Restriction Map of GRX7/YBR014C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GRX7/YBR014C on chromosome II from coordinates 267336 to 266725.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.28024

EMBOSS_001 MaeII | SetI | TaiI PleI CviJI PsiI | | HinfI |MlyI TspEI \ \ \ \ \ \\ \ ATGGCTATTGTTATAAACAAAAGAAACGTGAGAGTCTTGGTAATAACTAATTTACTGCTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGATAACAATATTTGTTTTCTTTGCACTCTCAGAACCATTATTGATTAAATGACGAG / / / / / / / CviJI PsiI | MaeII HinfI PleI TspEI TaiI MlyI SetI M A I V I N K R N V R V L V I T N L L L W L L L * T K E T * E S W * * L I Y C S G Y C Y K Q K K R E S L G N N * F T A H ----:----|----:----|----:----|----:----|----:----|----:----| X A I T I F L L F T L T K T I V L K S S X P * Q * L C F F R S L R P L L * N V A H S N N Y V F S V H S D Q Y Y S I * Q E NheI |MaeI ||BsmI ApoI ||Cac8I TspEI ||| BmtI EcoRI ||| | HindII | HgaI ||| | Hpy166II | |TaqI ||| | | FokI MslI MseI | |AsuII ||| | | | HphI \ \ \ \\ \\\ \ \ \ \ ATTGTTGTGTTTTTTGTGTTAAGGAATTCGAATGCTAGCGTCAACGAAAGTATTACTACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAACACAAAAAACACAATTCCTTAAGCTTACGATCGCAGTTGCTTTCATAATGATGA / / / / / / /// / / / / MslI MseI | | | | ||| Hpy166II | FokI TspDTI | | | | ||| HindII HphI | | | | ||NheI | | | | |MaeI | | | | Cac8I | | | BsmI | | | BmtI | | HgaI | AsuII | TaqI EcoRI TspEI ApoI I V V F F V L R N S N A S V N E S I T T L L C F L C * G I R M L A S T K V L L L C C V F C V K E F E C * R Q R K Y Y Y S ----:----|----:----|----:----|----:----|----:----|----:----| M T T N K T N L F E F A L T L S L I V V * Q Q T K Q T L S N S H * R * R F Y * * N N H K K H * P I R I S A D V F T N S S HphI TspEI | Hpy178III* | | CviRI* TspDTI | | | BssKI |BseGI MaeIII | | | EcoRII || Hpy178III* Tsp45I | | | |HphI || | TfiI | MaeII | | | ||ScrFI || | HinfI | | SetI | | | ||BseBI || | |BccI | | TaiI | | | |||SetI \\ \ \\ \ \ \ \ \ \ \\\\ CACCATCCTGATTCATTGGTGACGTTTGACAATTCAGGAAATGCACCTGGCACTCACCAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTAGGACTAAGTAACCACTGCAAACTGTTAAGTCCTTTACGTGGACCGTGAGTGGTT / / // / // / / / /// / / BseGI | |HinfI | || HphI | | ||| | EcoRII | |TfiI | |MaeII | | ||| | BssKI | BccI | Tsp45I | | ||| BseBI Hpy178III* | MaeIII | | ||| ScrFI TaiI | | ||HphI SetI | | |SetI | | CviRI* | Hpy178III* TspEI H H P D S L V T F D N S G N A P G T H Q T I L I H W * R L T I Q E M H L A L T N P S * F I G D V * Q F R K C T W H S P I ----:----|----:----|----:----|----:----|----:----|----:----| * W G S E N T V N S L E P F A G P V * W E G D Q N M P S T Q C N L F H V Q C E G V M R I * Q H R K V I * S I C R A S V L FatI |CviAII || NlaIII || | Tsp4CI* CviJI MboII \\ \ \ \ \ TCTGTCCATGATACAGTAAATACACAAGATAAGGAAGCCGAAGAAGTTGATAAAAATAGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGACAGGTACTATGTCATTTATGTGTTCTATTCCTTCGGCTTCTTCAACTATTTTTATCA / // / / / | || Tsp4CI* CviJI MboII | |FatI | CviAII NlaIII S V H D T V N T Q D K E A E E V D K N S L S M I Q * I H K I R K P K K L I K I V C P * Y S K Y T R * G S R R S * * K * W ----:----|----:----|----:----|----:----|----:----|----:----| D T W S V T F V C S L S A S S T S L F L I Q G H Y L L Y V L Y P L R L L Q Y F Y R D M I C Y I C L I L F G F F N I F I T SfaNI | BbvI | |ApoI | |TspEI | || HgaI | || | BslFI | || | | AciI | || | | BisI | || | | |BlsI | || | | ||TseI | || | | ||TauI | || | | ||NspBII* MaeIII | || | | |||BisI Tsp45I | || | | |||SfeI* Tsp4CI* | || | | ||||BlsI | FatI | || | | |||||CviRI* | |CviAII | || | | |||||| PstI HphI | || NlaIII \ \\ \ \ \\\\\\ \ \ \ \\ \ GGGGACGCTGAATTTGATGCCGCTGCAGAATACAACAAAATAATGGAACAGTCACCCATG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCTGCGACTTAAACTACGGCGACGTCTTATGTTGTTTTATTACCTTGTCAGTGGGTAC / // //////// / / / // // | || |||||||| SfeI* HphI | || |FatI | || |||||||CviRI* | || CviAII | || |||||||TseI | |NlaIII | || ||||||BisI | Tsp45I | || |||||BlsI | MaeIII | || |||||PstI Tsp4CI* | || ||||NspBII* | || ||||AciI | || |||BisI | || ||BslFI | || ||BlsI | || |TauI | || HgaI | |TspEI | |ApoI | BbvI SfaNI G D A E F D A A A E Y N K I M E Q S P M G T L N L M P L Q N T T K * W N S H P * G R * I * C R C R I Q Q N N G T V T H D ----:----|----:----|----:----|----:----|----:----|----:----| P S A S N S A A A S Y L L I I S C D G M H P R Q I Q H R Q L I C C F L P V T V W P V S F K I G S C F V V F Y H F L * G H MwoI | TseI HindII | CviJI HindIII Hpy166II | |BisI | AluI | TstI BbvI | |BsrI | CviJI | BsaXI | TaqII | ||BlsI MwoI | | SetI | TspEI \ \ \ \\\ \ \ \ \ \ \ ATTGTATTTAGCAAGACTGGCTGCCCATATAGCAAAAAACTGAAAGCTTTGTTGACTAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAACATAAATCGTTCTGACCGACGGGTATATCGTTTTTTGACTTTCGAAACAACTGATTA / / / ///// / / / / /// | | MwoI ||||| MwoI | | | ||BsaXI | BbvI ||||TseI | | | |Hpy166II TaqII |||BisI | | | |HindII ||BlsI | | | TstI |CviJI | | HindIII BsrI | CviJI | AluI SetI I V F S K T G C P Y S K K L K A L L T N L Y L A R L A A H I A K N * K L C * L I C I * Q D W L P I * Q K T E S F V D * F ----:----|----:----|----:----|----:----|----:----|----:----| I T N L L V P Q G Y L L F S F A K N V L S Q I * C S Q S G M Y C F V S L K T S * N Y K A L S A A W I A F F Q F S Q Q S I Csp6I |RsaI BccI ||AflIII | MaeII ||Hpy166II | |BsaXI ||| MaeII | || SetI ||| | SetI | || TaiI ||| | TaiI | || TstI TspEI \\\ \ \ \ \\ \ \ TCGTACACGTTTTCTCCATCTTACTACGTTGTAGAATTGGATAGGCACGAACACACAAAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGCATGTGCAAAAGAGGTAGAATGATGCAACATCTTAACCTATCCGTGCTTGTGTGTTTT / /// / // / / | ||| AflIII || MaeII TspEI | ||| MaeII |BccI | ||TaiI |TaiI | ||SetI |SetI | |Hpy166II BsaXI | |Csp6I TstI | RsaI TspEI S Y T F S P S Y Y V V E L D R H E H T K R T R F L H L T T L * N W I G T N T Q K V H V F S I L L R C R I G * A R T H K R ----:----|----:----|----:----|----:----|----:----|----:----| E Y V N E G D * * T T S N S L C S C V F N T C T K E M K S R Q L I P Y A R V C L R V R K R W R V V N Y F Q I P V F V C F MaeIII Tsp45I AclI | BslFI MaeII | | BsrI | SetI | | TspRI Tsp4CI* | TaiI \ \ \ \ \ \ GAACTACAAGACCAGATTGAAAAAGTCACTGGTAGGAGAACAGTCCCAAACGTTATCATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGATGTTCTGGTCTAACTTTTTCAGTGACCATCCTCTTGTCAGGGTTTGCAATAGTAG / / // / / / | | |BslFI Tsp4CI* | MaeII | | BsrI | AclI | Tsp45I TaiI | MaeIII SetI TspRI E L Q D Q I E K V T G R R T V P N V I I N Y K T R L K K S L V G E Q S Q T L S S T T R P D * K S H W * E N S P K R Y H R ----:----|----:----|----:----|----:----|----:----|----:----| S S C S W I S F T V P L L V T G F T I M L V V L G S Q F L * Q Y S F L G L R * * F * L V L N F F D S T P S C D W V N D D Csp6I |RsaI ||MnlI |||TsoI |||| Hpy178III* |||| | BseMII MlyI |||| | |SetI PleI |||| | |BspCNI DdeI MaeIII MslI | XbaI \\\\ \ \\ \ \ \ \ \ GGTGGTACTTCCAGAGGTGGTTATACTGAGATAGCAGAGTTACATAAAAATGATGAACTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCATGAAGGTCTCCACCAATATGACTCTATCGTCTCAATGTATTTTTACTACTTGAA // //// / / / // |Csp6I |||BspCNI DdeI | MslI |PleI RsaI ||BseMII MaeIII MlyI MnlI |SetI TsoI Hpy178III* G G T S R G G Y T E I A E L H K N D E L V V L P E V V I L R * Q S Y I K M M N F W Y F Q R W L Y * D S R V T * K * * T S ----:----|----:----|----:----|----:----|----:----|----:----| P P V E L P P * V S I A S N C L F S S S R H Y K W L H N Y Q S L L T V Y F H H V T T S G S T T I S L Y C L * M F I I F K Hpy166II | BtgZI | |Tsp4CI* | || AluI | || CviJI MaeI | || | SetI Hpy178III* | || | TspEI | HinfI | || | | BseMII DdeI | | TspDTI BccI | || | | |BspCNI |Hpy188I \ \ \ \ \ \\ \ \ \\ \\ CTAGACTCTTTCAAAAAATGGAGCGATGGGGCGTTTACTGTAAAAGCTAATTCGCAATCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GATCTGAGAAAGTTTTTTACCTCGCTACCCCGCAAATGACATTTTCGATTAAGCGTTAGA // // / / / / / / // / / || |HinfI BccI | | | | | || TspEI Hpy188I || TspDTI | | | | | |BspCNI |XbaI | | | | | BseMII Hpy178III* | | | | CviJI MaeI | | | | AluI | | | SetI | | BtgZI | Tsp4CI* Hpy166II L D S F K K W S D G A F T V K A N S Q S * T L S K N G A M G R L L * K L I R N L R L F Q K M E R W G V Y C K S * F A I * ----:----|----:----|----:----|----:----|----:----|----:----| R S E K L F H L S P A N V T F A L E C D E L S K * F I S R H P T * Q L L * N A I * V R E F F P A I P R K S Y F S I R L R MaeI \ GAGAGTGCCTAG 610 ----:----|-- CTCTCACGGATC / / DdeI MaeI E S A * R V P X E C L X ----:----|-- S L A * Q S H R L T G L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AluI 2 AluBI ApoI 2 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BbvI 2 BseXI,BstV1I,Lsp1109I BccI 3 BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmtI 1 BspOI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 2 BslFI 2 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 2 BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BtgZI 1 Cac8I 1 BstC8I Csp6I 2 CviQI,RsaNI CviAII 2 CviJI 5 CviKI-1 CviRI* 2 HpyCH4V DdeI 2 BstDEI,HpyF3I EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 2 FokI 1 HgaI 2 CseI HindII 2 HincII HindIII 1 HinfI 3 HphI 4 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 1 MaeI 3 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 4 MboII 1 MlyI 2 SchI MnlI 1 MseI 1 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIII 2 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I PleI 2 PpsI PsiI 1 AanI PstI 1 RsaI 2 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 9 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI TaiI 5 TaqI 1 TaqII 1 TauI 1 TfiI 1 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 7 TasI,Tsp509I,Sse9I TspRI 1 TscAI TstI 1 XbaI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmgT120I BplI Bpu10I BsaAI BsaBI BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BsmAI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstKTI BstXI BstZ17I BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HinP1I HpaI HpaII Hpy99I HspAI KasI KpnI Ksp632I* MauBI MboI McrI* MfeI MluI MmeI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NlaIV NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TatI TspGWI TspMI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769