Restriction Map of YBL100C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YBL100C on chromosome II from coordinates 37303 to 36989.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.25081

EMBOSS_001 BccI BsrI BsiI* HphI | CviRI* | MmeI \ \ \ \ \ \ ATGTTGTTCAAACCAAAAACACGAGCAATACCATCACCGACTGCAAGAACTCTACCAGTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACAAGTTTGGTTTTTGTGCTCGTTATGGTAGTGGCTGACGTTCTTGAGATGGTCAA // / / / / |HphI | CviRI* | MmeI BsiI* BccI BsrI M L F K P K T R A I P S P T A R T L P V C C S N Q K H E Q Y H H R L Q E L Y Q F V V Q T K N T S N T I T D C K N S T S F ----:----|----:----|----:----|----:----|----:----|----:----| X N N L G F V R A I G D G V A L V R G T X T T * V L F V L L V M V S Q L F E V L H Q E F W F C S C Y W * R S C S S * W N Hpy99I BccI CviJI Hpy188I MseI | DdeI TspEI HaeIII | MnlI |TspEI | |MnlI MnlI \ \ \ \ \\ \ \\ \ TCGTTCAAATTGGCCTCGTCGGACACACCCTTAATTCTTTCCTCTAAGATGGAGGAAACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAAGTTTAACCGGAGCAGCCTGTGTGGGAATTAAGAAAGGAGATTCTACCTCCTTTGA / / / / / / / // / / | | | | MnlI | TspEI || | MnlI | | | Hpy188I MseI || DdeI | | Hpy99I |MnlI | HaeIII BccI | CviJI TspEI S F K L A S S D T P L I L S S K M E E T R S N W P R R T H P * F F P L R W R K L V Q I G L V G H T L N S F L * D G G N F ----:----|----:----|----:----|----:----|----:----|----:----| E N L N A E D S V G K I R E E L I S S V K T * I P R T P C V R L E K R * S P P F R E F Q G R R V C G * N K G R L H L F S CviJI | FalI | FalI | | TseI | | MwoI | | BspMI | | |BisI | | ||BlsI | | |||TseI | | ||||BisI | | |||||BlsI | | ||||||AciI | | ||||||MwoI FalI | | ||||||NspBII* FalI | | |||||||BisI StyI MboII XcmI | | ||||||||BlsI SecI* | CviJI BstXI | | |||||||||TauI \ \ \ \ \ \ \\\\\\\\\\ TCTGTGGGTTGTGCCTTGGTGGAAGCCAATCTTCTGGTGGAAGCCAAAGCAGCAGCGGCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGACACCCAACACGGAACCACCTTCGGTTAGAAGACCACCTTCGGTTTCGTCGTCGCCGT / / / / / / / / / //////// / FalI | | | | XcmI | | | |||||||| SetI FalI | | | BstXI | | | |||||||BisI | | CviJI | | | |||||||AciI | MboII | | | ||||||BlsI SecI* | | | |||||NspBII* StyI | | | |||||TseI | | | |||||TauI | | | ||||BisI | | | |||BspMI | | | |||BlsI | | | ||MwoI | | | ||TseI | | | |BisI | | | BlsI | | MwoI | CviJI FalI FalI S V G C A L V E A N L L V E A K A A A A L W V V P W W K P I F W W K P K Q Q R Q C G L C L G G S Q S S G G S Q S S S G R ----:----|----:----|----:----|----:----|----:----|----:----| E T P Q A K T S A L R R T S A L A A A A K Q P N H R P P L W D E P P L W L L L P R H T T G Q H F G I K Q H F G F C C R C BbvI | SetI | |MwoI | |BbvI | |BstAPI | || AciI | || |BisI | || ||BlsI | || |||TauI TseI | || |||CviJI |BisI | || |||HaeIII EcoP15I ||BlsI | || ||||StyI | MseI Hpy178III* ||| Csp6I | || ||||SecI* | |TspEI |TaqI ||| |RsaI \ \\ \\\\\ \ \\ \\ \\\ \\ GGTCTTGCGGCCTTGGTAGAGTTAATTAGAGTTCTCGATAGAGAACGAATAGCAGCAGTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGAACGCCGGAACCATCTCAATTAATCTCAAGAGCTATCTCTTGCTTATCGTCGTCAT / / //// / / / / // /// /// | | |||| SecI* | | TspEI |TaqI ||| ||Csp6I | | |||| StyI | MseI Hpy178III* ||| |RsaI | | |||HaeIII EcoP15I ||| MwoI | | |||CviJI ||TseI | | ||BisI |BisI | | ||AciI BlsI | | |BbvI | | |BlsI | | TauI | BbvI BstAPI MwoI G L A A L V E L I R V L D R E R I A A V V L R P W * S * L E F S I E N E * Q Q Y S C G L G R V N * S S R * R T N S S S T ----:----|----:----|----:----|----:----|----:----|----:----| P R A A K T S N I L T R S L S R I A A T L D Q P R P L T L * L E R Y L V F L L L T K R G Q Y L * N S N E I S F S Y C C Y MwoI | BbvI MaeIII | CviJI EcoP15I | Tsp4CI* \ \ \ \ \ CGAGCCAACATTATTATATGTGCGTGTTTTTTTTATTTATTTTGTTACTGTTCTTGCGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCGGTTGTAATAATATACACGCACAAAAAAAATAAATAAAACAATGACAAGAACGCTA / / / / | BbvI EcoP15I Tsp4CI* CviJI MaeIII R A N I I I C A C F F Y L F C Y C S C D E P T L L Y V R V F F I Y F V T V L A I S Q H Y Y M C V F F L F I L L L F L R * ----:----|----:----|----:----|----:----|----:----|----:----| R A L M I I H A H K K * K N Q * Q E Q S V L W C * * I H T N K K N I K N S N K R S G V N N Y T R T K K I * K T V T R A I AluI CviJI | SetI \ \ AGTTATGAGAGCTGA 310 ----:----|----: TCAATACTCTCGACT / / | CviJI | AluI SetI S Y E S * V M R A X L * E L X ----:----|----: L * S L Q Y N H S S T I L A S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AluI 1 AluBI BbvI 3 BseXI,BstV1I,Lsp1109I BccI 2 BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BsiI* 1 BssSI,Bst2BI,BauI BspMI 1 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BstAPI 1 BstXI 1 Csp6I 1 CviQI,RsaNI CviJI 6 CviKI-1 CviRI* 1 HpyCH4V DdeI 1 BstDEI,HpyF3I EcoP15I 2 FalI 2 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HphI 1 AsuHPI Hpy178III* 1 Hpy188III Hpy188I 1 Hpy99I 1 MaeIII 1 MboII 1 MmeI 1 MnlI 3 MseI 2 Tru1I,Tru9I MwoI 4 HpyF10VI,BstMWI NspBII* 1 MspA1I RsaI 1 AfaI SecI* 2 BseDI,BssECI,BsaJI SetI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaqI 1 TauI 2 TseI 3 ApeKI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspEI 3 TasI,Tsp509I,Sse9I XcmI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI CspCI CviAII DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FatI FauI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI HpaII Hpy166II Hpy8I HspAI KasI KpnI Ksp632I* MaeI MaeII MauBI MboI McrI* MfeI MluI MlyI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I SwaI TaiI TaqII TatI TfiI TsoI Tsp45I TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769