Restriction Map of YBL055C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YBL055C on chromosome II from coordinates 116829 to 115573.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.28269

EMBOSS_001 MaeI | CviJI | | Hpy178III* SfaNI TaqI MnlI | | | TspEI \ \ \ \ \ \ \ ATGTGGGGCATCTTATTGAAATCCTCGAACAAAAGTTGTTCTAGGCTCTGGAAACCAATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACACCCCGTAGAATAACTTTAGGAGCTTGTTTTCAACAAGATCCGAGACCTTTGGTTAA / / / / / / / SfaNI TaqI MnlI | | | TspEI | | Hpy178III* | CviJI MaeI M W G I L L K S S N K S C S R L W K P I C G A S Y * N P R T K V V L G S G N Q F V G H L I E I L E Q K L F * A L E T N F ----:----|----:----|----:----|----:----|----:----|----:----| X H P M K N F D E F L L Q E L S Q F G I X T P C R I S I R S C F N N * A R S V L H P A D * Q F G R V F T T R P E P F W N FatI AciI |CviAII SecI* | NspBII* || NlaIII DsaI* | | TspGWI || | TstI | TfiI | | | BsaXI SspI || | BsaXI | HinfI | | | | TstI \ \\ \ \ \ \ \ \ \ \ \ TTGACACAATATTATAGCATGACATCAACTGCCACGGATTCTCCGCTGAAATACTATGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGTGTTATAATATCGTACTGTAGTTGACGGTGCCTAAGAGGCGACTTTATGATACTA / / /// / / / / / SspI | ||BsaXI | | | | BsaXI | ||FatI | | | | TstI | |CviAII | | | TspGWI | TstI | | NspBII* NlaIII | | AciI | HinfI | TfiI DsaI* SecI* L T Q Y Y S M T S T A T D S P L K Y Y D * H N I I A * H Q L P R I L R * N T M I D T I L * H D I N C H G F S A E I L * Y ----:----|----:----|----:----|----:----|----:----|----:----| K V C Y * L M V D V A V S E G S F Y * S K S V I N Y C S M L Q W P N E A S I S H Q C L I I A H C * S G R I R R Q F V I I TfiI HinfI | BinI* | |Hpy188I | || MboI | || XhoII Csp6I | || | DpnI |RsaI | || | |BstKTI Tsp4CI* FokI || BseGI \ \\ \ \\ \ \ \\ \ ATTGGATTGAATCTGACAGATCCTATGTTTCACGGTATTTACAATGGTAAGCAGTACCAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCTAACTTAGACTGTCTAGGATACAAAGTGCCATAAATGTTACCATTCGTCATGGTA /// // / / / // ||| || XhoII Tsp4CI* FokI |Csp6I ||| || MboI BseGI ||| |DpnI RsaI ||| BstKTI ||BinI* |Hpy188I HinfI TfiI I G L N L T D P M F H G I Y N G K Q Y H L D * I * Q I L C F T V F T M V S S T I W I E S D R S Y V S R Y L Q W * A V P S ----:----|----:----|----:----|----:----|----:----|----:----| I P N F R V S G I N * P I * L P L C Y W Y Q I S D S L D * T E R Y K C H Y A T G N S Q I Q C I R H K V T N V I T L L V M Cac8I | TseI | |MnlI | |BisI | |EcoP15I | ||BlsI | ||| DdeI | ||| | Hpy188I | ||| | | MaeII | ||| | | |PmaCI | ||| | | |BsaAI | ||| | | || SetI | ||| | | || TaiI TspEI | ||| | | || |BspCNI FokI BccI | BbvI | ||| | | || ||BseMII | MaeIII \ \ \ \ \\\ \ \ \\ \\\ \ \ CCAGCAGATTATGTAAAATTATTAGAGCGTGCTGCTCAGAGGCACGTGAAAAATGCCCTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGTCTAATACATTTTAATAATCTCGCACGACGAGTCTCCGTGCACTTTTTACGGGAA / / / / //// // / /// BccI | BbvI | |||| |DdeI | ||BseMII TspEI | |||| | | |BspCNI | |||| | | |MaeII | |||| | | BsaAI | |||| | | PmaCI | |||| | TaiI | |||| | SetI | |||| Hpy188I | |||EcoP15I | |||TseI | ||BisI | |BlsI | MnlI Cac8I P A D Y V K L L E R A A Q R H V K N A L Q Q I M * N Y * S V L L R G T * K M P L S R L C K I I R A C C S E A R E K C P C ----:----|----:----|----:----|----:----|----:----|----:----| G A S * T F N N S R A A * L C T F F A R D L L N H L I I L A H Q E S A R S F H G W C I I Y F * * L T S S L P V H F I G K MboI | DpnI | |BseGI | |BstKTI | || BinI* BsmAI TseI MboI | || | AciI |PleI HgaI |BisI BglII | || | | HinfI ||MlyI BstXI ||BlsI XhoII \ \\ \ \ \ \\\ \ \\\ \ GTTACAGGATCATCCATAGCGGAGTCTCAAAGTGCCATTGAGTTGGTAAGCAGCGTCAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGTCCTAGTAGGTATCGCCTCAGAGTTTCACGGTAACTCAACCATTCGTCGCAGTTT / / // / / / / / / / / /// | | || MboI | | HinfI | | BstXI | ||TseI | | |DpnI | AciI | BsmAI | |BisI | | BstKTI BinI* PleI | BlsI | | BseGI MlyI HgaI | MaeIII FokI V T G S S I A E S Q S A I E L V S S V K L Q D H P * R S L K V P L S W * A A S K Y R I I H S G V S K C H * V G K Q R Q R ----:----|----:----|----:----|----:----|----:----|----:----| T V P D D M A S D * L A M S N T L L T L Q * L I M W L P T E F H W Q T P L C R * N C S * G Y R L R L T G N L Q Y A A D F SetI | Hpy166II | | FatI | | |CviAII | | || NlaIII DpnI | | || | MseI BbvI | | || | |HpaI |BstKTI | | || | |HindII ||DdeI AluI | | || | |Hpy166II ||| CviJI CviJI | | || | || TaqII ||| | MseI | SetI HphI | | || | || |SfaNI \\\ \ \ \ \ \ \ \ \\ \ \\ \\ GATCTTAGCCCGTTAAAGCTGTATCACACAATAGGTGTTCACCCATGTTGCGTTAACGAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGAATCGGGCAATTTCGACATAGTGTGTTATCCACAAGTGGGTACAACGCAATTGCTC // / /// // / / / / / // // || | ||CviJI || CviJI | SetI | | |FatI |MseI || | |DdeI || AluI HphI | | CviAII Hpy166II || | BbvI |SetI | NlaIII HindII || XhoII MseI Hpy166II TaqII || BglII HpaI || MboI |DpnI BstKTI D L S P L K L Y H T I G V H P C C V N E I L A R * S C I T Q * V F T H V A L T S S * P V K A V S H N R C S P M L R * R V ----:----|----:----|----:----|----:----|----:----|----:----| S R L G N F S Y * V I P T * G H Q T L S L D * G T L A T D C L L H E G M N R * R I K A R * L Q I V C Y T N V W T A N V L NheI CviJI |MaeI FatI ||Cac8I NcoI ||| BmtI StyI ||| Hin6I SecI* ||| |GlaI DsaI* ||| |Eco47III |CviAII ||| ||HhaI |BsiYI* MaeI ||| ||BslFI || NlaIII AciI |BseGI FokI ||| |||HaeII || | Hin4II* \ \\ \ \\\ \\\\ \\ \ \ TTTGCGGATGCTAGTCAAGGGGACAAGGCTAGCGCTTCTATTGATAACCCTTCCATGGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGCCTACGATCAGTTCCCCTGTTCCGATCGCGAAGATAACTATTGGGAAGGTACCTA / / / / / / ///// / / / /// | | | MaeI FokI | ||||| BslFI | | ||Hin4II* | | BseGI | ||||Hin6I | | |DsaI* | AciI | |||Eco47III | | |SecI* SfaNI | |||GlaI | | |StyI | ||NheI | | |NcoI | ||HhaI | | |FatI | |HaeII | | CviAII | |MaeI | NlaIII | Cac8I BsiYI* CviJI BmtI F A D A S Q G D K A S A S I D N P S M D L R M L V K G T R L A L L L I T L P W M C G C * S R G Q G * R F Y * * P F H G * ----:----|----:----|----:----|----:----|----:----|----:----| N A S A L * P S L A L A E I S L G E M S T Q P H * D L P C P * R K * Q Y G K W P K R I S T L P V L S A S R N I V R G H I FokI | HinfI | |TspDTI | || BsmAI | || |PleI BccI BseGI | || ||MlyI |CviRI* \ \ \\ \\\ \\ GAAGCATATAATGAGTCTCTATATGCTAAAGTTATTAGTAATCCATCTTTTGCACAGGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGTATATTACTCAGAGATATACGATTTCAATAATCATTAGGTAGAAAACGTGTCCCA / / / / / / / BseGI | | HinfI | BsmAI CviRI* | FokI PleI BccI TspDTI MlyI E A Y N E S L Y A K V I S N P S F A Q G K H I M S L Y M L K L L V I H L L H R V S I * * V S I C * S Y * * S I F C T G * ----:----|----:----|----:----|----:----|----:----|----:----| S A Y L S D R Y A L T I L L G D K A C P H L M Y H T E I H * L * * Y D M K Q V P F C I I L R * I S F N N T I W R K C L T Cac8I | TspDTI | | FatI | | SetI | | BspHI | | |CviAII AluI | | |Hpy178III* CviJI TfiI | | || NlaIII Hpy166II | SetI HinfI | | || | MnlI \ \ \ \ \ \ \\ \ \ AAACTGAAAGAGCTTTATGATTTGATGAATCAGCAAGCAAAACCTCATGATACAAGTTTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGACTTTCTCGAAATACTAAACTACTTAGTCGTTCGTTTTGGAGTACTATGTTCAAAG / / / / / / / / // / / Hpy166II | CviJI | | | | | || MnlI SetI | AluI | | | | | |BspHI MmeI SetI | | | | | |FatI | | | | | Hpy178III* | | | | | CviAII | | | | NlaIII | | | SetI | | TspDTI | Cac8I HinfI TfiI K L K E L Y D L M N Q Q A K P H D T S F N * K S F M I * * I S K Q N L M I Q V S T E R A L * F D E S A S K T S * Y K F Q ----:----|----:----|----:----|----:----|----:----|----:----| L S F S S * S K I F * C A F G * S V L K Y V S L A K H N S S D A L L V E H Y L N F Q F L K I I Q H I L L C F R M I C T E MmeI MboI | SetI | DpnI | |MfeI | |BstKTI SfeI* | |TspEI | || HphI | SfaNI CviRI* \ \\ \ \\ \ \ \ \ AGGTCAATTGGTGAGATCGGGTTGGACTACGACAGATTTCACTATAGTTCTAAAGAGATG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAGTTAACCACTCTAGCCCAACCTGATGCTGTCTAAAGTGATATCAAGATTTCTCTAC / // / / / / / TspEI || | HphI | SfaNI CviRI* MfeI || MboI SfeI* |DpnI BstKTI R S I G E I G L D Y D R F H Y S S K E M G Q L V R S G W T T T D F T I V L K R C V N W * D R V G L R Q I S L * F * R D A ----:----|----:----|----:----|----:----|----:----|----:----| L D I P S I P N S * S L N * * L E L S I * T L Q H S R T P S R C I E S Y N * L S P * N T L D P Q V V V S K V I T R F L H DdeI | TseI | |BisI SetI | ||BlsI | SapI | |||AluI | Ksp632I* MboII | |||CviJI \ \ \ \ \\\\ CAAAAGGTTTTTTTTGAAGAGCAACTGAAAATAAGTTGTTTGAACGATAAACTCAGCAGC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCCAAAAAAAACTTCTCGTTGACTTTTATTCAACAAACTTGCTATTTGAGTCGTCG / / / / /// SetI Ksp632I* MboII | ||CviJI SapI | ||TseI | ||AluI | |BisI | BlsI | SetI DdeI Q K V F F E E Q L K I S C L N D K L S S K R F F L K S N * K * V V * T I N S A A K G F F * R A T E N K L F E R * T Q Q L ----:----|----:----|----:----|----:----|----:----|----:----| C F T K K S S C S F I L Q K F S L S L L A F P K K Q L A V S F L N N S R Y V * C L L N K K F L L Q F Y T T Q V I F E A A EcoP15I | Hin6I | |GlaI | ||FatI | ||HhaI | |||CviAII SetI | |||| MaeIII | BspCNI | |||| Tsp45I | |BseMII CviRI* | |||| |NspI | || BbvI | NdeI | |||| |NlaIII SspI \ \\ \ \ \ \ \\\\ \\ \ TATCCATTGTTTCTGCATATGAGAAGCGCATGTGACGATTTTGTTCAAATATTGGAAAGA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGGTAACAAAGACGTATACTCTTCGCGTACACTGCTAAAACAAGTTTATAACCTTTCT // / / / /// // / / |BseMII | | NdeI ||| || Tsp45I SspI BspCNI | CviRI* ||| || MaeIII BbvI ||| |FatI ||| CviAII ||NlaIII ||Hin6I ||NspI |GlaI EcoP15I HhaI Y P L F L H M R S A C D D F V Q I L E R I H C F C I * E A H V T I L F K Y W K D S I V S A Y E K R M * R F C S N I G K I ----:----|----:----|----:----|----:----|----:----|----:----| * G N N R C I L L A H S S K T * I N S L S D M T E A Y S F R M H R N Q E F I P F I W Q K Q M H S A C T V I K N L Y Q F S BssKI |HpaII ||ScrFI ||CauII* ||| Hpy166II ||| | MnlI AluI ||| | | BciVI CviJI SetI ||| | | TspRI SetI | SetI |CviRI* \\\ \ \ \ \ \ \ \\ TTTATTGCCGGGTTCACTGATGAGAGGGATACCTTTCAGCTACAAAAGTTAGGTGCATCG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAACGGCCCAAGTGACTACTCTCCCTATGGAAAGTCGATGTTTTCAATCCACGTAGC / / / / / / / / / / / | | | | BciVI SetI | CviJI SetI | Hpy99I | | | MnlI | AluI CviRI* | | Hpy166II SetI | BssKI | TspRI CauII* HpaII ScrFI F I A G F T D E R D T F Q L Q K L G A S L L P G S L M R G I P F S Y K S * V H R Y C R V H * * E G Y L S A T K V R C I V ----:----|----:----|----:----|----:----|----:----|----:----| N I A P N V S S L S V K * S C F N P A D I * Q R T * Q H S P Y R E A V F T L H M K N G P E S I L P I G K L * L L * T C R FauI | Hpy99I | |SfaNI | ||MaeI | ||| AciI | ||| | FokI SpeI | ||| | | TspDTI |MaeI | ||| | | | ApoI ||TspDTI | ||| | | | TspEI ||| AsuI* | ||| | | | | BseGI ||| AvaII XcmI | ||| | | | | | Hpy178III* ||| |BmgT120I | BcgI \ \\\ \ \ \ \ \ \ \\\ \\ \ \ TCGTCTAGCGGGTTTTACAAATTTCATCCAGATAGAAAACTAGTGGTCCATTCATTCACT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAGATCGCCCAAAATGTTTAAAGTAGGTCTATCTTTTGATCACCAGGTAAGTAAGTGA / // // / // / / // // // | || || FokI |TspEI | | || |AvaII |BcgI | || |TspDTI |ApoI | | || |AsuI* TspRI | || AciI BseGI | | || | XcmI | |SfaNI | | || BmgT120I | MaeI | | |SpeI FauI | | MaeI | TspDTI Hpy178III* S S S G F Y K F H P D R K L V V H S F T R L A G F T N F I Q I E N * W S I H S L V * R V L Q I S S R * K T S G P F I H W ----:----|----:----|----:----|----:----|----:----|----:----| D D L P N * L N * G S L F S T T W E N V T T * R T K C I E D L Y F V L P G N M * R R A P K V F K M W I S F * H D M * E S BsrI CviRI* HphI MboII TspRI | TspEI | BcgI TspDTI TaqII Hpy166II \ \ \ \ \ \ \ \ GGTTCTGCGATAGATTTGCAGAAATTACTGAACTTATCACCCAACATCTTCATAGGAGTA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAGACGCTATCTAAACGTCTTTAATGACTTGAATAGTGGGTTGTAGAAGTATCCTCAT / / / // // / / BsrI CviRI* | |BcgI |MboII TaqII Hpy166II | HphI TspDTI TspEI G S A I D L Q K L L N L S P N I F I G V V L R * I C R N Y * T Y H P T S S * E * F C D R F A E I T E L I T Q H L H R S K ----:----|----:----|----:----|----:----|----:----|----:----| P E A I S K C F N S F K D G L M K M P T Q N Q S L N A S I V S S I V W C R * L L T R R Y I Q L F * Q V * * G V D E Y S Y MaeI | AluI | CviJI Tsp4CI* MnlI SecI* | | SetI \ \ \ \ \ \ AACGGTTGCTCGTTGAGAACCGAGGAAAATCTAGCTGTTGTAAAGCAAATACCAACAGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCAACGAGCAACTCTTGGCTCCTTTTAGATCGACAACATTTCGTTTATGGTTGTCTT / / / /// / Tsp4CI* MnlI SecI* ||CviJI SetI ||AluI |MaeI SetI N G C S L R T E E N L A V V K Q I P T E T V A R * E P R K I * L L * S K Y Q Q K R L L V E N R G K S S C C K A N T N R K ----:----|----:----|----:----|----:----|----:----|----:----| F P Q E N L V S S F R A T T F C I G V S L R N S T S F R P F D L Q Q L A F V L L V T A R Q S G L F I * S N Y L L Y W C F FatI |CviAII ||Cac8I SetI ||| SphI | BsaXI ||| NspI | Hin4I ||| CviRI* | |BsmAI BsaXI ||| NlaIII | || SfaNI SecI* | MseI ||| | EcoT22I | || | TspGWI DsaI* | Hin4I ||| | | BsrI \ \\ \ \ \ \ \ \\\ \ \ \ AGGTTGTTATTAGAGACAGATGCTCCGTGGTGTGAGATTAAAAGAACGCATGCATCTTTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAACAATAATCTCTGTCTACGAGGCACCACACTCTAATTTTCTTGCGTACGTAGAAAG / / /// / / / / /// / | BsaXI ||SfaNI | Hin4I MseI | ||| BsrI Hin4I |TspGWI | BsaXI | ||CviRI* BsmAI DsaI* | ||FatI SecI* | |CviAII | EcoT22I | Cac8I NlaIII NspI SphI R L L L E T D A P W C E I K R T H A S F G C Y * R Q M L R G V R L K E R M H L S V V I R D R C S V V * D * K N A C I F P ----:----|----:----|----:----|----:----|----:----|----:----| L N N N S V S A G H H S I L L V C A D K F T T I L S L H E T T H S * F F A H M K P Q * * L C I S R P T L N F S R M C R E SfaNI |TatI ||Csp6I |||RsaI |||ScaI |||| DdeI |||| | CviJI |||| | | MnlI |||| | | | BssKI |||| | | | EcoRII |||| | | | | ScrFI |||| | | | | BseBI |||| | | | | | TsoI TspGWI |||| | | | | | |BcgI TaqI |BsmI MseI |||| | | | | | ||SetI AsuII |CviRI* BcgI \\\\ \ \ \ \ \ \\\ \ \\ \ CAGTACTTAGCCAAATACCAGGAGGTTAGGGATTTCGAATACCCTGCATTCAAGTCCGTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATGAATCGGTTTATGGTCCTCCAATCCCTAAAGCTTATGGGACGTAAGTTCAGGCAA /// // / / // / // / / ||| || MnlI | |BcgI AsuII || CviRI* BcgI ||| |CviJI | EcoRII TaqI |BsmI ||| DdeI | BssKI TspGWI ||TatI | TsoI |SfaNI | SetI |Csp6I BseBI ScaI ScrFI RsaI Q Y L A K Y Q E V R D F E Y P A F K S V S T * P N T R R L G I S N T L H S S P L V L S Q I P G G * G F R I P C I Q V R * ----:----|----:----|----:----|----:----|----:----|----:----| W Y K A L Y W S T L S K S Y G A N L D T G T S L W I G P P * P N R I G Q M * T R L V * G F V L L N P I E F V R C E L G N BceAI | FatI | |CviAII | ||MboII | ||| NlaIII AluI | ||| | AsuI* CviJI | ||| | |BmgT120I | SetI CviRI* | ||| | ||CviJI | Cac8I | BsmI | ||| | ||HaeIII \ \ \ \ \ \\\ \ \\\ AAGAAAAATAAGCTCGCTGACAAGTTGAATGCAGAAGAACTTTACATGGTCAAGGGCCGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTTATTCGAGCGACTGTTCAACTTACGTCTTCTTGAAATGTACCAGTTCCCGGCA / / / / / /// // // MseI | | Cac8I CviRI* ||| |FatI |AsuI* | CviJI BsmI ||| CviAII BmgT120I | AluI ||MboII HaeIII SetI |NlaIII CviJI BceAI K K N K L A D K L N A E E L Y M V K G R R K I S S L T S * M Q K N F T W S R A V E K * A R * Q V E C R R T L H G Q G P * ----:----|----:----|----:----|----:----|----:----|----:----| L F F L S A S L N F A S S S * M T L P R * S F Y A R Q C T S H L L V K C P * P G L F I L E S V L Q I C F F K V H D L A T TsoI |MaeII ||BtrI ||| SetI ||| TaiI ||| |MboI ||| |XhoII MfeI ||| || DpnI CviJI TspEI Hpy188I ||| || |BstKTI \ \ \ \\\ \\ \\ AATGAGCCTTGTAATATGGAACAAGTAGCAATTGTCGTATCGGAAGTCAAGGACGTGGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTCGGAACATTATACCTTGTTCATCGTTAACAGCATAGCCTTCAGTTCCTGCACCTA / / / / / // // CviJI TspEI Hpy188I | | || |DpnI MfeI | | || BstKTI | | |MaeII | | BtrI | TaiI | SetI TsoI N E P C N M E Q V A I V V S E V K D V D M S L V I W N K * Q L S Y R K S R T W I * A L * Y G T S S N C R I G S Q G R G S ----:----|----:----|----:----|----:----|----:----|----:----| L S G Q L I S C T A I T T D S T L S T S Y H A K Y Y P V L L L Q R I P L * P R P I L R T I H F L Y C N D Y R F D L V H I MaeII |PmaCI |BsaAI BbvII* CviJI || SetI | SetI |BinI* || TaiI | | MboII \\ \\ \ \ \ \ CTGGCTACTTTGATAGATACCACGTGGAAGACGACCTGTAAGATATTTGGAGAGTAA 1210 1220 1230 1240 1250 ----:----|----:----|----:----|----:----|----:----|----:-- GACCGATGAAACTATCTATGGTGCACCTTCTGCTGGACATTCTATAAACCTCTCATT / / / / // / / | | BinI* | |MaeII SetI BbvII* | CviJI | BsaAI MboII XhoII | PmaCI MboI TaiI SetI L A T L I D T T W K T T C K I F G E * W L L * * I P R G R R P V R Y L E S X G Y F D R Y H V E D D L * D I W R V X ----:----|----:----|----:----|----:----|----:----|----:-- R A V K I S V V H F V V Q L I N P S Y D P * K S L Y W T S S S R Y S I Q L T Q S S Q Y I G R P L R G T L Y K S L L # Enzymes that cut Frequency Isoschizomers AciI 4 BspACI,SsiI AluI 6 AluBI ApoI 1 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 BceAI 1 BcgI 2 BciVI 1 BfuI BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 2 BmtI 1 BspOI BsaAI 2 BstBAI,Ppu21I BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 2 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 2 BspHI 1 CciI,PagI,RcaI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 5 BstXI 1 BtrI 1 BmgBI,AjiI Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 2 CviQI,RsaNI CviAII 7 CviJI 13 CviKI-1 CviRI* 8 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 5 MalI DsaI* 3 BtgI,BstDSI Eco47III 1 Aor51HI,AfeI EcoP15I 2 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 7 FauI 1 SmuI FokI 5 GlaI 2 HaeII 1 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HhaI 2 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 1 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 5 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 2 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MfeI 2 MunI MlyI 2 SchI MmeI 1 MnlI 6 MseI 4 Tru1I,Tru9I NcoI 1 Bsp19I NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 7 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I NspI 2 BstNSI,XceI PleI 2 PpsI PmaCI 2 BbrPI,Eco72I,AcvI,PmlI,PspCI RsaI 2 AfaI SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SecI* 4 BseDI,BssECI,BsaJI SetI 18 SfaNI 6 LweI SfeI* 1 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI SspI 2 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 2 TaqII 2 TatI 1 TfiI 3 PfeI TseI 3 ApeKI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 6 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 2 TscAI TstI 1 XcmI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BclI BdaI BetI* BfiI BglI BmeT110I BplI Bpu10I BsaBI BsePI BseRI BseSI BseYI BsgI BsiI* Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtsI Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRV EgeI EheI Esp3I EspI* FalI FnuDII* FseI FspAI GsaI GsuI HgiAI* HgiCI* HgiJII* HindIII KasI KpnI MauBI McrI* MluI MroNI MslI MstI* MwoI NaeI NarI NgoMIV NlaIV NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SplI* SrfI Sse232I* Sse8387I StuI SwaI TauI TspMI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769