Restriction Map of FUR4/YBR021W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

FUR4/YBR021W on chromosome II from coordinates 281443 to 283344.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.28471

MseI |MboII || AciI || |BisI || |Hin4I || ||BlsI FalI || |||TauI SapI FalI FalI || |||CviJI Ksp632I* FalI \ \\ \\\\ \ \ ATGCCAGACAATCTATCATTACATTTAAGCGGCTCTTCAAAAAGATTGAACTCTCGCCAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGTCTGTTAGATAGTAATGTAAATTCGCCGAGAAGTTTTTCTAACTTGAGAGCGGTT / / / //// / / / FalI | | |||CviJI | FalI BsiYI* FalI | | ||BisI | FalI PflMI | | ||AciI Ksp632I* | | |BlsI SapI | | TauI | MseI Hin4I MboII M P D N L S L H L S G S S K R L N S R Q C Q T I Y H Y I * A A L Q K D * T L A N A R Q S I I T F K R L F K K I E L S P T ----:----|----:----|----:----|----:----|----:----|----:----| X G S L R D N C K L P E E F L N F E R W X A L C D I M V N L R S K L F I S S E G H W V I * * * M * A A R * F S Q V R A L MboII CspCI |PflMI | SetI |BsiYI* | | Hin6I || TfiI BsmAI | | |GlaI || HinfI Eco31I | | ||HhaI Hin4I CspCI \\ \ \ \ \ \\\ \ \ CTTATGGAATCTTCCAATGAGACCTTTGCGCCAAATAATGTGGATTTGGAAAAAGAGTAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GAATACCTTAGAAGGTTACTCTGGAAACGCGGTTTATTACACCTAAACCTTTTTCTCATA / / // / /// / / MboII HinfI || SetI ||Hin6I Hin4I CspCI TfiI |CspCI |GlaI Eco31I HhaI BsmAI L M E S S N E T F A P N N V D L E K E Y L W N L P M R P L R Q I M W I W K K S I Y G I F Q * D L C A K * C G F G K R V * ----:----|----:----|----:----|----:----|----:----|----:----| S I S D E L S V K A G F L T S K S F S Y V * P I K W H S R Q A L Y H P N P F L T K H F R G I L G K R W I I H I Q F F L I DdeI TaqI | Hpy188I | AluI | | Hin4I | CviJI | | | BspCNI | | SetI | | | |BseMII MnlI | | SfaNI \ \ \ \\ \ \ \ \ AAGTCATCTCAGAGTAATATAACTACCGAAGTTTATGAGGCATCGAGCTTTGAAGAAAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGTAGAGTCTCATTATATTGATGGCTTCAAATACTCCGTAGCTCGAAACTTCTTTTT // / // / / / / || Hin4I |BseMII MnlI | CviJI SfaNI |DdeI BspCNI | AluI Hpy188I TaqI SetI K S S Q S N I T T E V Y E A S S F E E K S H L R V I * L P K F M R H R A L K K K V I S E * Y N Y R S L * G I E L * R K S ----:----|----:----|----:----|----:----|----:----|----:----| L D D * L L I V V S T * S A D L K S S F Y T M E S Y Y L * R L K H P M S S Q L F L * R L T I Y S G F N I L C R A K F F F SetI MboII |BspCNI |AluI ||BseMII |CviJI ||| AluI ||DdeI ||| MnlI |||SetI ||| CviJI |||| Hpy188I ||| | SetI Hpy178III* MboII \\\\ \ \\\ \ \ \ \ GTAAGCTCAGAAAAACCTCAATACAGCTCATTCTGGAAGAAAATCTATTATGAATATGTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CATTCGAGTCTTTTTGGAGTTATGTCGAGTAAGACCTTCTTTTAGATAATACTTATACAC / / // / // /// / / | | |DdeI | || ||CviJI Hpy178III* MboII | | | | || ||AluI | | | | || |MnlI | | | | || SetI | | | | |BseMII | | | | BspCNI | | | SetI | | Hpy188I | CviJI | AluI MboII SetI V S S E K P Q Y S S F W K K I Y Y E Y V * A Q K N L N T A H S G R K S I M N M W K L R K T S I Q L I L E E N L L * I C G ----:----|----:----|----:----|----:----|----:----|----:----| T L E S F G * Y L E N Q F F I * * S Y T L L S L F V E I C S M R S S F R N H I H Y A * F F R L V A * E P L F D I I F I H TatI Bsp1407I |Csp6I ||RsaI TspDTI TspDTI ||| BssKI |HindII | Hpy178III* ||| EcoRII |Hpy166II | | TfiI ||| | ScrFI || TaqII | | HinfI ||| | BseBI \\ \ \ \ \ \\\ \ \ GTCGTTGACAAATCAATCTTGGGTGTTTCTATTCTGGATTCATTTATGTACAACCAGGAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCAACTGTTTAGTTAGAACCCACAAAGATAAGACCTAAGTAAATACATGTTGGTCCTG / / / / / / /// / / | | TaqII TspDTI | HinfI ||| | EcoRII | Hpy166II | TfiI ||| | BssKI | HindII Hpy178III* ||| BseBI TspDTI ||| ScrFI ||Bsp1407I ||TatI |Csp6I RsaI V V D K S I L G V S I L D S F M Y N Q D S L T N Q S W V F L F W I H L C T T R T R * Q I N L G C F Y S G F I Y V Q P G L ----:----|----:----|----:----|----:----|----:----|----:----| T T S L D I K P T E I R S E N I Y L W S P R Q C I L R P H K * E P N M * T C G P D N V F * D Q T N R N Q I * K H V V L V AsuI* AvaII |BmgT120I ||BssKI ||EcoRII ||| ScrFI CviJI ||| BseBI | TaqI ||| | Csp6I | | Hpy99I ||| | |RsaI | | | FauI AciI ||| | || TspEI MaeIII CviJI \ \ \ \ \ \\\ \ \\ \ \ \ TTGAAGCCCGTCGAAAAAGAAAGGCGGGTTTGGTCCTGGTACAATTATTGTTACTTCTGG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCGGGCAGCTTTTTCTTTCCGCCCAAACCAGGACCATGTTAATAACAATGAAGACC / / / / / // / /// / / / | | TaqI FauI AciI || | ||| TspEI | CviJI | Hpy99I || | ||Csp6I MaeIII CviJI || | |RsaI || | EcoRII || | BssKI || BseBI || ScrFI |AvaII |AsuI* BmgT120I L K P V E K E R R V W S W Y N Y C Y F W * S P S K K K G G F G P G T I I V T S G E A R R K R K A G L V L V Q L L L L L A ----:----|----:----|----:----|----:----|----:----|----:----| K F G T S F S L R T Q D Q Y L * Q * K Q S S A R R F L F A P K T R T C N N N S R Q L G D F F F P P N P G P V I I T V E P TspEI | TseI | CviRI* | |BisI | ||BlsI | |||AluI AccI | |||CviJI SetI | ||||SfeI* |BbvI MmeI Cac8I | |||||SetI |Hpy166II |BsrI \ \ \\\\\\ \\ \\ CTTGCTGAATGTTTCAATATCAACACTTGGCAAATTGCAGCTACAGGTCTACAACTGGGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGACTTACAAAGTTATAGTTGTGAACCGTTTAACGTCGATGTCCAGATGTTGACCCA / ///// // // / // Cac8I ||||| || || | |BsrI ||||| || || | MmeI ||||| || || BbvI ||||| || |AccI ||||| || Hpy166II ||||| |SfeI* ||||| SetI ||||CviJI ||||TseI ||||AluI |||BisI ||BlsI ||SetI |CviRI* TspEI L A E C F N I N T W Q I A A T G L Q L G L L N V S I S T L G K L Q L Q V Y N W V C * M F Q Y Q H L A N C S Y R S T T G S ----:----|----:----|----:----|----:----|----:----|----:----| S A S H K L I L V Q C I A A V P R C S P A Q Q I N * Y * C K A F Q L * L D V V P K S F T E I D V S P L N C S C T * L Q T Csp6I TspEI BtsI |RsaI |BfiI TspRI TspEI || Tsp4CI* MmeI \\ \ \ \\ \ \ CTAAATTGGTGGCAGTGTTGGATAACAATTTGGATTGGGTACGGTTTCGTTGGTGCTTTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTAACCACCGTCACAACCTATTGTTAAACCTAACCCATGCCAAAGCAACCACGAAAA / / / / / /// / | | TspRI BtsI TspEI ||Tsp4CI* MmeI | TspEI |Csp6I BfiI RsaI L N W W Q C W I T I W I G Y G F V G A F * I G G S V G * Q F G L G T V S L V L L K L V A V L D N N L D W V R F R W C F C ----:----|----:----|----:----|----:----|----:----|----:----| R F Q H C H Q I V I Q I P Y P K T P A K D L N T A T N S L L K S Q T R N R Q H K * I P P L T P Y C N P N P V T E N T S K CviJI HaeIII | XbaI | |MaeI | |Hpy178III* | || MnlI | || |MboI | || |XhoII | || || DpnI XbaI | || || |BstKTI |MaeI | || || || BinI* |Hpy178III* \ \\ \\ \\ \ \\ GTTGTTTTGGCCTCTAGAGTTGGATCTGCTTATCATTTGTCATTCCCTATATCATCTAGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAAAACCGGAGATCTCAACCTAGACGAATAGTAAACAGTAAGGGATATAGTAGATCT / // / // / / // | || | || | BinI* |XbaI | || | || XhoII Hpy178III* | || | || MboI MaeI | || | |DpnI | || | BstKTI | || MnlI | |XbaI | Hpy178III* | MaeI HaeIII CviJI V V L A S R V G S A Y H L S F P I S S R L F W P L E L D L L I I C H S L Y H L E C F G L * S W I C L S F V I P Y I I * S ----:----|----:----|----:----|----:----|----:----|----:----| T T K A E L T P D A * * K D N G I D D L Q Q K P R * L Q I Q K D N T M G * I M * N N Q G R S N S R S I M Q * E R Y * R S FatI |CviAII ||PleI |||CfrI AsuI* |||MlyI |CviJI ||||NlaIII |HaeIII |||||BalI MboII |BmgT120I |||||CviJI |SfaNI || MseI HinfI |||||HaeIII \\ \\ \ \ \\\\\\ GCATCATTCGGTATTTTCTTCTCTTTATGGCCCGTTATTAACAGAGTCGTCATGGCCATC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGTAAGCCATAAAAGAAGAGAAATACCGGGCAATAATTGTCTCAGCAGTACCGGTAG / / /// / / / /// / / MboII SfaNI ||AsuI* MseI | | ||| | BsiYI* |BmgT120I | | ||| | PflMI HaeIII | | ||| CfrI CviJI | | ||HaeIII | | ||CviJI | | ||BalI | | |FatI | | CviAII | | PleI | | MlyI | NlaIII HinfI A S F G I F F S L W P V I N R V V M A I H H S V F S S L Y G P L L T E S S W P S I I R Y F L L F M A R Y * Q S R H G H R ----:----|----:----|----:----|----:----|----:----|----:----| A D N P I K K E K H G T I L L T T M A M L M M R Y K R R K I A R * * C L R * P W C * E T N E E R * P G N N V S D D H G D HindIII | AluI | CviJI | | SetI | | | BaeI | | | | MwoI | | | | | AciI PflMI | | | | | |BisI BsiYI* | | | | | ||BlsI MseI | BccI | | | | | |||TauI VspI BaeI \ \ \ \ \ \ \ \\\\ \ \ GTTTGGTATAGTGTCCAAGCTTATATTGCGGCAACTCCCGTATCATTAATGCTGAAATCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAAACCATATCACAGGTTCGAATATAACGCCGTTGAGGGCATAGTAATTACGACTTTAGA / /// // /// / / BccI ||| |MwoI ||BisI | BaeI ||| | ||AciI VspI ||| | |BlsI MseI ||| | TauI ||| HindIII ||CviJI ||AluI |BaeI SetI V W Y S V Q A Y I A A T P V S L M L K S F G I V S K L I L R Q L P Y H * C * N L L V * C P S L Y C G N S R I I N A E I Y ----:----|----:----|----:----|----:----|----:----|----:----| T Q Y L T W A * I A A V G T D N I S F D R K T Y H G L K Y Q P L E R I M L A S I N P I T D L S I N R C S G Y * * H Q F R MboI MboI | DpnI | DpnI | |BstKTI | |BstKTI BsmI | || HphI | || BinI* | TspDTI \ \\ \ \ \\ \ \ \ ATCTTTGGAAAAGATTTACAAGACAAAATCCCAGATCACTTTGGATCACCGAATGCTACT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAAACCTTTTCTAAATGTTCTGTTTTAGGGTCTAGTGAAACCTAGTGGCTTACGATGA // / // / / / / || MboI || MboI | | TspDTI || HphI |DpnI | BsmI |DpnI BstKTI BinI* BstKTI I F G K D L Q D K I P D H F G S P N A T S L E K I Y K T K S Q I T L D H R M L L L W K R F T R Q N P R S L W I T E C Y Y ----:----|----:----|----:----|----:----|----:----|----:----| I K P F S K C S L I G S * K P D G F A V * R Q F L N V L C F G L D S Q I V S H * D K S F I * L V F D W I V K S * R I S S TseI MboII CviJI FatI BbvII* |CviAII |BisI || NlaIII ||BlsI BsrI || | BbvI ||| BsrI NlaIV \\ \ \ \\\ \ \ ACTTACGAGTTCATGTGTTTTTTTATCTTTTGGGCTGCCAGTCTTCCATTTTTACTGGTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TGAATGCTCAAGTACACAAAAAAATAGAAAACCCGACGGTCAGAAGGTAAAAATGACCAA / // / ////// / / | |FatI BbvI |||||BbvII* | NlaIV | CviAII ||||TseI BsrI NlaIII |||BisI |||BsrI ||BlsI |CviJI MboII T Y E F M C F F I F W A A S L P F L L V L T S S C V F L S F G L P V F H F Y W F L R V H V F F Y L L G C Q S S I F T G S ----:----|----:----|----:----|----:----|----:----|----:----| V * S N M H K K I K Q A A L R G N K S T * K R T * T N K * R K P Q W D E M K V P S V L E H T K K D K P S G T K W K * Q N BceAI |SetI || Hpy166II || | Tsp4CI* TspEI || | | CviJI SetI | MnlI || | | MseI |TspGWI NlaIV \ \ \ \\ \ \ \ \\ \ CCACCTCACAAAATTAGACACCTGTTTACTGTTAAAGCCGTCTTGGTTCCGTTTGCTTCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGGAGTGTTTTAATCTGTGGACAAATGACAATTTCGGCAGAACCAAGGCAAACGAAGA / / / / / / / / // / SetI | | SetI | | | | |CviJI NlaIV | TspEI | | | | TspGWI MnlI | | | MseI | | Tsp4CI* | Hpy166II BceAI P P H K I R H L F T V K A V L V P F A S H L T K L D T C L L L K P S W F R L L L T S Q N * T P V Y C * S R L G S V C F F ----:----|----:----|----:----|----:----|----:----|----:----| G G * L I L C R N V T L A T K T G N A E E V E C F * V G T * Q * L R R P E T Q K W R V F N S V Q K S N F G D Q N R K S R CviJI | SapI | Ksp632I* | | Hpy188I | | | AluI | | | CviJI DdeI | | | Ecl136II SauI* | | | | SetI | MboI | | | | SduI | XhoII | | | | SacI | | DpnI | | | | HgiAI* | | |BstKTI MseI | | | | HgiJII* | | || MseI |TspEI | | | | | MboII | | || | BinI* \\ \ \ \ \ \ \ \ \ \\ \ \ TTTGGTTTCTTAATTTGGGCTATCAGAAGAGCTCACGGGCGTATTGCCTTAGGATCTTTA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCAAAGAATTAAACCCGATAGTCTTCTCGAGTGCCCGCATAACGGAATCCTAGAAAT / / / / / / / / // / / | | | | | | MboII | || | MseI | | | | | Ecl136II | || XhoII | | | | | CviJI | || MboI | | | | | AluI | |DpnI | | | | HgiJII* | BstKTI | | | | HgiAI* SauI* | | | | SacI DdeI | | | | SduI | | | | SetI | | | Ksp632I* | | | Hpy188I | | | SapI | | CviJI | TspEI MseI F G F L I W A I R R A H G R I A L G S L L V S * F G L S E E L T G V L P * D L * W F L N L G Y Q K S S R A Y C L R I F N ----:----|----:----|----:----|----:----|----:----|----:----| K P K K I Q A I L L A * P R I A K P D K K Q N R L K P * * F L E R A Y Q R L I K K T E * N P S D S S S V P T N G * S R * FatI SetI DdeI TatI |CviAII | MboI Bsp1407I || NlaIII | | DpnI |Csp6I || |CviJI BsiYI* | | |BstKTI ||RsaI || || MnlI | CviJI | | || TsoI \\\ \\ \\ \ \ \ \ \ \\ \ ACCGATGTACAACCTCATGGCTCTGCCTTTTCGTGGGCTTTTCTAAGATCACTAATGGGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCTACATGTTGGAGTACCGAGACGGAAAAGCACCCGAAAAGATTCTAGTGATTACCCA / //// / /// / / / /// / / BinI* |||| | ||| MnlI BsiYI* CviJI ||| | TsoI |||| | ||CviJI ||| MboI |||| | |FatI ||DpnI |||| | CviAII |BstKTI |||| NlaIII DdeI |||SetI ||Bsp1407I ||TatI |Csp6I RsaI T D V Q P H G S A F S W A F L R S L M G P M Y N L M A L P F R G L F * D H * W V R C T T S W L C L F V G F S K I T N G L ----:----|----:----|----:----|----:----|----:----|----:----| V S T C G * P E A K E H A K R L D S I P L R H V V E H S Q R K T P K E L I V L P G I Y L R M A R G K R P S K * S * * H T Hpy178III* | XbaI | |MaeI CviJI GsuI | |Hpy178III* | TspEI Eco57MI | || BsaXI \ \ \ \ \\ \ TGTATGGCTAATTTCTCCACAATGGTAATCAACGCTCCAGATTTCTCTAGATTTTCAAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ACATACCGATTAAAGAGGTGTTACCATTAGTTGCGAGGTCTAAAGAGATCTAAAAGTTTT / / / / // CviJI | Eco57MI | |XbaI | GsuI | Hpy178III* TspEI | BsaXI | MaeI Hpy178III* C M A N F S T M V I N A P D F S R F S K V W L I S P Q W * S T L Q I S L D F Q K Y G * F L H N G N Q R S R F L * I F K K ----:----|----:----|----:----|----:----|----:----|----:----| Q I A L K E V I T I L A G S K E L N E F N Y P * N R W L P L * R E L N R * I K L T H S I E G C H Y D V S W I E R S K * F BsiYI* | AsuI* | AvaII | |BmgT120I | ||NlaIV BslFI | ||BsaXI BsmI | AciI | ||| TspEI CviRI* \ \ \ \\\ \ \ AACCCTAACTCCGCTTTATGGTCCCAATTAGTGTGCATTCCATTTTTGTTTTCCATCACT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGGATTGAGGCGAAATACCAGGGTTAATCACACGTAAGGTAAAAACAAAAGGTAGTGA / // / // / / / | || | |AvaII | | CviRI* | || | |AsuI* | BsmI | || | | TspEI | || | BmgT120I | || | NlaIV | || BsaXI | |BsiYI* | AciI BslFI N P N S A L W S Q L V C I P F L F S I T T L T P L Y G P N * C A F H F C F P S L P * L R F M V P I S V H S I F V F H H L ----:----|----:----|----:----|----:----|----:----|----:----| F G L E A K H D W N T H M G N K N E M V F G * S R K I T G I L T C E M K T K W * V R V G S * P G L * H A N W K Q K G D S ApoI TspEI EcoRI |HphI || MaeI || | MaeIII || | Tsp45I || | | TsoI || | | | AciI || | | | | TseI || | | | | |BisI || | | | | ||BlsI || | | | | |||AluI Tsp4CI* || | | | | |||CviJI | MseI BccI || | | | | |||PvuII | VspI | MseI || | | | | |||NspBII* | TspDTI | |TspEI || | | | | |||| SetI BbvI | |TspEI \ \\ \\ \ \ \ \ \\\\ \ \ \ \\ TGTTTAATTGGAATTCTAGTCACCGCAGCTGGTTATGAAATATACGGTATTAATTACTGG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAATTAACCTTAAGATCAGTGGCGTCGACCAATACTTTATATGCCATAATTAATGACC / / / / / / / //// / / / / / / | | | | | MaeI | |||NspBII* | | | | | BsrI | | | | | TsoI | |||PvuII | | | | TspEI | | | | EcoRI | |||CviJI | | | VspI | | | | TspEI | |||TseI | | | MseI | | | | ApoI | |||AluI | | TspDTI | | | HphI | ||BisI | Tsp4CI* | | TspEI | |BlsI BbvI | MseI | |SetI BccI | AciI Tsp45I MaeIII C L I G I L V T A A G Y E I Y G I N Y W V * L E F * S P Q L V M K Y T V L I T G F N W N S S H R S W L * N I R Y * L L V ----:----|----:----|----:----|----:----|----:----|----:----| Q K I P I R T V A A P * S I Y P I L * Q K N L Q F E L * R L Q N H F I R Y * N S T * N S N * D G C S T I F Y V T N I V P AluI ApoI SduI CviJI BsrI TaqI MaeI TspEI PsiI BseSI | SetI \ \ \ \ \ \ \ \ TCGCCACTCGATGTGCTAGAAAAATTTTTACAGACTACTTATAATAAGGGCACAAGAGCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGGTGAGCTACACGATCTTTTTAAAAATGTCTGATGAATATTATTCCCGTGTTCTCGA / / / / / / / TaqI MaeI TspEI PsiI BseSI | CviJI ApoI SduI | AluI SetI S P L D V L E K F L Q T T Y N K G T R A R H S M C * K N F Y R L L I I R A Q E L A T R C A R K I F T D Y L * * G H K S W ----:----|----:----|----:----|----:----|----:----|----:----| D G S S T S S F N K C V V * L L P V L A T A V R H A L F I K V S * K Y Y P C L L R W E I H * F F K * L S S I I L A C S S Csp6I |RsaI AluI |SetI CviJI || BspCNI MseI |DdeI || |BseMII | BceAI ||SetI || || SspI CviRI* \ \ \\\ \\ \\ \ \ GGTGTTTTCTTAATCTCTTTTGTTTTCGCCGTAGCTCAGTTAGGTACTAATATTTCTGCA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAAAAGAATTAGAGAAAACAAAAGCGGCATCGAGTCAATCCATGATTATAAAGACGT / / / / / / /// / / | BceAI | | | | ||| SspI CviRI* MseI | | | | ||BseMII | | | | |BspCNI | | | | |Csp6I | | | | RsaI | | | SetI | | DdeI | CviJI | AluI SetI G V F L I S F V F A V A Q L G T N I S A V F S * S L L F S P * L S * V L I F L Q C F L N L F C F R R S S V R Y * Y F C K ----:----|----:----|----:----|----:----|----:----|----:----| P T K K I E K T K A T A * N P V L I E A Q H K R L R K Q K R R L E T L Y * Y K Q T N E * D R K N E G Y S L * T S I N R C MslI AciI TspDTI \ \ \ AACTCATTATCGTGTGGAACTGATATGTCCGCTATTTTCCCCAAGTTTATCAATATCAAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGTAATAGCACACCTTGACTATACAGGCGATAAAAGGGGTTCAAATAGTTATAGTTC / / / MslI AciI TspDTI N S L S C G T D M S A I F P K F I N I K T H Y R V E L I C P L F S P S L S I S S L I I V W N * Y V R Y F P Q V Y Q Y Q A ----:----|----:----|----:----|----:----|----:----|----:----| F E N D H P V S I D A I K G L N I L I L L S M I T H F Q Y T R * K G W T * * Y * V * * R T S S I H G S N E G L K D I D L TseI CviRI* |BisI ||BlsI |||CviJI ||||FatI ||||NcoI ||||StyI ||||SecI* FatI ||||DsaI* NcoI |||||CviAII StyI ||||||MwoI SecI* ||||||| NlaIII DsaI* ||||||| |Hin6I |CviAII ||||||| ||GlaI || NlaIII ||||||| |||HhaI || |ApoI ||||||| ||||BbvI || |TspEI ||||||| ||||HaeII BsgI || || MseI \\\\\\\ \\\\\ \ \\ \\ \ CGTGGTTCATTATTTTGTGCAGCCATGGCGCTGTGTATTTGTCCATGGAATTTAATGGCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GCACCAAGTAATAAAACACGTCGGTACCGCGACACATAAACAGGTACCTTAAATTACCGT ///// ///// // / // / / ||||| ||||| |BsgI | || | MseI ||||| ||||| BbvI | || TspEI ||||| ||||Hin6I | || ApoI ||||| |||GlaI | |DsaI* ||||| ||HhaI | |SecI* ||||| |DsaI* | |StyI ||||| |SecI* | |NcoI ||||| |HaeII | |FatI ||||| |StyI | CviAII ||||| |NcoI NlaIII ||||| |FatI ||||| CviAII ||||NlaIII |||CviJI |||MwoI |||TseI ||BisI |BlsI CviRI* R G S L F C A A M A L C I C P W N L M A V V H Y F V Q P W R C V F V H G I * W Q W F I I L C S H G A V Y L S M E F N G N ----:----|----:----|----:----|----:----|----:----|----:----| R P E N N Q A A M A S H I Q G H F K I A A H N M I K H L W P A T Y K D M S N L P T T * * K T C G H R Q T N T W P I * H C MwoI ApoI |AciI Cfr10I TspEI CviJI || NdeI BsrI |HpaII \ \ \\ \ \ \\ ACATCAAGTAAATTTACAATGGCTTTGTCCGCATATGCTATCTTTTTGTCCAGTATTGCC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGTTCATTTAAATGTTACCGAAACAGGCGTATACGATAGAAAAACAGGTCATAACGG / / / / / / TspEI | MwoI | NdeI BsrI ApoI CviJI AciI T S S K F T M A L S A Y A I F L S S I A H Q V N L Q W L C P H M L S F C P V L P I K * I Y N G F V R I C Y L F V Q Y C R ----:----|----:----|----:----|----:----|----:----|----:----| V D L L N V I A K D A Y A I K K D L I A L M L Y I * L P K T R M H * R K T W Y Q C * T F K C H S Q G C I S D K Q G T N G BspCNI MboII |Hin4I | TstI |BseMII | | AluI DdeI ||Ksp632I* | | CviJI | Hpy188I |||MnlI | | | SetI Hin4I \ \ \\\\ \ \ \ \ \ GGTGTTGTCTGCTCAGATTACTTTGTTGTTAGAAGAGGATATATCAAGCTAACACACATA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAACAGACGAGTCTAATGAAACAACAATCTTCTCCTATATAGTTCGATTGTGTGTAT // // / // / / / / / / / |Cfr10I |DdeI | || | Ksp632I* | | | | Hin4I HpaII | | || MnlI | | | CviJI | | |BseMII | | | AluI | | BspCNI | | SetI | Hin4I | MboII Hpy188I TstI G V V C S D Y F V V R R G Y I K L T H I V L S A Q I T L L L E E D I S S * H T Y C C L L R L L C C * K R I Y Q A N T H I ----:----|----:----|----:----|----:----|----:----|----:----| P T T Q E S * K T T L L P Y I L S V C M R H Q R S L N S Q Q * F L I Y * A L V C T N D A * I V K N N S S S I D L * C V Y BsiYI* | BccI SetI | | CviJI | TspGWI | | |TstI | | MfeI | | ||SduI Csp6I | | TspEI | | ||HgiJII* |RsaI | | | BbvI \ \ \\\ \\ \ \ \ \ TATTCCCATCAAAAGGGCTCTTTTTATATGTACGGAAACAGGTTTGGTATCAATTGGAGA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGGGTAGTTTTCCCGAGAAAAATATACATGCCTTTGTCCAAACCATAGTTAACCTCT / / / / // / / / // | | | CviJI |Csp6I SetI TspGWI | |SetI | | HgiJII* RsaI | BbvI | | BccI TspEI | | SduI MfeI | TstI BsiYI* Y S H Q K G S F Y M Y G N R F G I N W R I P I K R A L F I C T E T G L V S I G E F P S K G L F L Y V R K Q V W Y Q L E S ----:----|----:----|----:----|----:----|----:----|----:----| Y E W * F P E K * I Y P F L N P I L Q L I N G D F P S K K Y T R F C T Q Y * N S I G M L L A R K I H V S V P K T D I P S AluI CviJI CviJI | SetI |NlaIV | | TseI || BtgZI | | MwoI || | TspDTI | | CviJI || | |Cac8I | | |BisI || | || BssKI MnlI | | ||BlsI || | || | HpaII | AciI | | |||CviRI* || | || | ScrFI | FnuDII* | | |||| MslI || | || | CauII* | | SetI \ \ \\\\ \ \\ \ \\ \ \ \ \ \ GCTTTGGCTGCATATCTATGTGGGGTGGCTCCTTGCTTGCCCGGTTTCATCGCGGAGGTG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACCGACGTATAGATACACCCCACCGAGGAACGAACGGGCCAAAGTAGCGCCTCCAC / / //// / // / / /// / / // | | |||| MslI || | | ||| MnlI | |SetI | | |||CviRI* || | | ||BssKI | AciI | | |||TseI || | | |HpaII FnuDII* | | ||BisI || | | CauII* | | |BlsI || | | ScrFI | | CviJI || | Cac8I | MwoI || | BtgZI CviJI || TspDTI AluI |NlaIV CviJI A L A A Y L C G V A P C L P G F I A E V L W L H I Y V G W L L A C P V S S R R W F G C I S M W G G S L L A R F H R G G G ----:----|----:----|----:----|----:----|----:----|----:----| A K A A Y R H P T A G Q K G P K M A S T L K P Q M D I H P P E K S A R N * R P P S Q S C I * T P H S R A Q G T E D R L H FauI | BccI Hin6I | |SetI |GlaI | || Hpy188I DdeI ||HhaI | || | AluI TspDTI |||HaeII | || | CviJI |SetI |||| AciI | || | | SetI || MaeIII \\\\ \ \ \\ \ \ \ \\ \ GGCGCTCCCGCTATAAAGGTTTCTGATGGAGCTATGAAACTATATTACCTAAGTTACTGG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCGAGGGCGATATTTCCAAAGACTACCTCGATACTTTGATATAATGGATTCAATGACC //// / // / / / / // / / / |||Hin6I AciI || | | | CviJI || DdeI | BsrI ||GlaI || | | | AluI |TspDTI MaeIII |HhaI || | | SetI SetI HaeII || | Hpy188I || BccI |FauI SetI G A P A I K V S D G A M K L Y Y L S Y W A L P L * R F L M E L * N Y I T * V T G R S R Y K G F * W S Y E T I L P K L L G ----:----|----:----|----:----|----:----|----:----|----:----| P A G A I F T E S P A I F S Y * R L * Q P R E R * L P K Q H L * S V I N G L N S A S G S Y L N R I S S H F * I V * T V P TaqII | Csp6I | |RsaI | ||BssKI | ||EcoRII | |||SecI* | |||BsiYI* CviJI Bce83I* | ||||ScrFI |SmlI | MboII | ||||BseBI BsrI BfiI || MboII | |MaeIII | |||||SetI \ \ \\ \ \ \\ \ \\\\\\ GTAGGATATGGCTTGAGTTTTTCTTCTTATACTGCTCTGTGTTACTTCTTCCCTGTACCT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CATCCTATACCGAACTCAAAAAGAAGAATATGACGAGACACAATGAAGAAGGGACATGGA / / / / / / / / /// / BfiI | | SmlI | MboII | TaqII ||| BseBI | MboII Bce83I* MaeIII ||| ScrFI CviJI ||Csp6I |RsaI |SetI BsiYI* V G Y G L S F S S Y T A L C Y F F P V P * D M A * V F L L I L L C V T S S L Y L R I W L E F F F L Y C S V L L L P C T W ----:----|----:----|----:----|----:----|----:----|----:----| T P Y P K L K E E * V A R H * K K G T G P L I H S S N K K K Y Q E T N S R G Q V Y S I A Q T K R R I S S Q T V E E R Y R HgiCI* | NlaIV | | SduI | | BseSI BsiYI* | | | MseI | AsuI* | | | |HpaI CviJI | |BmgT120I | | | |HindII | NlaIV | ||CviJI | | | |Hpy166II PsiI | |BccI | ||HaeIII TaqI \ \ \ \\ \ \ \\ \ \\\ \ GGGTGCCCTGTTAACAACATTATAAAGGACAAGGGCTGGTTCCAAAGATGGGCCAATGTC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CCCACGGGACAATTGTTGTAATATTTCCTGTTCCCGACCAAGGTTTCTACCCGGTTACAG /// / // / / / / / // ||| | |MseI PsiI | | | BsiYI* |AsuI* ||| | Hpy166II | | BccI BmgT120I ||| | HindII | NlaIV HaeIII ||| | HpaI CviJI CviJI ||| HgiCI* ||NlaIV |BseSI |SduI EcoRII BssKI SecI* G C P V N N I I K D K G W F Q R W A N V G A L L T T L * R T R A G S K D G P M S V P C * Q H Y K G Q G L V P K M G Q C R ----:----|----:----|----:----|----:----|----:----|----:----| P H G T L L M I F S L P Q N W L H A L T Q T G Q * C C * L P C P S T G F I P W H P A R N V V N Y L V L A P E L S P G I D BssKI SexAI MboII EcoRII | MboII |BseGI | | MnlI ||ScrFI | | MfeI ||BseBI Ksp632I* | | TspEI |||SetI FokI SspI \ \ \ \ \\\\ \ \ GATGATTTTGAAGAAGAGTGGAAAGACACAATTGAGAGGGATGACCTGGTAGATGACAAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTAAAACTTCTTCTCACCTTTCTGTGTTAACTCTCCCTACTGGACCATCTACTGTTA / / / / / / / / / / / TaqI Ksp632I* | | MnlI TspEI | | EcoRII | SspI | MboII MfeI | | SexAI FokI MboII | | BssKI | BseBI | ScrFI BseGI SetI D D F E E E W K D T I E R D D L V D D N M I L K K S G K T Q L R G M T W * M T I * F * R R V E R H N * E G * P G R * Q Y ----:----|----:----|----:----|----:----|----:----|----:----| S S K S S S H F S V I S L S S R T S S L R H N Q L L T S L C L Q S P H G P L H C I I K F F L P F V C N L P I V Q Y I V I AccI MseI |Hpy166II TspDTI |Hin4I \\ \ \\ ATTAGTGTCTACGAACACGAACACGAAAAGACTTTCATTTAA 1870 1880 1890 1900 ----:----|----:----|----:----|----:----|-- TAATCACAGATGCTTGTGCTTGTGCTTTTCTGAAAGTAAATT // / / / |AccI TspDTI Hin4I MseI Hpy166II I S V Y E H E H E K T F I * L V S T N T N T K R L S F X * C L R T R T R K D F H L X ----:----|----:----|----:----|----:----|-- I L T * S C S C S F V K M * Y * H R R V R V R F S K * K N T D V F V F V F L S E N L # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 9 BspACI,SsiI AluI 12 AluBI ApoI 4 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BceAI 2 BfiI 2 BmrI,BmuI BinI* 3 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmgT120I 4 BsaXI 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 4 BseSI 2 BaeGI,BstSLI BsgI 1 BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 2 BsrGI,BstAUI BspCNI 4 BsrI 6 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstKTI 5 BtgZI 1 BtsI 1 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 7 CviQI,RsaNI CspCI 1 CviAII 5 CviJI 32 CviKI-1 CviRI* 5 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 5 MalI DsaI* 2 BtgI,BstDSI Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 1 EcoRI 1 EcoRII 4 AjnI,Psp6I,PspGI FalI 2 FatI 5 FauI 2 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 3 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 3 Hin6I 3 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 3 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 5 Hpy99I 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeIII 4 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 MfeI 2 MunI MlyI 1 SchI MmeI 2 MnlI 8 MseI 12 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NcoI 2 Bsp19I NdeI 1 FauNDI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PflMI 2 BasI,AccB7I,Van91I PleI 1 PpsI PsiI 2 AanI PvuII 1 RsaI 7 AfaI SacI 1 Psp124BI,SstI SapI 2 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 25 SexAI 1 MabI SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaqI 4 TaqII 2 TatI 2 TauI 2 TfiI 2 PfeI TseI 5 ApeKI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 16 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI TstI 1 VspI 2 PshBI,AseI XbaI 3 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BamHI BarI BbvCI BcgI BciVI BclI BdaI BetI* BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsePI BseRI BseYI BsiI* Bsp120I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI Cfr9I ClaI DinI DraII DraIII DrdI Eam1105I EciI Eco47III Eco57I EcoNI EcoP15I EcoRV EcoT22I EgeI EheI Esp3I EspI* FseI FspAI GsaI HgaI Hin4II* KasI KpnI MaeII MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI RsrII SacII SalI SanDI ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaiI TspMI Tth111I XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769