI* | FalI || | MboII VspI | FalI || | BsaBI MseI MboII || HphI |MboII TspDTI N T L H K K N L L L L G E D R F L S S L T L C I R R T Y Y Y L V K I D F Y L H * H F A * E E L I I T W * R * I F I F I N ----:----|----:----|----:----|----:----|----:----|----:----| F V K C L F F K N N S P S S L N K D E N L C K A Y S S S I I V Q H L Y I K I K M V S Q M L L V * * * K T F I S K * R * * TseI AluI CviJI |BisI ||BlsI MseI DdeI BbvI ||SetI \ \ \ \\\ ATGTTAAAGACTTTCCCTAAGAGAAAGCAAGTATTTGTTCCAAAAGCTGCTTGTAAAACT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TACAATTTCTGAAAGGGATTCTCTTTCGTTCATAAACAAGGTTTTCGACGAACATTTTGA / / / / //// MseI DdeI BbvI | |||TseI | ||BisI | |BlsI | CviJI | AluI SetI M L K T F P K R K Q V F V P K A A C K T C * R L S L R E S K Y L F Q K L L V K L V K D F P * E K A S I C S K S C L * N Y ----:----|----:----|----:----|----:----|----:----|----:----| I N F V K G L L F C T N T G F A A Q L V L T L S K G * S F A L I Q E L L Q K Y F H * L S E R L S L L Y K N W F S S T F S BseYI | GsaI | | BccI FalI | | |TaqI MseI FalI | | || Hpy99I VspI | ApoI | | || | FalI |TspEI | TspEI HgaI | | || | FalI || MboII Tsp4CI* \ \ \ \ \ \\ \ \ \\ \ \ ATTGCCCCTGATAAATTCAAAGTCTTACTTTCCCAGCGTCGAAGATGGATTAATTCTACG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGGGGACTATTTAAGTTTCAGAATGAAAGGGTCGCAGCTTCTACCTAATTAAGATGC / / / / / // / / / / FalI TspEI | | | || TaqI | | Tsp4CI* FalI ApoI | | | |BccI | TspEI | | | FalI MboII | | | FalI VspI | | Hpy99I MseI | | BseYI | GsaI HgaI I A P D K F K V L L S Q R R R W I N S T L P L I N S K S Y F P S V E D G L I L R C P * * I Q S L T F P A S K M D * F Y G ----:----|----:----|----:----|----:----|----:----|----:----| I A G S L N L T K S E W R R L H I L E V * Q G Q Y I * L R V K G A D F I S * N * N G R I F E F D * K G L T S S P N I R R Csp6I TspEI BsmAI FatI |RsaI SetI | XmnI | Hpy188I |CviAII \\ \ \ \ \ \ \\ GTACATAACCTTTTTGAATTAGTTCTAATCAGAGACTTATGTGGCACTTTCTGTTTTTCC 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CATGTATTGGAAAAACTTAATCAAGATTAGTCTCTGAATACACCGTGAAAGACAAAAAGG // / / / / || SetI TspEI Hpy188I NlaIII |Csp6I XmnI BsmAI RsaI V H N L F E L V L I R D L C G T F C F S Y I T F L N * F * S E T Y V A L S V F P T * P F * I S S N Q R L M W H F L F F H ----:----|----:----|----:----|----:----|----:----|----:----| T C L R K S N T R I L S K H P V K Q K E P V Y G K Q I L E L * L S I H C K R N K Y M V K K F * N * D S V * T A S E T K G BceAI CviRI* |BaeI NlaIII TspEI ||Csp6I Csp6I CviJI |TspEI |BaeI |||RsaI |RsaI | BaeI \\ \\ \\\\ \\ \ \ ATGCAATTTGTGATTGGTATTGAATTGATTGGTACTATGGTACTGCCGTTAGCCATTTGC 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTAAACACTAACCATAACTTAACTAACCATGATACCATGACGGCAATCGGTAAACG // / / / /// // // / || TspEI BaeI TspEI ||Csp6I |Csp6I |CviJI BaeI |CviRI* BaeI |RsaI RsaI BaeI |FatI BceAI CviAII M Q F V I G I E L I G T M V L P L A I C C N L * L V L N * L V L W Y C R * P F A A I C D W Y * I D W Y Y G T A V S H L L ----:----|----:----|----:----|----:----|----:----|----:----| M C N T I P I S N I P V I T S G N A M Q W A I Q S Q Y Q I S Q Y * P V A T L W K H L K H N T N F Q N T S H Y Q R * G N A BaeI | TsoI SetI \ \ \ TTTACTATTTATGTCATTATTTTTGCCATTGTATCAAAACCTACACCCGTAATCACTTTA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| AAATGATAAATACAGTAATAAAAACGGTAACATAGTTTTGGATGTGGGCATTAGTGAAAT / / TsoI SetI F T I Y V I I F A I V S K P T P V I T L L L F M S L F L P L Y Q N L H P * S L * Y Y L C H Y F C H C I K T Y T R N H F S ----:----|----:----|----:----|----:----|----:----|----:----| K V I * T M I K A M T D F G V G T I V K S * * K H * * K Q W Q I L V * V R L * K K S N I D N N K G N Y * F R C G Y D S * BssKI | HpaII | ScrFI | CauII* | | CviJI BsrI | | | MseI TspEI | | | |TspEI PsiI BccI \ \ \ \ \\ \ \ GTTTTACTGGCAATTATTCTTGGTCTGCCCGGCTTAATTGTTGTTATAACTGCTACGAGA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAATGACCGTTAATAAGAACCAGACGGGCCGAATTAACAACAATATTGACGATGCTCT / / /// / / / / BsrI TspEI ||| | TspEI PsiI BccI ||| MseI ||BssKI ||CviJI |HpaII CauII* ScrFI V L L A I I L G L P G L I V V I T A T R F Y W Q L F L V C P A * L L L * L L R D F T G N Y S W S A R L N C C Y N C Y E M ----:----|----:----|----:----|----:----|----:----|----:----| T K S A I I R P R G P K I T T I V A V L L K V P L * E Q D A R S L Q Q * L Q * S N * Q C N N K T Q G A * N N N Y S S R S ApoI TspEI Csp6I | TspDTI |RsaI | | Csp6I || SetI BseGI FokI | | |RsaI \\ \ \ \ \ \ \\ TGGTCGTACCTATGGTGGATGTGCGTATATATTTGTGCTTTGCCTATTTGGAATTTCGTA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGCATGGATACCACCTACACGCATATATAAACACGAAACGGATAAACCTTAAAGCAT // / / // // |Csp6I BseGI FokI || |Csp6I RsaI || RsaI SetI |TspEI |ApoI TspDTI W S Y L W W M C V Y I C A L P I W N F V G R T Y G G C A Y I F V L C L F G I S Y V V P M V D V R I Y L C F A Y L E F R T ----:----|----:----|----:----|----:----|----:----|----:----| H D Y R H H I H T Y I Q A K G I Q F K T I T T G I T S T R I Y K H K A * K S N R P R V * P P H A Y I N T S Q R N P I E Y Hin4II* |Csp6I ||RsaI ||| Hin4I Hin4I ||| | ApoI FatI | FauI SetI ||| | BsrI |CviAII | |HphI | NdeI ||| | TspEI || NlaIII | || MnlI \ \ \\\ \ \ \\ \ \ \\ \ CTACCTTCATATGCGTACTGGAAATTTGATGACTTCTCATGGGGTGATACGAGAACTATT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| GATGGAAGTATACGCATGACCTTTAAACTACTGAAGAGTACCCCACTATGCTCTTGATAA / / // // / / / // / / // SetI | || || BsrI TspEI | |FatI Hin4I | |MnlI | || |Csp6I ApoI | CviAII | FauI | || RsaI NlaIII HphI | |Hin4I | Hin4II* NdeI L P S Y A Y W K F D D F S W G D T R T I Y L H M R T G N L M T S H G V I R E L L T F I C V L E I * * L L M G * Y E N Y C ----:----|----:----|----:----|----:----|----:----|----:----| S G E Y A Y Q F N S S K E H P S V L V I V V K M H T S S I Q H S R M P H Y S F * * R * I R V P F K I V E * P T I R S S N SetI |ApoI |TspEI || MboI || BclI || | DpnI BdaI || | TspDTI BdaI || | |BstKTI MnlI AciI SetI Hin4II* || | ||HphI MseI \ \ \ \\ \ \\\ \ GCGGGAGGTAATAAAAAGGCACAAGACGAGAATGAAGGTGAATTTGATCACTCAAAGATT 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCCTCCATTATTTTTCCGTGTTCTGCTCTTACTTCCACTTAAACTAGTGAGTTTCTAA / / // / ////// / / | SetI |Hin4II* SetI |||||BclI | BdaI AciI BdaI |||||MboI | BdaI BdaI ||||HphI MnlI |||DpnI ||BstKTI |TspDTI TspEI ApoI A G G N K K A Q D E N E G E F D H S K I R E V I K R H K T R M K V N L I T Q R L G R * * K G T R R E * R * I * S L K D * ----:----|----:----|----:----|----:----|----:----|----:----| A P P L L F A C S S F S P S N S * E F I Q P L Y Y F P V L R S H L H I Q D S L S R S T I F L C L V L I F T F K I V * L N MnlI | FatI | |CviAII Hin4II* MlyI | || NlaIII |MboII PleI BdaI | || | ApoI || MnlI | MaeIII BdaI | || | TspEI XmnI || | Hpy188I | Tsp45I \ \ \\ \ \ \ \\ \ \ \ \ AAAATGAGGACATGGAGGGAATTTGAAAGGGAAGATATTCTCAATCGGAAGGAGGAAAGT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTACTCCTGTACCTCCCTTAAACTTTCCCTTCTATAAGAGTTAGCCTTCCTCCTTTCA / / / // / / // / / // MseI | | |FatI TspEI XmnI || | Hpy188I |PleI | | CviAII ApoI || MnlI MlyI | NlaIII |MboII MnlI Hin4II* K M R T W R E F E R E D I L N R K E E S K * G H G G N L K G K I F S I G R R K V N E D M E G I * K G R Y S Q S E G G K * ----:----|----:----|----:----|----:----|----:----|----:----| L I L V H L S N S L S S I R L R F S S L * F S S M S P I Q F P L Y E * D S P P F F H P C P P F K F P F I N E I P L L F T CviRI* HinfI | Hin4II* \ \ \ GACTCCTTCGTTGCATAG 3490 ----:----|----:--- CTGAGGAAGCAACGTATC // // |HinfI |Hin4II* Tsp45I CviRI* MaeIII D S F V A * T P S L H X L L R C I X ----:----|----:--- S E K T A Y H S R R Q M V G E N C L # Enzymes that cut Frequency Isoschizomers AarI 1 Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 8 BspACI,SsiI AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 1 AluI 10 AluBI AlwNI 1 CaiI ApaI 1 ApoI 12 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AsuII 3 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BaeI 3 BalI 1 MlsI,MluNI,MscI,Msp20I BarI 2 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 12 BceAI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 2 BetI* 2 BsaWI BglII 2 BinI* 4 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmeT110I 1 BmgT120I 4 Bpu10I 1 BsaBI 3 Bse8I,BseJI BsaXI 2 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 10 BstF5I,BtsCI BseMII 3 BseRI 1 BseSI 2 BaeGI,BstSLI BseYI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI Bsp120I 1 PspOMI Bsp1407I 2 BsrGI,BstAUI BspCNI 3 BspMI 1 BfuAI,Acc36I,BveI BsrI 3 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 9 BtgZI 1 BtsI 1 Cac8I 2 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 15 CviQI,RsaNI CspCI 2 CviAII 7 CviJI 34 CviKI-1 CviRI* 7 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 9 MalI DraII 1 EcoO109I DrdI 1 AasI,DseDI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 1 EcoNI 1 BstENI,XagI EcoRII 3 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FalI 8 FatI 7 FauI 3 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 10 GlaI 2 GsaI 1 GsuI 1 BpmI HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 16 Hin4II* 7 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 16 HpaII 6 HapII,BsiSI,MspI HphI 9 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 16 Hpy188III Hpy188I 12 Hpy99I 5 KpnI 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 8 MboI 9 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 17 MfeI 2 MunI MlyI 6 SchI MmeI 3 MnlI 18 MseI 22 Tru1I,Tru9I MslI 4 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 5 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I OliI 1 AleI PacI 1 PleI 6 PpsI PsiI 3 AanI PstI 1 RsaI 15 AfaI SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 40 SfaNI 7 LweI SfeI* 2 BstSFI,SfcI,BfmI SspI 2 TaiI 7 TaqI 10 TatI 4 TauI 3 TfiI 10 PfeI TseI 2 ApeKI TsoI 3 Tsp45I 2 NmuCI Tsp4CI* 12 HpyCH4III,TaaI,Bst4CI TspDTI 17 TspEI 37 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 5 TscAI TstI 2 Tth111I 1 PflFI,PsyI,AspI VspI 2 PshBI,AseI XbaI 2 XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AclI AcyI AflII AlfI AloI ApaLI AscI AvaII AvrII BamHI BbvCI Bce83I* BcgI BfiI BglI BmtI BplI BsaAI BsePI BsgI BsiI* BsmI BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BstAPI BstEII BstXI BtrI Cfr9I ClaI DinI DraIII DsaI* EciI Ecl136II Eco47III Eco57I EcoICRI EcoP15I EcoRI EcoT22I EgeI EheI Esp3I EspI* FseI FspAI HaeII HpaI KasI MauBI McrI* MluI Mph1103I MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TspMI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769