Restriction Map of ILS1/YBL076C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

ILS1/YBL076C on chromosome II from coordinates 84261 to 81043.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Hpy188I | MaeIII MnlI XmnI MboII \ \ \ \ \ ATGTCCGAGAGTAACGCACACTTCTCATTTCCAAAGGAGGAAGAAAAAGTTCTATCTCTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGCTCTCATTGCGTGTGAAGAGTAAAGGTTTCCTCCTTCTTTTTCAAGATAGAGAA / / / / / Hpy188I MaeIII MnlI | MboII XmnI M S E S N A H F S F P K E E E K V L S L C P R V T H T S H F Q R R K K K F Y L F V R E * R T L L I S K G G R K S S I S L ----:----|----:----|----:----|----:----|----:----|----:----| X D S L L A C K E N G F S S S F T R D R X T R S Y R V S R M E L P P L F L E I E H G L T V C V E * K W L L F F F N * R K BseGI |TspDTI || FokI BetI* || |TspDTI TspEI |HpaII SfaNI || || TspDTI | MseI || MboII \ \\ \\ \ \ \ \\ \ TGGGATGAAATAGATGCCTTTCATACTTCATTAGAATTAACAAAAGACAAACCGGAGTTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCTACTTTATCTACGGAAAGTATGAAGTAATCTTAATTGTTTTCTGTTTGGCCTCAAA // / / / // /// |TspDTI | | FokI |MseI ||MboII BseGI | TspDTI TspEI |BetI* SfaNI TspDTI HpaII W D E I D A F H T S L E L T K D K P E F G M K * M P F I L H * N * Q K T N R S F G * N R C L S Y F I R I N K R Q T G V F ----:----|----:----|----:----|----:----|----:----|----:----| Q S S I S A K * V E N S N V F S L G S N K P H F L H R E Y K M L I L L L C V P T P I F Y I G K M S * * F * C F V F R L K BccI | TaqI MnlI | | Hin4II* BseRI | | |AsuI* | AgeI | | ||BmgT120I | BetI* BsiYI* | | |||CviJI | Cfr10I | Tsp4CI* | | |||HaeIII | |HpaII | |MnlI | | |||| TstI | || Csp6I | ||BsaXI | | |||| BsaXI | || |RsaI | ||| TstI \ \ \\\\ \ \ \\ \\ \ \\\ \ TCCTTCTTCGATGGGCCTCCATTTGCCACCGGTACTCCTCATTACGGTCATATTCTTGCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAAGAAGCTACCCGGAGGTAAACGGTGGCCATGAGGAGTAATGCCAGTATAAGAACGA / // / // // //// / // BccI || | |AsuI* |MnlI |||Csp6I | |MnlI || | BmgT120I BseRI ||RsaI | Tsp4CI* || | HaeIII |Cfr10I | BsaXI || | CviJI |BetI* | TstI || | BsaXI |AgeI BsiYI* || TstI HpaII |Hin4II* TaqI S F F D G P P F A T G T P H Y G H I L A P S S M G L H L P P V L L I T V I F L L L L R W A S I C H R Y S S L R S Y S C F ----:----|----:----|----:----|----:----|----:----|----:----| E K K S P G G N A V P V G * * P * I R A K R R R H A E M Q W R Y E E N R D Y E Q G E E I P R W K G G T S R M V T M N K S FatI |CviAII || NlaIII || | CviJI || | HaeIII || | | MaeII || | | |AjuI || | | |PmaCI || | | |BsaAI || | | |PflMI || | | |DraIII || | | |BsiYI* || | | || SetI MseI || | | || TaiI \ \\ \ \ \\ \ TCCACTATTAAGGATATTGTTCCAAGATACGCTACCATGACAGGCCACCACGTGGAAAGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTGATAATTCCTATAACAAGGTTCTATGCGATGGTACTGTCCGGTGGTGCACCTTTCT / / // / / // // MseI | |FatI | | || |MaeII | | | | || BsaAI | | | | || PmaCI | | | | |TaiI | | | | |SetI | | | | BsiYI* | | | | DraIII | | | | PflMI | | | AjuI | | HaeIII | | CviJI | CviAII NlaIII S T I K D I V P R Y A T M T G H H V E R P L L R I L F Q D T L P * Q A T T W K E H Y * G Y C S K I R Y H D R P P R G K K ----:----|----:----|----:----|----:----|----:----|----:----| E V I L S I T G L Y A V M V P W W T S L K W * * P Y Q E L I R * W S L G G R P F G S N L I N N W S V S G H C A V V H F S TfiI DraIII HinfI Tsp4CI* | BciVI | MfeI | | MboII |AjuI TspEI TspEI SetI \ \ \ \\ \ \ \ AGATTCGGTTGGGATACACACGGTGTTCCAATTGAACATATCATTGACAAGAAATTAGGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAAGCCAACCCTATGTGTGCCACAAGGTTAACTTGTATAGTAACTGTTCTTTAATCCA / / // / / / | MboII || Tsp4CI* TspEI TspEI HinfI |DraIII MfeI SetI BciVI AjuI TfiI R F G W D T H G V P I E H I I D K K L G D S V G I H T V F Q L N I S L T R N * V I R L G Y T R C S N * T Y H * Q E I R Y ----:----|----:----|----:----|----:----|----:----|----:----| L N P Q S V C P T G I S C I M S L F N P F I R N P Y V R H E L Q V Y * Q C S I L S E T P I C V T N W N F M D N V L F * T MboII BbvII* | AcyI | MaeII | |ZraI BinI* | || SetI | MboI | || TaiI Hpy178III* | XhoII | || AatII | Hin4I | | DpnI \ \\ \ \ \ \ \ \ ATCACGGGTAAAGATGACGTCTTCAAGTATGGTCTTGAAAACTACAACAATGAGTGTAGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGCCCATTTCTACTGCAGAAGTTCATACCAGAACTTTTGATGTTGTTACTCACATCT / / // / / / // | | |MaeII | Hin4I | |DpnI | | |AcyI Hpy178III* | BstKTI | | ZraI BinI* | BbvII* | AatII | TaiI | SetI MboII I T G K D D V F K Y G L E N Y N N E C R S R V K M T S S S M V L K T T T M S V D H G * R * R L Q V W S * K L Q Q * V * I ----:----|----:----|----:----|----:----|----:----|----:----| I V P L S S T K L Y P R S F * L L S H L Y * P Y L H R R * T H D Q F S C C H T Y D R T F I V D E L I T K F V V V I L T S PflMI BstKTI Hin4I BsiYI* | MslI | BsrI |TspRI MmeI \ \ \ \ \\ \ TCCATTGTTATGACTTATGCCAGTGATTGGAGAAAAACTATTGGTCGTTTGGGTCGTTGG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAACAATACTGAATACGGTCACTAACCTCTTTTTGATAACCAGCAAACCCAGCAACC / / / / / / | | Hin4I | BsiYI* MmeI | MslI | PflMI XhoII TspRI MboI BsrI S I V M T Y A S D W R K T I G R L G R W P L L * L M P V I G E K L L V V W V V G H C Y D L C Q * L E K N Y W S F G S L D ----:----|----:----|----:----|----:----|----:----|----:----| D M T I V * A L S Q L F V I P R K P R Q I W Q * S K H W H N S F F * Q D N P D N G N N H S I G T I P S F S N T T Q T T P BciVI |BccI || HinfI || |Hin4I || |Hin4I || || Hpy166II || || | FatI || || | |CviAII || || | ||PleI || || | |||MlyI || || | ||||PflMI || || | ||||NlaIII Hin4I || || | ||||DraIII TaqI Hin4I FokI BseGI || || | ||||BsiYI* \ \ \ \ \\ \\ \ \\\\\ ATTGATTTCGACAACGATTACAAGACTATGTATCCATCCTTTATGGAGTCCACATGGTGG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTAAAGCTGTTGCTAATGTTCTGATACATAGGTAGGAAATACCTCAGGTGTACCACC / / / / // // // // Hin4I FokI BseGI | |BccI || || |FatI Hin4I | Hin4I || || CviAII TaqI | Hin4I || || PleI BciVI || || MlyI || |BsiYI* || |DraIII || |PflMI || NlaIII |Hpy166II HinfI I D F D N D Y K T M Y P S F M E S T W W L I S T T I T R L C I H P L W S P H G G * F R Q R L Q D Y V S I L Y G V H M V G ----:----|----:----|----:----|----:----|----:----|----:----| I S K S L S * L V I Y G D K I S D V H H S Q N R C R N C S * T D M R * P T W M T N I E V V I V L S H I W G K H L G C P P TspDTI |Hpy166II || SecI* || DsaI* FatI || |Tsp4CI* CviJI BspHI || || TfiI | TspDTI |CviAII || || BdaI | | BdaI |Hpy178III* || || BdaI | | BdaI || NlaIII SetI || || HinfI \ \ \ \\ \ \ \\ \\ \ GCTTTCAAGCAACTTCATGAAAAAGGTCAAGTTTACCGTGGATTCAAAGTTATGCCTTAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAAGTTCGTTGAAGTACTTTTTCCAGTTCAAATGGCACCTAAGTTTCAATACGGAATA // / / // / / / / // / || BdaI | || SetI | | | || HinfI || BdaI | |BspHI | | | || TfiI |TspDTI | |FatI | | | |DsaI* CviJI | Hpy178III* | | | |SecI* | CviAII | | | BdaI NlaIII | | | BdaI | | Tsp4CI* | Hpy166II TspDTI A F K Q L H E K G Q V Y R G F K V M P Y L S S N F M K K V K F T V D S K L C L I F Q A T S * K R S S L P W I Q S Y A L F ----:----|----:----|----:----|----:----|----:----|----:----| A K L C S * S F P * T * R P N L T I G * P K * A V E H F L D L K G H I * L * A K S E L L K M F F T L N V T S E F N H R I AluI CviJI |DdeI MseI CviJI SmlI |EspI* |HpaI HaeIII | MaeIII ||SetI BspCNI |HindII |BsrI | | TsoI ||| Bce83I* |BseMII |Hpy166II \\ \ \ \ \\\ \ \\ \\ TCTACTGGCCTAACCACTCCCTTGAGTAACTTTGAAGCTCAGCAAAACTATAAAGATGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGACCGGATTGGTGAGGGAACTCATTGAAACTTCGAGTCGTTTTGATATTTCTACAA // / / / / // // / |HaeIII TsoI | | | |EspI* |BseMII Hpy166II |CviJI SmlI | | | |DdeI BspCNI HindII BsrI | | | Bce83I* HpaI | | CviJI | | AluI | SetI MaeIII S T G L T T P L S N F E A Q Q N Y K D V L L A * P L P * V T L K L S K T I K M L Y W P N H S L E * L * S S A K L * R C * ----:----|----:----|----:----|----:----|----:----|----:----| E V P R V V G K L L K S A * C F * L S T N * Q G L W E R S Y S Q L E A F S Y L H R S A * G S G Q T V K F S L L V I F I N BseYI | AluI CfrI | GsaI | BalI | CviJI | BssKI | PvuII | CviJI | NspBII* | EcoRII MfeI | | SetI | HaeIII TspEI | | MaeIII | | ScrFI | BsaXI | | Tsp45I | | BseBI | Hin4I \ \ \ \ \ \ \ \ AACGACCCAGCTGTGACCATTGGTTTCAATGTTATTGGCCAGGAAAAAACTCAATTGGTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTGGGTCGACACTGGTAACCAAAGTTACAATAACCGGTCCTTTTTTGAGTTAACCAG / / / / / / // / / / / MseI | | | Tsp45I | || EcoRII | | TspEI | | | MaeIII | || BssKI | | MfeI | | NspBII* | |BseBI | BsaXI | | BseYI | |ScrFI Hin4I | | PvuII | CfrI | | CviJI HaeIII | | AluI CviJI | SetI BalI GsaI N D P A V T I G F N V I G Q E K T Q L V T T Q L * P L V S M L L A R K K L N W S R P S C D H W F Q C Y W P G K N S I G R ----:----|----:----|----:----|----:----|----:----|----:----| L S G A T V M P K L T I P W S F V * N T * R G L Q S W Q N * H * Q G P F F E I P V V W S H G N T E I N N A L F F S L Q D HinfI | FatI | NcoI FatI | StyI BsaXI |CviAII | SecI* | Hin4I MseI || NlaIII | DsaI* | |SetI |HpaI || |MlyI | |CviAII | || TspEI |HindII || |PleI | || NlaIII | || | Hin4II* |Hpy166II \\ \\ \ \\ \ \ \\ \ \ \\ GCATGGACTACGACTCCATGGACTTTACCTTCCAATTTGTCGTTATGTGTTAACGCTGAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGTACCTGATGCTGAGGTACCTGAAATGGAAGGTTAAACAGCAATACACAATTGCGACTA / //// // // / / / // | |||PleI || || | SetI Hin4II* |MseI | ||MlyI || || Hin4I TspEI Hpy166II | |FatI || || BsaXI HindII | CviAII || |DsaI* HpaI NlaIII || |SecI* || |StyI || |NcoI || |FatI || CviAII |NlaIII HinfI A W T T T P W T L P S N L S L C V N A D H G L R L H G L Y L P I C R Y V L T L I M D Y D S M D F T F Q F V V M C * R * F ----:----|----:----|----:----|----:----|----:----|----:----| A H V V V G H V K G E L K D N H T L A S R M S * S E M S K V K W N T T I H * R Q C P S R S W P S * R G I Q R * T N V S I MboI TspDTI TaqI | DpnI TfiI AsuII Hpy99I | |BstKTI HinfI \ \ \ \\ \ TTCGAATATGTAAAGATTTACGACGAAACCAGAGATCGTTATTTCATCTTATTAGAATCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTTATACATTTCTAAATGCTGCTTTGGTCTCTAGCAATAAAGTAGAATAATCTTAGA / / / // / / AsuII Hpy99I | || MboI HinfI TaqI | |DpnI TfiI | BstKTI TspDTI F E Y V K I Y D E T R D R Y F I L L E S S N M * R F T T K P E I V I S S Y * N L R I C K D L R R N Q R S L F H L I R I F ----:----|----:----|----:----|----:----|----:----|----:----| K S Y T F I * S S V L S R * K M K N S D N R I H L S K R R F W L D N N * R I L I E F I Y L N V V F G S I T I E D * * F R CviJI TspEI MseI SetI | DdeI TspDTI | MseI \ \ \ \ \ \ \ TTGATTAAAACCTTGTATAAGAAGCCTAAGAATGAAAAATATAAGATTGTGGAAAAAATT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAATTTTGGAACATATTCTTCGGATTCTTACTTTTTATATTCTAACACCTTTTTTAA / / / / / / | SetI | DdeI TspDTI TspEI MseI CviJI L I K T L Y K K P K N E K Y K I V E K I * L K P C I R S L R M K N I R L W K K L D * N L V * E A * E * K I * D C G K N * ----:----|----:----|----:----|----:----|----:----|----:----| K I L V K Y L F G L F S F Y L I T S F I K S * F R T Y S A * S H F I Y S Q P F F Q N F G Q I L L R L I F F I L N H F F N SetI AloI | Hpy188I AloI TspDTI | Tsp4CI* \ \ \ \ \ \ AAAGGTTCTGATTTGGTTGGTTTGAAGTATGAACCATTGTTCCCATATTTCGCTGAACAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCAAGACTAAACCAACCAAACTTCATACTTGGTAACAAGGGTATAAAGCGACTTGTC // / / / / / |SetI Hpy188I AloI TspDTI AloI Tsp4CI* MseI K G S D L V G L K Y E P L F P Y F A E Q K V L I W L V * S M N H C S H I S L N S R F * F G W F E V * T I V P I F R * T V ----:----|----:----|----:----|----:----|----:----|----:----| L P E S K T P K F Y S G N N G Y K A S C * L N Q N P Q N S T H V M T G M N R Q V F T R I Q N T Q L I F W Q E W I E S F L TfiI FatI HinfI |CviAII | BetI* || NlaIII | |HpaII || | AluI MaeIII | || Csp6I || | CviJI | SpeI | || |RsaI || | | SetI TspDTI Hpy188I | |MaeI | || ||TspDTI \\ \ \ \ \ \ \ \\ \ \\ \\\ TTCCATGAAACAGCTTTTAGAGTTATTTCAGATGATTATGTTACTAGTGATTCCGGTACT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTACTTTGTCGAAAATCTCAATAAAGTCTACTAATACAATGATCACTAAGGCCATGA / // / / / / / // / //// | || | | TspDTI Hpy188I | |SpeI | |||Csp6I | || | CviJI | MaeI | ||RsaI | || | AluI MaeIII | |TspDTI | || SetI | |BetI* | |FatI | HpaII | CviAII HinfI NlaIII TfiI F H E T A F R V I S D D Y V T S D S G T S M K Q L L E L F Q M I M L L V I P V L P * N S F * S Y F R * L C Y * * F R Y W ----:----|----:----|----:----|----:----|----:----|----:----| N W S V A K L T I E S S * T V L S E P V T G H F L K * L * K L H N H * * H N R Y E M F C S K S N N * I I I N S T I G T S BsiYI* HphI |Ksp632I* | TseI ||MnlI | MboII ||FauI | |BisI BsrI AciI ||| BbvI | ||BlsI HgaI \ \ \\\ \ \ \\\ \ GGTATTGTTCATAACGCTCCCGCTTTCGGTGAAGAGGATAATGCTGCTTGTTTGAAGAAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACAAGTATTGCGAGGGCGAAAGCCACTTCTCCTATTACGACGAACAAACTTCTTG / / / / / / / /// / BsrI | | | BbvI | | ||TseI HgaI | | Ksp632I* | | |BisI | | FauI | | BlsI | MnlI | MboII BsiYI* HphI AciI G I V H N A P A F G E E D N A A C L K N V L F I T L P L S V K R I M L L V * R T Y C S * R S R F R * R G * C C L F E E R ----:----|----:----|----:----|----:----|----:----|----:----| P I T * L A G A K P S S S L A A Q K F F Q Y Q E Y R E R K R H L P Y H Q K N S S T N N M V S G S E T F L I I S S T Q L V Hpy188I MaeIII | BceAI | MboII StyI TfiI AcyI | |TfiI | |TspRI SecI* HinfI | MboII | |HinfI | || SetI | SetI | Hpy178III* \ \ \ \\ \ \\ \ \ \ \ \ GGCGTCATATCCGAAGATTCAGTGTTACCTAACGCCATTGATGACCTTGGTAGATTCACG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCAGTATAGGCTTCTAAGTCACAATGGATTGCGGTAACTACTGGAACCATCTAAGTGC // / / / / / / / / / / |MboII | | | | | MaeIII SetI SecI* | Hpy178III* AcyI | | | | SetI StyI HinfI | | | MboII TfiI | | HinfI | | TfiI | BceAI | TspRI Hpy188I G V I S E D S V L P N A I D D L G R F T A S Y P K I Q C Y L T P L M T L V D S R R H I R R F S V T * R H * * P W * I H E ----:----|----:----|----:----|----:----|----:----|----:----| P T M D S S E T N G L A M S S R P L N V R R * I R L N L T V * R W Q H G Q Y I * A D Y G F I * H * R V G N I V K T S E R MaeII | SetI | TaiI MseI | | Hpy178III* | TatI | | | MnlI HgaI | |Csp6I \ \ \ \ \ \ \\ AAAGACGTTCCTGATTTTGAGGGTGTTTATGTCAAGGACGCTGATAAGTTGATTATTAAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTGCAAGGACTAAAACTCCCACAAATACAGTTCCTGCGACTATTCAACTAATAATTC / / // / / | | |Hpy178III* HgaI MseI | | MnlI | MaeII TaiI SetI K D V P D F E G V Y V K D A D K L I I K K T F L I L R V F M S R T L I S * L L S R R S * F * G C L C Q G R * * V D Y * V ----:----|----:----|----:----|----:----|----:----|----:----| F S T G S K S P T * T L S A S L N I I L S L R E Q N Q P H K H * P R Q Y T S * * F V N R I K L T N I D L V S I L Q N N L FokI ApoI RsaI ApoI TspEI ScaI BsrI | SfaNI | MseI TspEI BseGI | | MmeI \ \ \ \ \ \ \ TACTTAACTAATACTGGAAATTTGTTATTGGCATCCCAAATTCGCCATTCCTATCCATTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAATTGATTATGACCTTTAAACAATAACCGTAGGGTTTAAGCGGTAAGGATAGGTAAG /// / / / / // / / ||| MseI BsrI TspEI BseGI || SfaNI BstXI ||TatI ApoI |TspEI |Csp6I FokI |ApoI ScaI MmeI RsaI Y L T N T G N L L L A S Q I R H S Y P F T * L I L E I C Y W H P K F A I P I H S L N * Y W K F V I G I P N S P F L S I L ----:----|----:----|----:----|----:----|----:----|----:----| Y K V L V P F K N N A D W I R W E * G N T S L * Y Q F N T I P M G F E G N R D M V * S I S S I Q * Q C G L N A M G I W E BinI* BstXI | MboI | XhoII | | DpnI AluI | | |BstKTI CviJI BslFI | | || Hpy188I Tsp4CI* | SetI | MseI \ \ \\ \ \ \ \ \ \ TGTTGGAGATCCGATACCCCATTGTTATACCGTTCTGTTCCAGCTTGGTTCGTTCGTGTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ACAACCTCTAGGCTATGGGGTAACAATATGGCAAGACAAGGTCGAACCAAGCAAGCACAA / // / / / / // | || Hpy188I Tsp4CI* | CviJI |MmeI | || XhoII | AluI BslFI | || MboI SetI | |DpnI | BstKTI BinI* C W R S D T P L L Y R S V P A W F V R V V G D P I P H C Y T V L F Q L G S F V L L E I R Y P I V I P F C S S L V R S C * ----:----|----:----|----:----|----:----|----:----|----:----| Q Q L D S V G N N Y R E T G A Q N T R T R N S I R Y G M T I G N Q E L K T R E H T P S G I G W Q * V T R N W S P E N T N BsrI TspRI TspDTI MnlI |NlaIV |Hin4I || BfiI ||TfiI || | Hin4I MmeI ||HinfI || | | AloI \ \\\ \\ \ \ \ AAAAACATTGTCCCTCAAATGTTGGATTCTGTGATGAAATCTCACTGGGTTCCTAACACC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGTAACAGGGAGTTTACAACCTAAGACACTACTTTAGAGTGACCCAAGGATTGTGG / / / / / / // / MseI | MnlI HinfI TspRI | || BfiI Hin4I TfiI | || AloI | |Hin4I | NlaIV TspDTI BsrI K N I V P Q M L D S V M K S H W V P N T K T L S L K C W I L * * N L T G F L T P K H C P S N V G F C D E I S L G S * H H ----:----|----:----|----:----|----:----|----:----|----:----| L F M T G * I N S E T I F D * Q T G L V * F C Q G E F T P N Q S S I E S P E * C F V N D R L H Q I R H H F R V P N R V G MaeIII Tsp45I | BsiYI* | | BsrI MboI | | |AclI | DpnI | | |MaeII | BsrI | | ||AjuI | |BstKTI | | ||| SetI MnlI | ||AloI | | ||| TaiI | BccI SetI | ||| BinI* | | ||| | Hpy178III* \ \ \ \ \\\ \ \ \ \\\ \ \ ATCAAGGAAAAGAGGTTCGCCAACTGGATCGCCAATGCCCGTGACTGGAACGTTTCCAGA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTCCTTTTCTCCAAGCGGTTGACCTAGCGGTTACGGGCACTGACCTTGCAAAGGTCT / / / //// / / / /// / / / | | SetI |||| MboI BinI* | ||| | MaeII Hpy178III* | BccI |||DpnI | ||| | AclI MnlI ||BstKTI | ||| TaiI |BsrI | ||| SetI AloI | ||BsrI | |AjuI | Tsp45I | MaeIII BsiYI* I K E K R F A N W I A N A R D W N V S R S R K R G S P T G S P M P V T G T F P E Q G K E V R Q L D R Q C P * L E R F Q K ----:----|----:----|----:----|----:----|----:----|----:----| M L S F L N A L Q I A L A R S Q F T E L W * P F S T R W S S R W H G H S S R K W D L F L P E G V P D G I G T V P V N G S TspEI Hpy188I Csp6I | AjuI | MnlI |RsaI | | XcmI | | MnlI SetI \\ \ \ \ \ \ \ \ AATAGATATTGGGGTACTCCAATTCCTTTATGGGTTTCAGACGATTTTGAGGAGGTCGTC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTATAACCCCATGAGGTTAAGGAAATACCCAAAGTCTGCTAAAACTCCTCCAGCAG // / // / / / / || AjuI |XcmI | | MnlI SetI |Csp6I TspEI | MnlI RsaI Hpy188I N R Y W G T P I P L W V S D D F E E V V I D I G V L Q F L Y G F Q T I L R R S S * I L G Y S N S F M G F R R F * G G R L ----:----|----:----|----:----|----:----|----:----|----:----| F L Y Q P V G I G K H T E S S K S S T T F Y I N P Y E L E K I P K L R N Q P P R I S I P T S W N R * P N * V I K L L D D AgeI BetI* Cfr10I |HpaII TspRI BseRI TspEI TspEI || MboII MaeIII | CviRI* \ \ \ \\ \ \ \ \ TGTGTTGGTTCTATCAAAGAATTGGAAGAATTGACCGGTGTGCGTAACATCACTGACTTG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| ACACAACCAAGATAGTTTCTTAACCTTCTTAACTGGCCACACGCATTGTAGTGACTGAAC / / / /// / / BseRI TspEI | ||Cfr10I MaeIII CviRI* | ||BetI* TspRI | ||AgeI | |HpaII | MboII TspEI C V G S I K E L E E L T G V R N I T D L V L V L S K N W K N * P V C V T S L T C C W F Y Q R I G R I D R C A * H H * L A ----:----|----:----|----:----|----:----|----:----|----:----| Q T P E I L S N S S N V P T R L M V S K R H Q N * * L I P L I S R H A Y C * Q S T N T R D F F Q F F Q G T H T V D S V Q SetI Hpy178III* FalI | MaeIII |MslI FokI TspEI FalI | Tsp45I || SfaNI |TspEI | BseGI | BccI | | MseI \\ \ \\ \ \ \ \ \ \ \ CATCGTGATGTCATTGACAAATTGACAATTCCATCCAAGCAAGGTAAGGGTGACTTAAAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGCACTACAGTAACTGTTTAACTGTTAAGGTAGGTTCGTTCCATTCCCACTGAATTTC // / // // / // / / / || SfaNI |TspEI || FalI |SetI | | HphI |Hpy178III* FokI || FalI BccI | MseI MslI |TspEI Tsp45I BseGI MaeIII H R D V I D K L T I P S K Q G K G D L K I V M S L T N * Q F H P S K V R V T * R S * C H * Q I D N S I Q A R * G * L K E ----:----|----:----|----:----|----:----|----:----|----:----| C R S T M S L N V I G D L C P L P S K F A D H H * Q C I S L E M W A L Y P H S L M T I D N V F Q C N W G L L T L T V * L HphI FalI TfiI |TspEI FalI MboII HinfI \\ \ \ \ AGAATTGAAGAAGTTTTTGATTGTTGGTTTGAATCTGGTTCTATGCCTTATGCTTCTCAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAACTTCTTCAAAAACTAACAACCAAACTTAGACCAAGATACGGAATACGAAGAGTT / / / / | TspEI MboII HinfI FalI TfiI FalI R I E E V F D C W F E S G S M P Y A S Q E L K K F L I V G L N L V L C L M L L N N * R S F * L L V * I W F Y A L C F S T ----:----|----:----|----:----|----:----|----:----|----:----| L I S S T K S Q Q N S D P E I G * A E * S F Q L L K Q N N T Q I Q N * A K H K E S N F F N K I T P K F R T R H R I S R L XmnI | TspDTI | | AluI | | CviJI ApoI | | | SetI Hin4II* TspEI | | | TspEI | Hpy188I \ \ \ \ \ \ \ CATTATCCATTTGAAAACACAGAAAAATTTGACGAAAGAGTTCCAGCTAATTTCATCTCT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GTAATAGGTAAACTTTTGTGTCTTTTTAAACTGCTTTCTCAAGGTCGATTAAAGTAGAGA / / / / / / / / TspEI | | | CviJI | | Hpy188I ApoI | | | AluI | Hin4II* | | SetI TspEI | TspDTI XmnI H Y P F E N T E K F D E R V P A N F I S I I H L K T Q K N L T K E F Q L I S S L L S I * K H R K I * R K S S S * F H L * ----:----|----:----|----:----|----:----|----:----|----:----| C * G N S F V S F N S S L T G A L K M E V N D M Q F C L F I Q R F L E L * N * R M I W K F V C F F K V F S N W S I E D R AflIII | MaeII | | SetI | | TaiI | | | AluI | | | CviJI SetI | | | | SetI | MboI | | | | | DdeI | | DpnI | | | | | | Acc65I | | |BstKTI | | | | | | HgiCI* | | ||MnlI | | | | | | |Csp6I | | ||| BinI* | | | | | | ||RsaI | | ||| | Eco57I | | | | | | ||SetI | | ||| | Eco57MI | | | | | | ||NlaIV | | ||| | | SetI | | | | | | ||| KpnI \ \ \\\ \ \ \ \ \ \ \ \ \ \\\ \ GAAGGTTTGGATCAAACAAGAGGTTGGTTCTACACGTTAGCTGTCTTAGGTACCCATCTA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCAAACCTAGTTTGTTCTCCAACCAAGATGTGCAATCGACAGAATCCATGGGTAGAT / //// / / / / / / /// /// / SetI |||MboI | SetI | | | CviJI ||| ||| BstXI ||MnlI Eco57MI | | | AluI ||| ||HgiCI* |DpnI Eco57I | | SetI ||| ||Acc65I BstKTI BinI* | AflIII ||| |Csp6I | MaeII ||| NlaIV TaiI ||| RsaI SetI ||KpnI |DdeI SetI E G L D Q T R G W F Y T L A V L G T H L K V W I K Q E V G S T R * L S * V P I Y R F G S N K R L V L H V S C L R Y P S I ----:----|----:----|----:----|----:----|----:----|----:----| S P K S * V L P Q N * V N A T K P V W R Q L N P D F L L N T R C T L Q R L Y G D F T Q I L C S T P E V R * S D * T G M * DdeI | BccI | TseI | AluI | CviJI BstXI MaeII BbvI | |BisI |BccI | SetI BsmAI | ||BlsI || CviJI | TaiI Esp3I | ||SetI \\ \ \ \ \ \ \\\ TTTGGCTCTGTTCCATACAAGAACGTCATCGTCTCTGGTATTGTCTTAGCTGCCGATGGT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCGAGACAAGGTATGTTCTTGCAGTAGCAGAGACCATAACAGAATCGACGGCTACCA / / / / / ////// | CviJI | MaeII Esp3I |||||TseI BccI TaiI BsmAI ||||BisI SetI BbvI |||BlsI |||BccI ||CviJI ||AluI |DdeI SetI F G S V P Y K N V I V S G I V L A A D G L A L F H T R T S S S L V L S * L P M V W L C S I Q E R H R L W Y C L S C R W * ----:----|----:----|----:----|----:----|----:----|----:----| N P E T G Y L F T M T E P I T K A A S P I Q S Q E M C S R * R R Q Y Q R L Q R H K A R N W V L V D D D R T N D * S G I T FokI TspEI | BinI* | | MboI | | | DpnI | | | |BstKTI Hpy188I | | | ||BseGI BccI | SfaNI \ \ \ \\\ \ \ \ AGAAAGATGTCTAAATCCTTGAAAAATTACCCTGATCCATCCATTGTTCTGAACAAATAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTCTACAGATTTAGGAACTTTTTAATGGGACTAGGTAGGTAACAAGACTTGTTTATA // // / / / || || MboI | Hpy188I || |BseGI BccI || |DpnI || BstKTI |BinI* TspEI FokI R K M S K S L K N Y P D P S I V L N K Y E R C L N P * K I T L I H P L F * T N M K D V * I L E K L P * S I H C S E Q I W ----:----|----:----|----:----|----:----|----:----|----:----| L F I D L D K F F * G S G D M T R F L Y Y F S T * I R S F N G Q D M W Q E S C I S L H R F G Q F I V R I W G N N Q V F I CviRI* | BseGI | EcoT22I SetI | | FokI | MseI | | |TatI | |AhaIII* | | ||Csp6I | || AluI | | |||RsaI | || CviJI AciI | |MseI |||| HphI | || | SetI \ \ \\ \\\\ \ \ \\ \ \ GGTGCGGATGCATTAAGATTGTACTTGATAAACTCACCTGTTTTAAAAGCTGAAAGTTTG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGCCTACGTAATTCTAACATGAACTATTTGAGTGGACAAAATTTTCGACTTTCAAAC / / / / / //// / // / / | | | | MseI |||HphI SetI || | CviJI | | | CviRI* ||TatI || | AluI | | | BseGI |Csp6I || SetI | | EcoT22I |FokI |MseI | AciI RsaI AhaIII* SfaNI G A D A L R L Y L I N S P V L K A E S L V R M H * D C T * * T H L F * K L K V * C G C I K I V L D K L T C F K S * K F E ----:----|----:----|----:----|----:----|----:----|----:----| P A S A N L N Y K I F E G T K F A S L K H H P H M L I T S S L S V Q K L L Q F N T R I C * S Q V Q Y V * R N * F S F T Q FatI NcoI StyI ApoI SecI* TspEI MnlI DsaI* | Ksp632I* | MseI |CviAII | |MnlI | | MboII SetI SetI || NlaIII \ \\ \ \ \ \ \ \\ \ AAATTCAAAGAAGAGGGTGTTAAGGAGGTTGTTTCAAAGGTCTTACTACCATGGTGGAAC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAGTTTCTTCTCCCACAATTCCTCCAACAAAGTTTCCAGAATGATGGTACCACCTTG / / / // / / / // | Ksp632I* | || SetI SetI | |DsaI* TspEI | |MseI | |SecI* ApoI | MboII | |StyI MnlI MnlI | |NcoI | |FatI | CviAII NlaIII K F K E E G V K E V V S K V L L P W W N N S K K R V L R R L F Q R S Y Y H G G T I Q R R G C * G G C F K G L T T M V E L ----:----|----:----|----:----|----:----|----:----|----:----| F N L S S P T L S T T E F T K S G H H F S I * L L P H * P P Q K L P R V V M T S F E F F L T N L L N N * L D * * W P P V MseI |AhaIII* ||ApoI Tsp4CI* ||TspEI | TspEI TaqI \\\ \ \ \ TCCTTTAAATTTTTGGACGGTCAAATTGCCTTGTTGAAAAAGATGTCTAACATCGACTTC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAAATTTAAAAACCTGCCAGTTTAACGGAACAACTTTTTCTACAGATTGTAGCTGAAG // / / / / || TspEI Tsp4CI* TspEI TaqI || ApoI |MseI AhaIII* S F K F L D G Q I A L L K K M S N I D F P L N F W T V K L P C * K R C L T S T S L * I F G R S N C L V E K D V * H R L P ----:----|----:----|----:----|----:----|----:----|----:----| E K L N K S P * I A K N F F I D L M S K S R * I K P R D F Q R T S F S T * C R S G K F K Q V T L N G Q Q F L H R V D V E FatI |CviAII AluI TfiI || BccI CviJI HinfI || |NlaIII | SetI CviRI* \ \\ \\ \ \ \ CAATATGATGATTCTGTGAAAAGTGATAATGTCATGGACAGATGGATTTTAGCTTCTATG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATACTACTAAGACACTTTTCACTATTACAGTACCTGTCTACCTAAAATCGAAGATAC / / // / / / HinfI | |FatI | CviJI CviRI* TfiI | |BccI | AluI | CviAII SetI NlaIII Q Y D D S V K S D N V M D R W I L A S M N M M I L * K V I M S W T D G F * L L C I * * F C E K * * C H G Q M D F S F Y A ----:----|----:----|----:----|----:----|----:----|----:----| W Y S S E T F L S L T M S L H I K A E I G I H H N Q S F H Y H * P C I S K L K * L I I I R H F T I I D H V S P N * S R H TspDTI MboII |MaeI |TatI || TatI ||Csp6I || |Csp6I |||RsaI || ||RsaI |||| TstI Tsp4CI* || ||| TspEI Hpy178III* |||| |TspEI | TspRI \\ \\\ \ \ \\\\ \\ \ \ CAATCTCTAGTACAATTCATTCACGAAGAAATGGGTCAGTACAAATTATACACTGTCGTT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGAGATCATGTTAAGTAAGTGCTTCTTTACCCAGTCATGTTTAATATGTGACAGCAA / / /// / / // /// // / | | ||| TspEI Hpy178III* || ||TatI || Tsp4CI* | | ||TatI || |Csp6I |TspRI | | |Csp6I || RsaI TspEI | | RsaI |TstI | MaeI MboII TspDTI Q S L V Q F I H E E M G Q Y K L Y T V V N L * Y N S F T K K W V S T N Y T L S F I S S T I H S R R N G S V Q I I H C R S ----:----|----:----|----:----|----:----|----:----|----:----| C D R T C N M * S S I P * Y L N Y V T T A I E L V I * E R L F P D T C I I C Q R L R * Y L E N V F F H T L V F * V S D N TspDTI | ApoI | TspEI TspDTI Hpy99I | | TstI TspEI | BsrI MseI |Hin4II* \ \ \ \ \ \ \ \\ CCAAAACTTTTGAATTTCATTGATGAATTGACAAACTGGTATATTAGATTTAATCGTCGT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTTGAAAACTTAAAGTAACTACTTAACTGTTTGACCATATAATCTAAATTAGCAGCA / / / / / / / / / / | TstI TspEI TspEI | BsrI | | | Hin4II* TspDTI ApoI TspDTI | | Hpy99I | Hpy99I MseI P K L L N F I D E L T N W Y I R F N R R Q N F * I S L M N * Q T G I L D L I V V K T F E F H * * I D K L V Y * I * S S S ----:----|----:----|----:----|----:----|----:----|----:----| G F S K F K M S S N V F Q Y I L N L R R E L V K S N * Q H I S L S T Y * I * D D W F K Q I E N I F Q C V P I N S K I T T MseI MnlI | ApoI |Tsp4CI* | TspEI Hpy99I || HphI Tsp4CI* | | SfaNI TaqI \ \\ \ \ \ \ \ \ CGTTTGAAGGGTGAAAACGGTGTTGAGGACTGTTTGAAAGCATTAAATTCTTTATTCGAT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAACTTCCCACTTTTGCCACAACTCCTGACAAACTTTCGTAATTTAAGAAATAAGCTA // / / / / / / || HphI Tsp4CI* | | SfaNI TaqI |Tsp4CI* | TspEI MnlI | ApoI MseI R L K G E N G V E D C L K A L N S L F D V * R V K T V L R T V * K H * I L Y S M F E G * K R C * G L F E S I K F F I R C ----:----|----:----|----:----|----:----|----:----|----:----| R K F P S F P T S S Q K F A N F E K N S D N S P H F R H Q P S N S L M L N K I R T Q L T F V T N L V T Q F C * I R * E I FatI NcoI StyI SecI* DsaI* |CviAII |BsiYI* || HphI || NlaIII || |CviJI TspGWI || ||NlaIV Hpy188I BsmAI \ \\ \\\ \ \ GCCTTATTCACATTTGTCCGTGCCATGGCTCCATTCACCCCATTTTTGTCAGAAAGCATT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAATAAGTGTAAACAGGCACGGTACCGAGGTAAGTGGGGTAAAAACAGTCTTTCGTAA / / / //// / TspGWI | | |||NlaIV Hpy188I | | ||CviJI | | |DsaI* | | |SecI* | | |StyI | | |NcoI | | |FatI | | CviAII | | HphI | NlaIII BsiYI* A L F T F V R A M A P F T P F L S E S I P Y S H L S V P W L H S P H F C Q K A F L I H I C P C H G S I H P I F V R K H L ----:----|----:----|----:----|----:----|----:----|----:----| A K N V N T R A M A G N V G N K D S L M H R I * M Q G H W P E M * G M K T L F C G * E C K D T G H S W E G W K Q * F A N AluI CviJI AlwNI Eco57I Eco57MI | SetI Hin4I Hin4II* | | DdeI Hin4I |FokI BseGI | | |MwoI | Tsp4CI* \\ \ \ \ \\ \ \ TATTTGAGACTGAAGGAATACATCCCAGAAGCTGTCTTAGCAAAATACGGTAAGGACGGA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAACTCTGACTTCCTTATGTAGGGTCTTCGACAGAATCGTTTTATGCCATTCCTGCCT // / / // / / / / / || FokI BseGI || | MwoI | Hin4I Tsp4CI* |Hin4II* || CviJI | Hin4I BsmAI || AluI DdeI |Eco57MI |Eco57I |SetI AlwNI Y L R L K E Y I P E A V L A K Y G K D G I * D * R N T S Q K L S * Q N T V R T E F E T E G I H P R S C L S K I R * G R K ----:----|----:----|----:----|----:----|----:----|----:----| * K L S F S Y M G S A T K A F Y P L S P K N S V S P I C G L L Q R L L I R Y P R I Q S Q L F V D W F S D * C F V T L V S MboI Hin4I CviJI | DpnI MboII Hin4I TspRI HaeIII | |BstKTI TspGWI |BfiI BsrI |Hpy178III* MnlI | TaqI \ \\ \ \\ \ \\ \ \ \ AGATCAGTCCATTTCTTATCTTACCCAGTGGTCAAGAAAGAATACTTTGACGAGGCCATC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGTCAGGTAAAGAATAGAATGGGTCACCAGTTCTTTCTTATGAAACTGCTCCGGTAG // / // / / / / / / || | || | BfiI TspRI | MnlI HaeIII || | || Hin4I BsrI Hpy178III* CviJI || | || Hin4I || | |MboII || | TspGWI || MboI |DpnI BstKTI R S V H F L S Y P V V K K E Y F D E A I D Q S I S Y L T Q W S R K N T L T R P S I S P F L I L P S G Q E R I L * R G H R ----:----|----:----|----:----|----:----|----:----|----:----| L D T W K K D * G T T L F S Y K S S A M F I L G N R I K G L P * S L I S Q R P W S * D M E * R V W H D L F F V K V L G D BccI |SfeI* || CviRI* || | PstI || | | XbaI || | | |MaeI || | | |Hpy178III* || | | ||TspGWI || | | ||| CviRI* TaqI || | | ||| | BsmI ClaI Hpy178III* \\ \ \ \\\ \ \ \ \ GAAACTGCAGTTTCTAGAATGCAATCCGTTATCGATTTGGGTAGAAACATTCGTGAAAAG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGACGTCAAAGATCTTACGTTAGGCAATAGCTAAACCCATCTTTGTAAGCACTTTTC / / / / / // / / / | | | | | || CviRI* ClaI Hpy178III* | | | | | || BsmI TaqI | | | | | |XbaI | | | | | Hpy178III* | | | | | MaeI | | | | TspGWI | | | SfeI* | | CviRI* | BccI | PstI TaqI E T A V S R M Q S V I D L G R N I R E K K L Q F L E C N P L S I W V E T F V K R N C S F * N A I R Y R F G * K H S * K E ----:----|----:----|----:----|----:----|----:----|----:----| S V A T E L I C D T I S K P L F M R S F R F Q L K * F A I R * R N P Y F C E H F F S C N R S H L G N D I Q T S V N T F L Tsp4CI* |MslI || Hin4II* PshAI || | TspRI BbvII* || | |TfiI | BseGI || | |HinfI MseI FokI | |MboII || | || Hin4II* \ \ \ \\ \\ \ \\ \ AAAACTATTTCCTTAAAAACTCCATTGAAGACTTTGGTCATCCTTCACAGTGATGAATCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGATAAAGGAATTTTTGAGGTAACTTCTGAAACCAGTAGGAAGTGTCACTACTTAGT / / / / / / / // // MseI FokI | | BbvII* | | || |Hin4II* | | MboII | | || HinfI | BseGI | | || TfiI PshAI | | |Hin4II* | | MslI | Tsp4CI* TspRI K T I S L K T P L K T L V I L H S D E S K L F P * K L H * R L W S S F T V M N H N Y F L K N S I E D F G H P S Q * * I I ----:----|----:----|----:----|----:----|----:----|----:----| F V I E K F V G N F V K T M R * L S S D S F * K R L F E M S S K P * G E C H H I F S N G * F S W Q L S Q D D K V T I F * BseGI | CviJI TspEI Hpy178III* TspDTI | | FokI MnlI TaqI | MseI | HphI \ \ \ \ \ \ \ \ \ \ TACTTGAAGGATGTAGAAGCCTTGAAAAACTACATTATCGAGGAATTAAATGTTCGTGAT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAACTTCCTACATCTTCGGAACTTTTTGATGTAATAGCTCCTTAATTTACAAGCACTA / / / / / / // / / TspDTI BseGI CviJI FokI MnlI TaqI |MseI | HphI TspEI Hpy178III* Y L K D V E A L K N Y I I E E L N V R D T * R M * K P * K T T L S R N * M F V M L E G C R S L E K L H Y R G I K C S * C ----:----|----:----|----:----|----:----|----:----|----:----| Y K F S T S A K F F * M I S S N F T R S M S S P H L L R S F S C * R P I L H E H V Q L I Y F G Q F V V N D L F * I N T I MnlI |SetI || Hpy188I CviJI || | MnlI AlwNI HaeIII \\ \ \ \ \ GTTGTTATCACCTCCGATGAGGCAAAATATGGTGTTGAGTATAAAGCAGTTGCTGATTGG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAATAGTGGAGGCTACTCCGTTTTATACCACAACTCATATTTCGTCAACGACTAACC / / / / / / | | | MnlI AlwNI HaeIII | | Hpy188I CviJI | MnlI SetI V V I T S D E A K Y G V E Y K A V A D W L L S P P M R Q N M V L S I K Q L L I G C Y H L R * G K I W C * V * S S C * L A ----:----|----:----|----:----|----:----|----:----|----:----| T T I V E S S A F Y P T S Y L A T A S Q H Q * * R R H P L I H H Q T Y L L Q Q N N N D G G I L C F I T N L I F C N S I P Hin4II* | SfaNI BseMII | |HgaI |BspCNI | || MseI |MaeIII BsiYI* | || SetI |Tsp45I \ \ \\ \ \\ CCTGTATTGGGTAAGAAGTTGAAAAAAGACGCAAAGAAGGTTAAAGATGCCCTACCATCA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| GGACATAACCCATTCTTCAACTTTTTTCTGCGTTTCTTCCAATTTCTACGGGATGGTAGT / / / / // // BsiYI* Hin4II* | | |MseI |BspCNI | | HgaI BseMII | SfaNI SetI P V L G K K L K K D A K K V K D A L P S L Y W V R S * K K T Q R R L K M P Y H Q C I G * E V E K R R K E G * R C P T I S ----:----|----:----|----:----|----:----|----:----|----:----| G T N P L F N F F S A F F T L S A R G D A Q I P Y S T S F L R L S P * L H G V M R Y Q T L L Q F F V C L L N F I G * W * DdeI SetI |Hpy188I | Cfr10I || Csp6I MmeI AciI | |HpaII BccI || |RsaI | SspI | MnlI | || TsoI \ \\ \\ \ \ \ \ \ \\ \ GTCACTTCTGAGCAAGTACGGGAATATTTGGAAAGCGGAAAGTTGGAGGTTGCCGGTATT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGAAGACTCGTTCATGCCCTTATAAACCTTTCGCCTTTCAACCTCCAACGGCCATAA // / / // / / // / / // || | DdeI || | SspI |MnlI SetI | |Cfr10I || Hpy188I || MmeI AciI | HpaII |Tsp45I |Csp6I TsoI |MaeIII RsaI BccI V T S E Q V R E Y L E S G K L E V A G I S L L S K Y G N I W K A E S W R L P V L H F * A S T G I F G K R K V G G C R Y * ----:----|----:----|----:----|----:----|----:----|----:----| T V E S C T R S Y K S L P F N S T A P I L * K Q A L V P I N P F R F T P P Q R Y D S R L L Y P F I Q F A S L Q L N G T N MwoI EcoP15I TfiI | AluI MseI | MnlI CviJI HinfI | CviJI BsrI | | BsmI | Cac8I | AlwNI | | SetI \ \ \ \ \ \ \ \ \ \ \ GAACTGGTTAAAGGAGATTTGAATGCTATTAGAGGCTTGCCAGAATCTGCTGTCCAAGCT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGACCAATTTCCTCTAAACTTACGATAATCTCCGAACGGTCTTAGACGACAGGTTCGA / / / // / / / / / / / | MseI | |BsmI | Cac8I | HinfI | | CviJI BsrI | MnlI CviJI | TfiI | | AluI EcoP15I AlwNI | SetI MwoI E L V K G D L N A I R G L P E S A V Q A N W L K E I * M L L E A C Q N L L S K L T G * R R F E C Y * R L A R I C C P S W ----:----|----:----|----:----|----:----|----:----|----:----| S S T L P S K F A I L P K G S D A T W A Q V P * L L N S H * * L S A L I Q Q G L F Q N F S I Q I S N S A Q W F R S D L S MaeII AflIII |BtrI BciVI || SetI | FatI || TaiI | |CviAII Hin4I || | MseI | || NlaIII SspI Hpy188I \\ \ \ \ \\ \ \ \ GGACAAGAAACCAGAACCGACCAAGACGTGTTAATCATCATGGATACAAATATTTACTCT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGTTCTTTGGTCTTGGCTGGTTCTGCACAATTAGTAGTACCTATGTTTATAAATGAGA / // / / / / // / / / | || | | | | |FatI | | Hpy188I | || | | | | CviAII | Hin4I | || | | | NlaIII SspI | || | | BciVI | || | MseI | || AflIII | |MaeII | BtrI TaiI SetI G Q E T R T D Q D V L I I M D T N I Y S D K K P E P T K T C * S S W I Q I F T L T R N Q N R P R R V N H H G Y K Y L L * ----:----|----:----|----:----|----:----|----:----|----:----| P C S V L V S W S T N I M M S V F I * E Q V L F W F R G L R T L * * P Y L Y K S S L F G S G V L V H * D D H I C I N V R AluI CviJI | SetI | Hin4I Hin4I | | HindII |SetI | | Hpy166II TspEI || BsmAI | | | TfiI Hin4I Hin4II* || Eco31I | | | HinfI | AjuI \ \\ \ \ \ \ \ \ \ GAACTAAAGAGTGAAGGTCTCGCAAGAGAGCTGGTCAACAGAATCCAAAAATTGAGAAAG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGATTTCTCACTTCCAGAGCGTTCTCTCGACCAGTTGTCTTAGGTTTTTAACTCTTTC / / / /// / / / / / | | SetI ||| CviJI | | AjuI TspEI | Hin4I ||| AluI | Hin4I Hin4II* ||SetI | HinfI |Hin4I | TfiI Eco31I Hpy166II BsmAI HindII E L K S E G L A R E L V N R I Q K L R K N * R V K V S Q E S W S T E S K N * E R T K E * R S R K R A G Q Q N P K I E K E ----:----|----:----|----:----|----:----|----:----|----:----| S S F L S P R A L S S T L L I W F N L F Q V L S H L D R L L A P * C F G F I S F F * L T F T E C S L Q D V S D L F Q S L Csp6I AjuI |RsaI CviJI |Hpy99I || TspEI MseI \ \\ \\ \ \ AAGTGTGGTTTGGAAGCCACCGACGATGTTTTAGTGGAGTACGAATTAGTTAAAGATACT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TTCACACCAAACCTTCGGTGGCTGCTACAAAATCACCTCATGCTTAATCAATTTCTATGA / // // / / | |Hpy99I |Csp6I | MseI | AjuI RsaI TspEI CviJI K C G L E A T D D V L V E Y E L V K D T S V V W K P P T M F * W S T N * L K I L V W F G S H R R C F S G V R I S * R Y Y ----:----|----:----|----:----|----:----|----:----|----:----| F H P K S A V S S T K T S Y S N T L S V S T H N P L W R R H K L P T R I L * L Y L T T Q F G G V I N * H L V F * N F I S BinI* |SfeI* ||SetI ||| MboI ||| XhoII ||| | DpnI ||| | |BstKTI TaqI CviJI MseI ||| | || Hpy188I \ \ \ \\\ \ \\ \ ATCGACTTTGAAGCCATTGTCAAAGAACATTTTGATATGTTAAGCAAGACCTGTAGATCC 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTGAAACTTCGGTAACAGTTTCTTGTAAAACTATACAATTCGTTCTGGACATCTAGG / / / / / /// // TaqI CviJI MseI | | ||| |BsrDI | | ||| Hpy188I | | ||| XhoII | | ||| MboI | | ||DpnI | | |BstKTI | | SfeI* | BinI* SetI I D F E A I V K E H F D M L S K T C R S S T L K P L S K N I L I C * A R P V D P R L * S H C Q R T F * Y V K Q D L * I R ----:----|----:----|----:----|----:----|----:----|----:----| I S K S A M T L S C K S I N L L V Q L D * R S Q L W Q * L V N Q Y T L C S R Y I D V K F G N D F F M K I H * A L G T S G MboII BceAI |MseI CviJI | MfeI |VspI BsrDI | MmeI | TspEI HphI |TspDTI \ \ \ \ \ \ \\ GACATTGCCAAATATGACGGCTCAAAGACAGACCCAATTGGTGATGAAGAACAATCTATT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAACGGTTTATACTGCCGAGTTTCTGTCTGGGTTAACCACTACTTCTTGTTAGATAA // / / / / |MmeI | TspEI HphI TspDTI CviJI | MfeI MboII BceAI D I A K Y D G S K T D P I G D E E Q S I T L P N M T A Q R Q T Q L V M K N N L L H C Q I * R L K D R P N W * * R T I Y * ----:----|----:----|----:----|----:----|----:----|----:----| S M A L Y S P E F V S G I P S S S C D I R C Q W I H R S L S L G L Q H H L V I * V N G F I V A * L C V W N T I F F L R N TspEI | MseI TspEI \ \ \ AATGACACCATTTTCAAATTAAAAGTGTTCAAATTATGA 3190 3200 3210 ----:----|----:----|----:----|----:---- TTACTGTGGTAAAAGTTTAATTTTCACAAGTTTAATACT / // / VspI |MseI TspEI MseI TspEI N D T I F K L K V F K L * M T P F S N * K C S N Y X * H H F Q I K S V Q I M X ----:----|----:----|----:----|----:---- L S V M K L N F T N L N H * H C W K * I L L T * I I I V G N E F * F H E F * S # Enzymes that cut Frequency Isoschizomers AatII 1 Acc65I 1 Asp718I AciI 3 BspACI,SsiI AclI 1 Psp1406I AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AgeI 2 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 3 AloI 2 AluI 12 AluBI AlwNI 3 CaiI ApoI 7 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 10 Bce83I* 1 BpuEI BceAI 2 BciVI 3 BfuI BdaI 2 BetI* 4 BsaWI BfiI 2 BmrI,BmuI BinI* 6 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 9 BstF5I,BtsCI BseMII 2 BseRI 2 BseYI 1 BsiYI* 8 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 2 BspHI 1 CciI,PagI,RcaI BsrDI 1 BseMI,Bse3DI BsrI 10 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 8 BstXI 2 BtrI 1 BmgBI,AjiI Cac8I 1 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 10 CviQI,RsaNI CviAII 10 CviJI 27 CviKI-1 CviRI* 5 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 8 MalI DraIII 3 AdeI DsaI* 4 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 2 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 10 FauI 1 SmuI FokI 9 GsaI 1 HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 9 Hin4II* 9 HpyAV HindII 3 HincII HinfI 14 HpaI 2 KspAI HpaII 5 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 13 Hpy99I 4 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 9 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 14 MfeI 3 MunI MlyI 2 SchI MmeI 5 MnlI 19 MseI 25 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NcoI 3 Bsp19I NlaIII 10 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PflMI 3 BasI,AccB7I,Van91I PleI 2 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PshAI 1 BstPAI,BoxI PstI 1 PvuII 1 RsaI 10 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 5 BseDI,BssECI,BsaJI SetI 40 SfaNI 6 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 2 StyI 4 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 9 TatI 4 TfiI 12 PfeI TseI 2 ApeKI TsoI 2 Tsp45I 4 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 17 TspEI 31 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 7 TscAI TstI 2 VspI 1 PshBI,AseI XbaI 1 XcmI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AccI AflII AlfI ApaI ApaLI AscI AvaI AvaII AvrII BaeI BamHI BarI BbvCI BcgI BclI BglI BglII BmeT110I BmtI BplI Bpu10I BsaBI BsePI BseSI BsgI BsiI* Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtsI CauII* Cfr9I CspCI DinI DraII DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoRI EcoRV EgeI EheI FnuDII* FseI FspAI GlaI GsuI HaeII HgiAI* HgiJII* HhaI Hin6I HindIII HinP1I HspAI KasI MauBI McrI* MluI MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NspI OliI PacI PasI PfoI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI TspMI Tth111I XhoI XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769