Restriction Map of YAR009C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YAR009C on chromosome I from coordinates 164187 to 160597.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.29881

EMBOSS_001 TatI |Csp6I ||RsaI TspGWI Csp6I BsrI BfiI ||ScaI | BccI |RsaI \ \ \\\ \ \ \\ ATGGAGACTTTTACTGGGTATCTAAAAAGTACTTGCTTCCATCAAATATCTCCGTACCCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTCTGAAAATGACCCATAGATTTTTCATGAACGAAGGTAGTTTATAGAGGCATGGGT / / /// / / // BsrI BfiI ||TatI TspGWI BccI |Csp6I |Csp6I RsaI ScaI RsaI M E T F T G Y L K S T C F H Q I S P Y P W R L L L G I * K V L A S I K Y L R T H G D F Y W V S K K Y L L P S N I S V P T ----:----|----:----|----:----|----:----|----:----|----:----| X S V K V P Y R F L V Q K W * I D G Y G X P S K * Q T D L F Y K S G D F I E T G H L S K S P I * F T S A E M L Y R R V W TatI |Csp6I TaqI ||RsaI TspDTI |AlfI BccI MslI |||Hpy166II | TspDTI |AlfI \ \ \\\\ \ \ \\ CCATCAATAATGTCCATACAAGTGAAAGTACACGCAAATATCCTTATCCTTTCATTCATC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGTTATTACAGGTATGTTCACTTTCATGTGCGTTTATAGGAATAGGAAAGTAAGTAG / / /// / / / BccI MslI ||TatI | TspDTI AlfI |Hpy166II TspDTI AlfI |Csp6I RsaI P S I M S I Q V K V H A N I L I L S F I H Q * C P Y K * K Y T Q I S L S F H S S I N N V H T S E S T R K Y P Y P F I H R ----:----|----:----|----:----|----:----|----:----|----:----| G D I I D M C T F T C A F I R I R E N M V M L L T W V L S L V R L Y G * G K M * W * Y H G Y L H F Y V C I D K D K * E D BsmI Cac8I | Hin6I | |GlaI | |MstI* | ||FatI | ||HhaI | |||CviAII | ||||Cac8I ApoI | ||||| SphI TspEI | ||||| NspI | TaqI | ||||| NlaIII | |AlfI | ||||| |MslI CviRI* | |AlfI MseI \ \\\\\ \\ \ \ \\ \ GAATGCTTGCGCATGCCAATGCACAGACAAATTCGATACTCACTTAAAAATAACACCATC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACGAACGCGTACGGTTACGTGTCTGTTTAAGCTATGAGTGAATTTTTATTGTGGTAG / / / /// //// / // / / / | | | ||| |||MslI CviRI* || TaqI MseI TaiI | | | ||| ||FatI |TspEI SetI | | | ||| |CviAII |ApoI | | | ||| Cac8I AlfI | | | ||NlaIII AlfI | | | ||Hin6I | | | ||NspI | | | ||SphI | | | |MstI* | | | |GlaI | | | HhaI | | Cac8I | BsmI TaqI E C L R M P M H R Q I R Y S L K N N T I N A C A C Q C T D K F D T H L K I T P S M L A H A N A Q T N S I L T * K * H H H ----:----|----:----|----:----|----:----|----:----|----:----| S H K R M G I C L C I R Y E S L F L V M R I S A C A L A C V F E I S V * F Y C W F A Q A H W H V S L N S V * K F I V G D TfiI HinfI | Hpy188I | | SalI MaeII | | |TaqI |BsaAI | | |AccI || SetI | | ||HindII || TaiI | | ||Hpy166II || BccI | | ||| BsrI || | MseI | | ||| |MaeI Hpy178III* \\ \ \ \ \ \\\ \\ \ ACGTATTTTAACGAATCAGATGTCGACTGGTCTAGTGCTATTGACTATCAATGTCCTGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGCATAAAATTGCTTAGTCTACAGCTGACCAGATCACGATAACTGATAGTTACAGGACTA // / / // /// / / / || BccI MseI || ||| BsrI MaeI Hpy178III* |MaeII || ||SalI BsaAI || |AccI || |TaqI || Hpy166II || HindII |Hpy188I HinfI TfiI T Y F N E S D V D W S S A I D Y Q C P D R I L T N Q M S T G L V L L T I N V L I V F * R I R C R L V * C Y * L S M S * L ----:----|----:----|----:----|----:----|----:----|----:----| V Y K L S D S T S Q D L A I S * * H G S * T N * R I L H R S T * H * Q S D I D Q R I K V F * I D V P R T S N V I L T R I SetI |Hpy166II ||Hpy178III* ApoI MseI ||| TspDTI TspEI \ \\\ \ \ TGTTTAATCGGCAAAAGCACCAAACACAGACATATCAAAGGTTCACGACTAAAATACCAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAATTAGCCGTTTTCGTGGTTTGTGTCTGTATAGTTTCCAAGTGCTGATTTTATGGTT / / / / / MseI SetI | | TspDTI | Hpy178III* Hpy166II C L I G K S T K H R H I K G S R L K Y Q V * S A K A P N T D I S K V H D * N T K F N R Q K H Q T Q T Y Q R F T T K I P K ----:----|----:----|----:----|----:----|----:----|----:----| Q K I P L L V L C L C I L P E R S F Y W N N L R C F C W V C V Y * L N V V L I G T * D A F A G F V S M D F T * S * F V L AsuI* AvaII |BmgT120I || Hpy166II || | SetI XmnI SetI || BsrI | |FokI \ \ \\ \ \ \\ AATTCATACGAACCCTTTCAATACCTACATACTGACATATTTGGTCCAGTTCACAACCTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGTATGCTTGGGAAAGTTATGGATGTATGACTGTATAAACCAGGTCAAGTGTTGGAT / / / /// / / TspEI XmnI SetI ||| | SetI ApoI ||| Hpy166II ||AvaII ||AsuI* |BmgT120I BsrI N S Y E P F Q Y L H T D I F G P V H N L I H T N P F N T Y I L T Y L V Q F T T Y F I R T L S I P T Y * H I W S S S Q P T ----:----|----:----|----:----|----:----|----:----|----:----| F E Y S G K * Y R C V S M N P G T * L R F N M R V R E I G V Y Q C I Q D L E C G I * V F G K L V * M S V Y K T W N V V * ApaLI | CviRI* | Hpy166II | | SduI | | BseSI | | TspDTI | | HgiAI* | | |BseGI BccI BsmAI TspEI \ \ \\ \ \ \ CCAAAAAGTGCACCATCCTATTTCATCTCATTTACTGATGAGACAACAAAATTGCGTTGG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTTTCACGTGGTAGGATAAAGTAGAGTAAATGACTACTCTGTTGTTTTAACGCAACC / / /// / / / | | ||ApaLI BccI BsmAI TspEI | | |BseGI | | Hpy166II | | CviRI* | | TspDTI | HgiAI* | BseSI | SduI FokI P K S A P S Y F I S F T D E T T K L R W Q K V H H P I S S H L L M R Q Q N C V G K K C T I L F H L I Y * * D N K I A L G ----:----|----:----|----:----|----:----|----:----|----:----| G F L A G D * K M E N V S S V V F N R Q V L F H V M R N * R M * Q H S L L I A N W F T C W G I E D * K S I L C C F Q T P MnlI McrI* |Tsp4CI* || MlyI || PleI || Hpy178III* || |NruI || |Hpy99I || |FnuDII* || ||BsiYI* || ||| HinfI TaqI MnlI MaeI \\ \\\ \ \ \ \ GTTTATCCATTACACGACCGTCGCGAGGACTCTATCCTCGATGTTTTTACTACGATACTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CAAATAGGTAATGTGCTGGCAGCGCTCCTGAGATAGGAGCTACAAAAATGATGCTATGAT /// //// / / / // ||| |||| HinfI TaqI MnlI |MaeI ||| |||Hpy178III* SetI ||| ||FnuDII* ||| ||NruI ||| ||PleI ||| |MlyI ||| BsiYI* ||Tsp4CI* ||Hpy99I |MnlI McrI* V Y P L H D R R E D S I L D V F T T I L F I H Y T T V A R T L S S M F L L R Y * L S I T R P S R G L Y P R C F Y Y D T S ----:----|----:----|----:----|----:----|----:----|----:----| T * G N C S R R S S E I R S T K V V I S P K D M V R G D R P S * G R H K * * S V N I W * V V T A L V R D E I N K S R Y * AsuI* AvaII |BmgT120I ||BseMII |||SecI* BsiYI* |||DsaI* | TsoI |||BspCNI AluI | CviJI ||||Tsp4CI* CviJI | HaeIII TspRI ||||| DdeI | SetI MseI BsrI | |BsrI BstXI ||||| |Hpy188I \ \ \ \ \ \\ \ \\\\\ \\ GCTTTTATTAAAAACCAGTTTCAGGCCAGTGTCTTGGTTATACAAATGGACCGTGGTTCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAAATAATTTTTGGTCAAAGTCCGGTCACAGAACCAATATGTTTACCTGGCACCAAGA / / / / /// / //// / / CviJI | BsrI | ||| BstXI |||| | Hpy188I AluI MseI | ||HaeIII |||| DsaI* | ||CviJI |||| SecI* | |TspRI |||Tsp4CI* | |BsrI |||AvaII | TsoI |||AsuI* BsiYI* ||BmgT120I |BspCNI BseMII A F I K N Q F Q A S V L V I Q M D R G S L L L K T S F R P V S W L Y K W T V V L F Y * K P V S G Q C L G Y T N G P W F * ----:----|----:----|----:----|----:----|----:----|----:----| A K I L F W N * A L T K T I C I S R P E L K * * F G T E P W H R P * V F P G H N S K N F V L K L G T D Q N Y L H V T T R AccI FatI |BssNAI ApoI |CviAII |Hpy166II TspEI || NlaIII \\ \ \\ \ GAGTATACTAACAGAACTCTCCATAAATTCCTTGAAAAAAATGGTATAACTCCATGCTAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTCATATGATTGTCTTGAGAGGTATTTAAGGAACTTTTTTTACCATATTGAGGTACGATA / // / / // | |AccI TspEI | |FatI | Hpy166II ApoI | CviAII | BssNAI NlaIII DdeI E Y T N R T L H K F L E K N G I T P C Y S I L T E L S I N S L K K M V * L H A I V Y * Q N S P * I P * K K W Y N S M L Y ----:----|----:----|----:----|----:----|----:----|----:----| S Y V L L V R W L N R S F F P I V G H * Q T Y * C F E G Y I G Q F F H Y L E M S L I S V S S E M F E K F F I T Y S W A I AciI NspBII* | TfiI | HinfI | | AvaI | | Hpy178III* | | |BmeT110I | | || FatI Tsp4CI* | | || SduI |Csp6I | | || HgiAI* ||RsaI | | || |CviAII PleI ||| BceAI | | || || NlaIII |MlyI ||| | SetI | | || || |HinfI || CviJI ||| | BceAI \ \ \\ \\ \\ \\ \ \\\ \ \ ACAACCACAGCGGATTCCCGAGCACATGGAGTCGCTGAACGGCTAAACCGTACCTTATTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGGTGTCGCCTAAGGGCTCGTGTACCTCAGCGACTTGCCGATTTGGCATGGAATAAT / / / /// / // / / / / // / / | | | ||| | || HinfI | CviJI | || | BceAI | | | ||| | |FatI PleI | || BceAI | | | ||| | CviAII MlyI | |Csp6I | | | ||| NlaIII | RsaI | | | ||AvaI | SetI | | | |BmeT110I Tsp4CI* | | | |HgiAI* | | | |SduI | | | Hpy178III* | | HinfI | | TfiI | AciI NspBII* T T T A D S R A H G V A E R L N R T L L Q P Q R I P E H M E S L N G * T V P Y * N H S G F P S T W S R * T A K P Y L I R ----:----|----:----|----:----|----:----|----:----|----:----| V V V A S E R A C P T A S R S F R V K N Y L W L P N G L V H L R Q V A L G Y R I C G C R I G S C M S D S F P * V T G * * Csp6I |RsaI CviRI* BsrDI Hpy166II CviRI* \\ \ \ \ \ GATGACTGCCGTACTCAACTGCAATGTAGTGGTTTACCGAACCATTTATGGTTCTCTGCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGACGGCATGAGTTGACGTTACATCACCAAATGGCTTGGTAAATACCAAGAGACGT // / / / / |Csp6I | BsrDI Hpy166II CviRI* RsaI CviRI* D D C R T Q L Q C S G L P N H L W F S A M T A V L N C N V V V Y R T I Y G S L Q * L P Y S T A M * W F T E P F M V L C N ----:----|----:----|----:----|----:----|----:----|----:----| S S Q R V * S C H L P K G F W K H N E A L H S G Y E V A I Y H N V S G N I T R Q I V A T S L Q L T T T * R V M * P E R C ApoI TspEI | HphI | | MaeI TaqI | | | AluI | ApoI | | | CviJI | TspEI | | | | SetI SetI CviRI* \ \ \ \ \ \ \ \ \ ATCGAATTTTCTACTATTGTGAGAAATTCACTAGCTTCACCTAAAAGCAAAAAATCTGCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTTAAAAGATGATAACACTCTTTAAGTGATCGAAGTGGATTTTCGTTTTTTAGACGT / / / /// / / | TspEI | ||| SetI CviRI* | ApoI | ||CviJI TaqI | ||AluI | |MaeI | SetI TspEI ApoI HphI I E F S T I V R N S L A S P K S K K S A S N F L L L * E I H * L H L K A K N L Q R I F Y Y C E K F T S F T * K Q K I C K ----:----|----:----|----:----|----:----|----:----|----:----| I S N E V I T L F E S A E G L L L F D A L R I K * * Q S F N V L K V * F C F I Q D F K R S N H S I * * S * R F A F F R C EcoRV FatI | TatI |CviAII | |Csp6I || NspI | ||RsaI || NlaIII | ||ScaI || | Cac8I | ||| TaqII || | | Hin4I | ||| |MaeIII || | | Hin4I | ||| || Hin4I HindII || | | CviJI | ||| || Hin4I Hpy166II || | | | MwoI | ||| || | SetI | SetI \\ \ \ \ \ \ \\\ \\ \ \ \ \ AGACAACATGCTGGCTTGGCAGGACTTGATATCAGTACTTTGTTACCTTTCGGTCAACCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTGTACGACCGAACCGTCCTGAACTATAGTCATGAAACAATGGAAAGCCAGTTGGA / // /// / /// / / / // | || ||CviJI EcoRV ||| | | MaeIII |SetI | || |MwoI ||| | SetI Hpy166II | || Cac8I ||| Hin4I HindII | |FatI ||| Hin4I | CviAII ||TaqII | Hin4I ||TatI | Hin4I |Csp6I NlaIII ScaI NspI RsaI R Q H A G L A G L D I S T L L P F G Q P D N M L A W Q D L I S V L C Y L S V N L T T C W L G R T * Y Q Y F V T F R S T C ----:----|----:----|----:----|----:----|----:----|----:----| L C C A P K A P S S I L V K N G K P * G L V V H Q S P L V Q Y * Y K T V K R D V S L M S A Q C S K I D T S Q * R E T L R BseGI | MnlI | |BssKI | |SecI* | |EcoRII | || FokI | || MwoI BsaXI FokI | || ScrFI | MboI | BseGI | || BseBI | BclI | | BsaXI | || | CviJI | | DpnI | | |MslI | || | SfaNI | | |BstKTI FokI | | |BsiI* | || | | TspGWI \ \ \\ \ \ \ \\ \ \\ \ \ \ GTTATCGTCAATGATCACAACCCTAACTCCAAAATACATCCTCGTGGCATCCCAGGCTAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAATAGCAGTTACTAGTGTTGGGATTGAGGTTTTATGTAGGAGCACCGTAGGGTCCGATG / // / / / // / / // //// / BsaXI || BclI FokI | || | | || |||| SfaNI || MboI | || | | || |||TspGWI |DpnI | || | | || |||FokI BstKTI | || | | || ||EcoRII | || | | || ||BssKI | || | | || ||CviJI | || | | || |SecI* | || | | || BseBI | || | | || ScrFI | || | | |MwoI | || | | MnlI | || | BsiI* | || | BseGI | || MslI | |FokI | BsaXI BseGI V I V N D H N P N S K I H P R G I P G Y L S S M I T T L T P K Y I L V A S Q A T Y R Q * S Q P * L Q N T S S W H P R L R ----:----|----:----|----:----|----:----|----:----|----:----| T I T L S * L G L E L I C G R P M G P * Q * R * H D C G * S W F V D E H C G L S N D D I I V V R V G F Y M R T A D W A V Hpy178III* |TaqI || BsmAI MseI || Esp3I Hin4I || | Hin4I FokI Hin4I BseGI || | Hin4I |MboII BseGI | BccI \ \\ \ \ \\ \ \ \ GCTCTACATCCGTCTCGAAACTCTTATGGATATATCATCTATCTTCCATCCTTAAAGAAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGATGTAGGCAGAGCTTTGAGAATACCTATATAGTAGATAGAAGGTAGGAATTTCTTC / /// / / / / / // BseGI ||| Esp3I | FokI | Hin4I |BccI ||| BsmAI MboII | Hin4I MseI ||TaqI BseGI |Hpy178III* Hin4I Hin4I A L H P S R N S Y G Y I I Y L P S L K K L Y I R L E T L M D I S S I F H P * R R S T S V S K L L W I Y H L S S I L K E D ----:----|----:----|----:----|----:----|----:----|----:----| A R C G D R F E * P Y I M * R G D K F F R E V D T E F S K H I Y * R D E M R L S S * M R R S V R I S I D D I K W G * L L TfiI HinfI Tsp4CI* | Hpy178III* |BbvII* | | MboI || MboII | | | DpnI || | Eco57I | | | |BstKTI || | Eco57MI | | | ||TspEI || | | MboII | | | ||| TspEI \\ \ \ \ \ \ \ \\\ \ ACAGTAGATACAACTAACTATGTTATTCTTCAGGGCAAGGAATCCAGATTAGATCAATTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCATCTATGTTGATTGATACAATAAGAAGTCCCGTTCCTTAGGTCTAATCTAGTTAAG / / / / / / // / / | | | MboII | | || | TspEI | | Eco57MI | | || MboI | | Eco57I | | |DpnI | BbvII* | | BstKTI | MboII | Hpy178III* Tsp4CI* HinfI TfiI T V D T T N Y V I L Q G K E S R L D Q F Q * I Q L T M L F F R A R N P D * I N S S R Y N * L C Y S S G Q G I Q I R S I Q ----:----|----:----|----:----|----:----|----:----|----:----| V T S V V L * T I R * P L S D L N S * N S L L Y L * S H * E E P C P I W I L D I C Y I C S V I N N K L A L F G S * I L E MseI |BbvII* || MboII Hpy99I || Tsp4CI* | HgaI || |TspDTI TspDTI | | TaqI || || MseI | HgaI \ \ \ \\ \\ \ \ \ AATTACGACGCACTCACTTTCGATGAAGACTTAAACCGTTTAACTGCTTCATATCATTCG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATGCTGCGTGAGTGAAAGCTACTTCTGAATTTGGCAAATTGACGAAGTATAGTAAGC // // / / / / / |Hpy99I |TaqI | | MseI TspDTI BsrDI TspEI HgaI | Tsp4CI* | TspDTI | BbvII* | MboII MseI N Y D A L T F D E D L N R L T A S Y H S I T T H S L S M K T * T V * L L H I I R L R R T H F R * R L K P F N C F I S F V ----:----|----:----|----:----|----:----|----:----|----:----| L * S A S V K S S S K F R K V A E Y * E * N R R V * K R H L S L G N L Q K M D N I V V C E S E I F V * V T * S S * I M R TfiI BinI* HinfI | MboI | Hin4I | XhoII | Hin4I | | DpnI MboI | | Hpy188I | | |BstKTI | DpnI | | | FatI | | || TfiI | |BstKTI | | | |CviAII BsrDI | | || HinfI | || MseI | | | || NlaIII \ \ \ \\ \ \ \\ \ \ \ \ \\ \ TTCATTGCGTCAAATGAGATCCAAGAATCCAATGATCTTAACATAGAATCTGACCATGAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAACGCAGTTTACTCTAGGTTCTTAGGTTACTAGAATTGTATCTTAGACTGGTACTG / / // / / // / / / // / // HgaI | || XhoII HinfI || | | | || | |FatI | || MboI TfiI || | | | || | CviAII | |DpnI || | | | || NlaIII | BstKTI || | | | |Hpy188I BinI* || | | | HinfI || | | | TfiI || | | Hin4I || | | Hin4I || | MseI || MboI |DpnI BstKTI F I A S N E I Q E S N D L N I E S D H D S L R Q M R S K N P M I L T * N L T M T H C V K * D P R I Q * S * H R I * P * L ----:----|----:----|----:----|----:----|----:----|----:----| N M A D F S I W S D L S R L M S D S W S T * Q T L H S G L I W H D * C L I Q G H E N R * I L D L F G I I K V Y F R V M V BseMII |BspCNI || BseGI || Hin4I || Hin4I || | Hpy178III* AluI || | |DdeI CviJI FokI || | |Bpu10I | SetI |Hpy188I || | || MmeI | | HinfI \\ \\ \ \\ \ \ \ \ TTCCAATCCGACATTGAACTACATCCTGAGCAACCGAGAAATGTCCTTTCAAAAGCTGTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTTAGGCTGTAACTTGATGTAGGACTCGTTGGCTCTTTACAGGAAAGTTTTCGACAC / / // / / // / / | | || BseGI | |MmeI | CviJI | | |BspCNI | Bpu10I | AluI | | |Hin4I | DdeI SetI | | |Hin4I Hpy178III* | | BseMII | FokI Hpy188I F Q S D I E L H P E Q P R N V L S K A V S N P T L N Y I L S N R E M S F Q K L * P I R H * T T S * A T E K C P F K S C E ----:----|----:----|----:----|----:----|----:----|----:----| K W D S M S S C G S C G L F T R E F A T S G I R C Q V V D Q A V S F H G K L L Q E L G V N F * M R L L R S I D K * F S H TfiI HinfI | TaqI | AsuII PleI | | MaeII |MlyI HindII | | AflIII ||TfiI Hpy166II | | |MboII ||HinfI | MmeI | | || SetI Eco57I |||TspGWI SetI | |MnlI | | || TaiI Eco57MI \\\\ \ \ \\ \ \ \\ \ \ AGTCCAACCGATTCCACACCTCCGTCAACTCATACTGAAGATTCGAAACGTGTTTCTAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGGTTGGCTAAGGTGTGGAGGCAGTTGAGTATGACTTCTAAGCTTTGCACAAAGATTT / / / / / / / / // / / / HinfI | | SetI | MnlI | | || | | Eco57MI | HinfI Hpy166II | | || | | Eco57I | TfiI HindII | | || | AflIII TspGWI MmeI | | || MaeII PleI | | |MboII MlyI | | TaiI | | SetI | AsuII | TaqI HinfI TfiI S P T D S T P P S T H T E D S K R V S K V Q P I P H L R Q L I L K I R N V F L K S N R F H T S V N S Y * R F E T C F * N ----:----|----:----|----:----|----:----|----:----|----:----| L G V S E V G G D V * V S S E F R T E L S D L R N W V E T L E Y Q L N S V H K * T W G I G C R R * S M S F I R F T N R F Hpy188I Hin6I |TfiI FnuDII* HindII |HinfI |GlaI Hpy166II || MboII SspI ||HhaI | TaqII || | SspI \ \\\ \ \ \\ \ \ ACCAATATTCGCGCACCCAGAGAAGTTGACCCCAACATATCTGAATCTAATATTCTTCCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTATAAGCGCGTGGGTCTCTTCAACTGGGGTTGTATAGACTTAGATTATAAGAAGGT / /// // / // / SspI ||Hin6I |TaqII | || SspI |GlaI Hpy166II | |HinfI FnuDII* HindII | |TfiI HhaI | MboII Hpy188I T N I R A P R E V D P N I S E S N I L P P I F A H P E K L T P T Y L N L I F F H Q Y S R T Q R S * P Q H I * I * Y S S I ----:----|----:----|----:----|----:----|----:----|----:----| V L I R A G L S T S G L M D S D L I R G F W Y E R V W L L Q G W C I Q I * Y E E G I N A C G S F N V G V Y R F R I N K W Ksp632I* | BccI TaqI | | MboI |Hpy178III* | | BglII || Csp6I | | XhoII || |RsaI | | | DpnI || ||AgeI | | | |BstKTI || ||BetI* | | | ||MaeI ApoI || ||Cfr10I | | | ||| MboII TspEI PpiI || |||HpaII \ \ \ \\\ \ \ \ \\ \\\\ TCAAAGAAGAGATCTAGCACCCCCCAAATTTCCAATATCGAGAGTACCGGTTCGGGTGGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTTCTTCTCTAGATCGTGGGGGGTTTAAAGGTTATAGCTCTCATGGCCAAGCCCACCA / / // / // / / // // // / | | || | |MboII | TspEI || || |Cfr10I PpiI | | || | MaeI | ApoI || || |BetI* | | || XhoII PpiI || || |AgeI | | || BglII || || HpaII | | || MboI || |Csp6I | | |DpnI || RsaI | | BstKTI |Hpy178III* | BccI TaqI Ksp632I* S K K R S S T P Q I S N I E S T G S G G Q R R D L A P P K F P I S R V P V R V V K E E I * H P P N F Q Y R E Y R F G W Y ----:----|----:----|----:----|----:----|----:----|----:----| D F F L D L V G W I E L I S L V P E P P M L S S I * C G G F K W Y R S Y R N P H * L L S R A G G L N G I D L T G T R T T CviRI* | PpiI FatI | EcoT22I FatI |CviAII | | TspEI |CviAII || HinfI | | | MseI BslFI || NlaIII || NlaIII \ \ \ \ \ \\ \ \\ \ ATGCATAAATTAAATGTTCCTTTACTTGCTCCCATGTCCCAATCTAACACACATGAGTCG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTATTTAATTTACAAGGAAATGAACGAGGGTACAGGGTTAGATTGTGTGTACTCAGC / / // / / // / // / | CviRI* |MseI BslFI | |FatI | || Hpy99I EcoT22I TspEI | CviAII | || HinfI NlaIII | |FatI | CviAII NlaIII M H K L N V P L L A P M S Q S N T H E S C I N * M F L Y L L P C P N L T H M S R A * I K C S F T C S H V P I * H T * V V ----:----|----:----|----:----|----:----|----:----|----:----| I C L N F T G K S A G M D W D L V C S D Y A Y I L H E K V Q E W T G I * C V H T H M F * I N R * K S G H G L R V C M L R Hpy188I | MlyI | PleI | | DdeI | | | Hpy188I | | | |HinfI | | | || Csp6I | | | || |BdaI | | | || |BdaI | | | || |RsaI | | | || || BspCNI PleI | | | || || Tsp4CI* Hpy99I | | | || || |BseMII |MlyI | | | || || || BsmAI ||Cac8I | | | || || || | TspRI ||| BsrI | | | || || || | | BaeI \\\ \ \ \ \ \\ \\ \\ \ \ \ TCGCACGCCAGTAAATCTAAAGATTTCAGACACTCAGACTCGTACAGTGAAAATGAGACT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGTGCGGTCATTTAGATTTCTAAAGTCTGTGAGTCTGAGCATGTCACTTTTACTCTGA /// / // // ////// / / ||BsrI | || || |||||| | BsmAI |Cac8I | || || |||||| BaeI PleI | || || |||||Tsp4CI* MlyI | || || |||||BseMII | || || ||||BspCNI | || || ||||Csp6I | || || |||RsaI | || || ||TspRI | || || |BdaI | || || |BdaI | || || HinfI | || |DdeI | || Hpy188I | |PleI | MlyI Hpy188I S H A S K S K D F R H S D S Y S E N E T R T P V N L K I S D T Q T R T V K M R L A R Q * I * R F Q T L R L V Q * K * D * ----:----|----:----|----:----|----:----|----:----|----:----| D C A L L D L S K L C E S E Y L S F S V T A R W Y I * L N * V S L S T C H F H S R V G T F R F I E S V * V R V T F I L S MaeII | Csp6I Acc65I | |RsaI HgiCI* | |SetI BsrI |Csp6I | |TaiI | Csp6I ||RsaI | || BdaI | |RsaI ||NlaIV Tsp4CI* | || BdaI | || BaeI ||| KpnI | AciI \ \\ \ \ \\ \ \\\ \ \ \ AATCATACAAACGTACCAATATCCAGTACGGGTGGTACCAACAACAAAACTGTTCCGCAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTATGTTTGCATGGTTATAGGTCATGCCCACCATGGTTGTTGTTTTGACAAGGCGTC / /// / / // / /// / / | ||Csp6I | | |Csp6I | ||HgiCI* | AciI | ||BdaI | | RsaI | ||Acc65I Tsp4CI* | ||BdaI | BaeI | |Csp6I | |RsaI BsrI | NlaIV | MaeII | RsaI TaiI KpnI SetI N H T N V P I S S T G G T N N K T V P Q I I Q T Y Q Y P V R V V P T T K L F R R S Y K R T N I Q Y G W Y Q Q Q N C S A D ----:----|----:----|----:----|----:----|----:----|----:----| L * V F T G I D L V P P V L L L V T G C * D Y L R V L I W Y P H Y W C C F Q E A I M C V Y W Y G T R T T G V V F S N R L MaeIII Tsp45I Tsp4CI* | BsmAI | Hpy166II TaqI | |BseMII | | SfaNI ClaI | ||BspCNI DdeI HphI | | | SetI | Hin4II* \ \\\ \ \ \ \ \ \ \ \ ATAAGTGACCAAGAGACTGAGAAAAGGATTATACACCGTTCACCTTCAATCGATGCTTCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TATTCACTGGTTCTCTGACTCTTTTCCTAATATGTGGCAAGTGGAAGTTAGCTACGAAGA // / / / / / // / / || | BsmAI DdeI HphI | |SetI SfaNI Hin4II* || Tsp45I | Hpy166II ClaI || MaeIII Tsp4CI* TaqI |BspCNI BseMII I S D Q E T E K R I I H R S P S I D A S * V T K R L R K G L Y T V H L Q S M L L K * P R D * E K D Y T P F T F N R C F S ----:----|----:----|----:----|----:----|----:----|----:----| I L S W S V S F L I I C R E G E I S A E S L H G L S Q S F S * V G N V K L R H K Y T V L L S L F P N Y V T * R * D I S R BtgZI |BetI* ||HpaII Tsp4CI* |||TspDTI TspEI SspI AjuI | Hpy188I \\\\ \ \ \ \ \ CCACCGGAAAATAATTCATCGCACAATATTGTTCCTATCAAAACGCCAACTACTGTTTCT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGGCCTTTTATTAAGTAGCGTGTTATAACAAGGATAGTTTTGCGGTTGATGACAAAGA / // / / / / / | |BetI* TspEI SspI AjuI | Hpy188I | HpaII Tsp4CI* | BtgZI TspDTI P P E N N S S H N I V P I K T P T T V S H R K I I H R T I L F L S K R Q L L F L T G K * F I A Q Y C S Y Q N A N Y C F * ----:----|----:----|----:----|----:----|----:----|----:----| G G S F L E D C L I T G I L V G V V T E E V P F Y N M A C Y Q E * * F A L * Q K W R F I I * R V I N N R D F R W S S N R MboI | DpnI | |BstKTI | || GsuI | || Eco57MI | || | MboI MnlI | || | | DpnI | BtgZI | || | | |BstKTI | | AjuI | || | | || SetI | | SecI* | || | | || |Hpy178III* | | | TfiI | || | | || || TfiI | | | HinfI | || | | || || HinfI \ \ \ \ \ \\ \ \ \\ \\ \ GAACAGAATACCGAGGAATCTATCATCGCTGATCTCCCACTCCCTGATCTACCTCCAGAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTCTTATGGCTCCTTAGATAGTAGCGACTAGAGGGTGAGGGACTAGATGGAGGTCTT // / / / // / / // // / |AjuI | | HinfI || | Eco57MI || |SetI Hpy178III* MnlI | | TfiI || | GsuI || MboI | SecI* || MboI |DpnI BtgZI |DpnI BstKTI BstKTI E Q N T E E S I I A D L P L P D L P P E N R I P R N L S S L I S H S L I Y L Q N T E Y R G I Y H R * S P T P * S T S R I ----:----|----:----|----:----|----:----|----:----|----:----| S C F V S S D I M A S R G S G S R G G S Q V S Y R P I * * R Q D G V G Q D V E L F L I G L F R D D S I E W E R I * R W F ApoI MseI TspEI |AhaIII* ApoI MnlI EcoRI || Hin4I TspEI TspEI \ \ \\ \ \ \ TCTCCTACCGAATTCCCTGACCCATTTAAAGAACTCCCACCGATAAATTCTCATCAAACT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGATGGCTTAAGGGACTGGGTAAATTTCTTGAGGGTGGCTATTTAAGAGTAGTTTGA / / // / // HinfI EcoRI |Hin4I TspEI |Hin4I MnlI TspEI |MseI ApoI TaqII TfiI ApoI AhaIII* S P T E F P D P F K E L P P I N S H Q T L L P N S L T H L K N S H R * I L I K L S Y R I P * P I * R T P T D K F S S N * ----:----|----:----|----:----|----:----|----:----|----:----| D G V S N G S G N L S S G G I F E * * V I E * R I G Q G M * L V G V S L N E D F R R G F E R V W K F F E W R Y I R M L S MlyI PleI TaqII | MaeIII | BsrI | Tsp45I | Hin4I | | HinfI HphI Tsp4CI* \ \ \ \ \ \ \ AATTCCAGTTTGGGTGGTATTGGTGACTCTAATGCCTATACTACTATCAACAGTAAGAAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGGTCAAACCCACCATAACCACTGAGATTACGGATATGATGATAGTTGTCATTCTTT // // // / / |TspEI |PleI || HphI Tsp4CI* BsrI MlyI |HinfI Tsp45I MaeIII N S S L G G I G D S N A Y T T I N S K K I P V W V V L V T L M P I L L S T V R K F Q F G W Y W * L * C L Y Y Y Q Q * E K ----:----|----:----|----:----|----:----|----:----|----:----| L E L K P P I P S E L A * V V I L L L F * N W N P H Y Q H S * H R Y * * * C Y S I G T Q T T N T V R I G I S S D V T L F MboII | TspEI | | MseI | | | TspDTI | | | | SetI | | | | BsmAI | | | | | BsiI* | | | | | Hpy178III* | | | | | | FatI MboI | | | | | | |CviAII | DpnI | | | | | | || NlaIII | |BstKTI | | | | | | || | DdeI \ \\ \ \ \ \ \ \ \\ \ \ AGATCATTAGAAGATAATGAAACTGAAATTAAGGTATCACGAGACACATGGAATACTAAG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGTAATCTTCTATTACTTTGACTTTAATTCCATAGTGCTCTGTGTACCTTATGATTC // / / // // / / // / || MboI MboII |MseI || | | |FatI DdeI |DpnI |SetI || | | CviAII BstKTI TspDTI || | NlaIII TspEI || BsiI* |Hpy178III* BsmAI R S L E D N E T E I K V S R D T W N T K D H * K I M K L K L R Y H E T H G I L R I I R R * * N * N * G I T R H M E Y * E ----:----|----:----|----:----|----:----|----:----|----:----| L D N S S L S V S I L T D R S V H F V L F I M L L Y H F Q F * P I V L C M S Y * S * * F I I F S F N L Y * S V C P I S L SetI | Hpy188I | | MboI | | | DpnI TseI | | | |TaqI CviRI* | | | |BstKTI |BisI | | | || HphI ||BlsI | | | || | ApoI |||AluI | | | || | TspEI |||CviJI | | | || | EcoRI |||PvuII | | | || | | MboII |||NspBII* | | | ||MnlI | | | SetI |||| SetI \ \ \ \\\ \ \ \ \ \\\\ \ AATATGCGTAGTTTAGAACCTCCGAGATCGAAGAAACGAATTCACCTGATTGCAGCTGTA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTATACGCATCAAATCTTGGAGGCTCTAGCTTCTTTGCTTAAGTGGACTAACGTCGACAT / / ///// / /// //// / SetI | ||||| HphI ||SetI |||| MwoI | ||||TaqI |EcoRI |||NspBII* | |||MboI |TspEI |||PvuII | ||MnlI |ApoI |||CviJI | |DpnI MboII |||TseI | BstKTI |||AluI Hpy188I ||BisI |BlsI |SetI CviRI* N M R S L E P P R S K K R I H L I A A V I C V V * N L R D R R N E F T * L Q L * Y A * F R T S E I E E T N S P D C S C K ----:----|----:----|----:----|----:----|----:----|----:----| F I R L K S G G L D F F R I * R I A A T S Y A Y N L V E S I S S V F E G S Q L Q I H T T * F R R S R L F S N V Q N C S Y MnlI MwoI TspGWI | BbvI SetI | HphI \ \ \ \ \ AAAGCAGTAAAATCAATCAAACCAATACGGACAACCTTACGATACGATGAGGCAATCACC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGTCATTTTAGTTAGTTTGGTTATGCCTGTTGGAATGCTATGCTACTCCGTTAGTGG / / // / / BbvI SetI |MnlI HphI SetI TspGWI K A V K S I K P I R T T L R Y D E A I T K Q * N Q S N Q Y G Q P Y D T M R Q S P S S K I N Q T N T D N L T I R * G N H L ----:----|----:----|----:----|----:----|----:----|----:----| F A T F D I L G I R V V K R Y S S A I V L L L L I L * V L V S L R V I R H P L * F C Y F * D F W Y P C G * S V I L C D G HindII SetI MseI MnlI TaqI Hpy166II \ \ \ \ \ TATAATAAAGATATTAAAGAAAAAGAAAAATATATCGAGGCATACCACAAAGAAGTCAAC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTATTTCTATAATTTCTTTTTCTTTTTATATAGCTCCGTATGGTGTTTCTTCAGTTG / / / / MseI MnlI TaqI Hpy166II HindII Y N K D I K E K E K Y I E A Y H K E V N I I K I L K K K K N I S R H T T K K S T * * R Y * R K R K I Y R G I P Q R S Q P ----:----|----:----|----:----|----:----|----:----|----:----| * L L S I L S F S F Y I S A Y W L S T L R Y Y L Y * L F L F I Y R P M G C L L * I I F I N F F F F F I D L C V V F F D V TspDTI | TspRI | | SspI | | BslFI \ \ \ CAACTATTGAAAATGAATACTTGGGACACTGACAAATATTATGACAGAAAAGAAATAGAC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGATAACTTTTACTTATGAACCCTGTGACTGTTTATAATACTGTCTTTTCTTTATCTG / / / / | TspDTI | BslFI TspRI SspI Q L L K M N T W D T D K Y Y D R K E I D N Y * K * I L G T L T N I M T E K K * T T I E N E Y L G H * Q I L * Q K R N R P ----:----|----:----|----:----|----:----|----:----|----:----| W S N F I F V Q S V S L Y * S L F S I S G V I S F S Y K P C Q C I N H C F L F L L * Q F H I S P V S V F I I V S F F Y V MaeII |MaeIII |Tsp45I BdaI || SetI MboII BdaI || TaiI \ \ \\ \ CCTAAAAGAGTAATAAACTCAATGTTTATCTTCAACAAGAAACGTGACGGAACTCATAAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTTTCTCATTATTTGAGTTACAAATAGAAGTTGTTCTTTGCACTGCCTTGAGTATTT / / / / / // MboII BdaI | | Tsp45I |TspGWI BdaI | | MaeIII SetI | MaeII TaiI SetI P K R V I N S M F I F N K K R D G T H K L K E * * T Q C L S S T R N V T E L I K * K S N K L N V Y L Q Q E T * R N S * S ----:----|----:----|----:----|----:----|----:----|----:----| G L L T I F E I N I K L L F R S P V * L G * F L L L S L T * R * C S V H R F E Y R F S Y Y V * H K D E V L F T V S S M F AluI BseGI CviJI |HphI |MaeI || Hpy178III* |TspGWI || | SfaNI || BdaI || | |MaeII || BdaI || | ||SplI* || | MnlI || | ||BsaAI || | | CviRI* || | ||SnaBI || | | | FokI || | |||Csp6I || | | | | MaeIII || | ||||RsaI || | | | | Tsp45I || | ||||SetI SetI ||SetI | | | | | SetI || | ||||TaiI | CviRI* \\\ \ \ \ \ \ \ \\ \ \\\\\ \ \ GCTAGATTTGTTGCAAGAGGTGACATTCAGCATCCTGATACGTACGATACAGGTATGCAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CGATCTAAACAACGTTCTCCACTGTAAGTCGTAGGACTATGCATGCTATGTCCATACGTT / / / / / / / / / / / / ///// / / | | | | | | | | | HphI | | ||||| SetI CviRI* | | | | | | | | BseGI | | ||||SplI* | | | | | | | Tsp45I | | |||Csp6I | | | | | | | MaeIII | | ||SfaNI | | | | | | FokI | | ||RsaI | | | | | SetI | | |MaeII | | | | CviRI* | | SnaBI | | | MnlI | | BsaAI | | BdaI | TaiI | | BdaI | SetI | MaeI Hpy178III* CviJI AluI A R F V A R G D I Q H P D T Y D T G M Q L D L L Q E V T F S I L I R T I Q V C N * I C C K R * H S A S * Y V R Y R Y A I ----:----|----:----|----:----|----:----|----:----|----:----| A L N T A L P S M * C G S V Y S V P I C L * I Q Q L L H C E A D Q Y T R Y L Y A S S K N C S T V N L M R I R V I C T H L TatI Tsp4CI* Bsp1407I |Csp6I ||RsaI BseGI |||TspRI | DrdI |||| MslI | | MaeIII |||| |FokI MmeI | | Tsp45I CviRI* \\\\ \\ \ \ \ \ \ TCCAACACTGTACATCATTATGCGTTGATGACATCCCTGTCACTTGCATTAGACAATAAC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGTGACATGTAGTAATACGCAACTACTGTAGGGACAGTGAACGTAATCTGTTATTG / / /// / / / / / / / | | ||| MslI | MmeI | DrdI | CviRI* | | ||Bsp1407I FokI BseGI Tsp45I | | ||TatI MaeIII | | |Csp6I | | RsaI | Tsp4CI* TspRI S N T V H H Y A L M T S L S L A L D N N P T L Y I I M R * * H P C H L H * T I T Q H C T S L C V D D I P V T C I R Q * L ----:----|----:----|----:----|----:----|----:----|----:----| D L V T C * * A N I V D R D S A N S L L I W C Q V D N H T S S M G T V Q M L C Y G V S Y M M I R Q H C G Q * K C * V I V TspEI | MboII CviRI* TspEI \ \ \ \ TACTATATTACACAATTAGACATATCTTCGGCATATTTGTATGCAGACATCAAAGAAGAA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| ATGATATAATGTGTTAATCTGTATAGAAGCCGTATAAACATACGTCTGTAGTTTCTTCTT // / |TspEI CviRI* MboII Y Y I T Q L D I S S A Y L Y A D I K E E T I L H N * T Y L R H I C M Q T S K K N L Y Y T I R H I F G I F V C R H Q R R I ----:----|----:----|----:----|----:----|----:----|----:----| * * I V C N S M D E A Y K Y A S M L S S S S Y * V I L C I K P M N T H L C * L L V I N C L * V Y R R C I Q I C V D F F F TspDTI | MaeII MnlI | | SetI MboII SetI | BsiYI* | | TaiI \ \ \ \ \ \ \ TTATACATAAGACCTCCACCACATTTAGGAATGAATGATAAGTTGATACGTTTGAAGAAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| AATATGTATTCTGGAGGTGGTGTAAATCCTTACTTACTATTCAACTATGCAAACTTCTTT / / / / / / / | | SetI BsiYI* | | MaeII | MboII MnlI | TaiI TspEI | SetI TspDTI L Y I R P P P H L G M N D K L I R L K K Y T * D L H H I * E * M I S * Y V * R N I H K T S T T F R N E * * V D T F E E I ----:----|----:----|----:----|----:----|----:----|----:----| N Y M L G G G C K P I F S L N I R K F F I I C L V E V V N L F S H Y T S V N S S * V Y S R W W M * S H I I L Q Y T Q L F Csp6I |RsaI MboII |BsrI SetI \ \\ \ TCACTTTATGGATTGAAACAAAGTGGAGCGAACTGGTACGAAACTATCAAATCATACCTG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGAAATACCTAACTTTGTTTCACCTCGCTTGACCATGCTTTGATAGTTTAGTATGGAC / / // / MboII | |Csp6I SetI | RsaI BsrI S L Y G L K Q S G A N W Y E T I K S Y L H F M D * N K V E R T G T K L S N H T * T L W I E T K W S E L V R N Y Q I I P D ----:----|----:----|----:----|----:----|----:----|----:----| D S * P N F C L P A F Q Y S V I L D Y R I V K H I S V F H L S S T R F * * I M G * K I S Q F L T S R V P V F S D F * V Q FatI BseGI |CviAII || NlaIII Tsp4CI* XmnI || | FokI | TspRI | BccI MboII || | | MseI MaeIII \ \ \ \ \ \\ \ \ \ \ ATAAAACAGTGTGGTATGGAAGAAGTTCGTGGATGGTCATGCGTATTTAAGAATAGTCAA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTTGTCACACCATACCTTCTTCAAGCACCTACCAGTACGCATAAATTCTTATCAGTT / / / / / / / // // | Tsp4CI* | | | | | |FatI |MseI TspRI | | | | | CviAII FokI | | | | NlaIII | | | BseGI | | MboII | BccI XmnI I K Q C G M E E V R G W S C V F K N S Q * N S V V W K K F V D G H A Y L R I V K K T V W Y G R S S W M V M R I * E * S S ----:----|----:----|----:----|----:----|----:----|----:----| I F C H P I S S T R P H D H T N L F L * S L V T H Y P L L E H I T M R I * S Y D Y F L T T H F F N T S P * A Y K L I T L MseI | BdaI BdaI | BdaI TspEI BdaI | | CviRI* \ \ \ \ \ GTAACAATTTGCTTATTCGTTGATGATATGATATTGTTCAGCAAAGACTTAAATGCAAAT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CATTGTTAAACGAATAAGCAACTACTATACTATAACAAGTCGTTTCTGAATTTACGTTTA / / / // / | TspEI BdaI || CviRI* MaeIII BdaI |MseI BdaI BdaI V T I C L F V D D M I L F S K D L N A N * Q F A Y S L M I * Y C S A K T * M Q I N N L L I R * * Y D I V Q Q R L K C K * ----:----|----:----|----:----|----:----|----:----|----:----| T V I Q K N T S S I I N N L L S K F A F L L L K S I R Q H Y S I T * C L S L H L Y C N A * E N I I H Y Q E A F V * I C I SmlI Hin4I Bce83I* | Hpy178III* Hin4I TaqII \ \ \ \ \ AAGAAAATCATAACAACACTCAAGAAACAATACGATACAAAGATAATAAATCTGGGTGAA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTAGTATTGTTGTGAGTTCTTTGTTATGCTATGTTTCTATTATTTAGACCCACTT / / / / / Bce83I* | Hin4I TaqII Hin4I | Hin4I Hin4I Hpy178III* SmlI K K I I T T L K K Q Y D T K I I N L G E R K S * Q H S R N N T I Q R * * I W V K E N H N N T Q E T I R Y K D N K S G * K ----:----|----:----|----:----|----:----|----:----|----:----| L F I M V V S L F C Y S V F I I F R P S Y S F * L L V * S V I R Y L S L L D P H L F D Y C C E L F L V I C L Y Y I Q T F Hin4I Hin4I | HphI | | ApoI Csp6I CviJI | | TspEI |RsaI |DdeI MnlI SetI \ \ \ \\ \\ \ \ AGTGATAACGAAATTCAGTACGACATACTTGGCTTAGAAATCAAATATCAAAGAGGTAAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTATTGCTTTAAGTCATGCTGTATGAACCGAATCTTTAGTTTATAGTTTCTCCATTT / / // / / / / HphI | |Csp6I | DdeI MnlI SetI | RsaI CviJI TspEI ApoI S D N E I Q Y D I L G L E I K Y Q R G K V I T K F S T T Y L A * K S N I K E V N * * R N S V R H T W L R N Q I S K R * I ----:----|----:----|----:----|----:----|----:----|----:----| L S L S I * Y S M S P K S I L Y * L P L F H Y R F E T R C V Q S L F * I D F L Y T I V F N L V V Y K A * F D F I L S T F MaeII | Csp6I FatI | |RsaI |CviAII | |SetI || NlaIII SetI | |TaiI || |TspEI | TspDTI TspEI | || SetI \\ \\ \ \ \ \ \\ \ TACATGAAATTAGGTATGGAAAAATCCTTGACAGAAAAATTACCCAAACTAAACGTACCT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTACTTTAATCCATACCTTTTTAGGAACTGTCTTTTTAATGGGTTTGATTTGCATGGA / // / / / / /// | |FatI TspEI TspDTI TspEI | ||Csp6I | | SetI | |RsaI | CviAII | |SetI NlaIII | MaeII TaiI SetI Y M K L G M E K S L T E K L P K L N V P T * N * V W K N P * Q K N Y P N * T Y L H E I R Y G K I L D R K I T Q T K R T F ----:----|----:----|----:----|----:----|----:----|----:----| Y M F N P I S F D K V S F N G L S F T G I C S I L Y P F I R S L F I V W V L R V V H F * T H F F G Q C F F * G F * V Y R AluI CviJI Ecl136II | SetI | SduI | SacI | BssKI | EcoRII | HgiAI* | HgiJII* | | ScrFI | | BseBI | | | SetI | | | |HindII | | | |Hpy166II | | | || BssKI | | | || SexAI | | | || EcoRII BssKI | | | || | ScrFI EcoRII GsuI | | | || | BseBI | ScrFI Eco57MI DdeI | | | || | | SetI | BseBI \ \ \ \ \ \\ \ \ \ \ \ TTGAACCCAAAAGGAAAGAAACTTAGAGCTCCAGGTCAACCAGGTCTTTATATAGACCAG 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTGGGTTTTCCTTTCTTTGAATCTCGAGGTCCAGTTGGTCCAGAAATATATCTGGTC / // / // / / // / / Eco57MI || | || | | || EcoRII BseBI GsuI || | || | | || SexAI ScrFI || | || | | || BssKI || | || | | |BseBI || | || | | |ScrFI || | || | | SetI || | || | Hpy166II || | || | HindII || | || EcoRII || | || BssKI || | |BseBI || | |ScrFI || | SetI || Ecl136II || CviJI || AluI |HgiJII* |HgiAI* |SacI |SduI |SetI DdeI L N P K G K K L R A P G Q P G L Y I D Q * T Q K E R N L E L Q V N Q V F I * T R E P K R K E T * S S R S T R S L Y R P G ----:----|----:----|----:----|----:----|----:----|----:----| K F G F P F F S L A G P * G P R * I S W K S G L L F S V * L E L D V L D K Y L G Q V W F S L F K S S W T L W T K I Y V L Hin4II* |MboII ||TspDTI ||| TspDTI ||| | Csp6I ||| | |RsaI ||| | |SetI ||| | ||FatI ||| | |||CviAII BseGI FokI ||| | |||| NlaIII TspDTI |MaeI | TspDTI ||| | |||| | CviRI* |MmeI \\ \ \ \\\ \ \\\\ \ \ \\ GATGAACTAGAAATAGATGAAGATGAATACAAAGAGAAGGTACATGAAATGCAAAAGTTG 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTGATCTTTATCTACTTCTACTTATGTTTCTCTTCCATGTACTTTACGTTTTCAAC / / / / / // // // // / // / | | MaeI | FokI || || || |FatI | || TspDTI | BseGI TspDTI || || || | | |MmeI EcoRII || || || | | TspDTI BssKI || || || | CviRI* || || || CviAII || || |NlaIII || || |Csp6I || || RsaI || |SetI || TspDTI |TspDTI |MboII Hin4II* D E L E I D E D E Y K E K V H E M Q K L M N * K * M K M N T K R R Y M K C K S * * T R N R * R * I Q R E G T * N A K V D ----:----|----:----|----:----|----:----|----:----|----:----| S S S S I S S S S Y L S F T C S I C F N P H V L F L H L H I C L S P V H F A F T I F * F Y I F I F V F L L Y M F H L L Q TspDTI | MaeI | | AluI | | CviJI | | | SetI ApoI | | | | NdeI TspEI \ \ \ \ \ \ ATTGGTCTAGCTTCATATGTTGGATATAAATTTAGATTTGACTTACTATACTACATCAAC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCAGATCGAAGTATACAACCTATATTTAAATCTAAACTGAATGATATGATGTAGTTG /// / / ||CviJI NdeI TspEI ||AluI ApoI |MaeI SetI I G L A S Y V G Y K F R F D L L Y Y I N L V * L H M L D I N L D L T Y Y T T S T W S S F I C W I * I * I * L T I L H Q H ----:----|----:----|----:----|----:----|----:----|----:----| I P R A E Y T P Y L N L N S K S Y * M L S Q D L K M H Q I Y I * I Q S V I S C * N T * S * I N S I F K S K V * * V V D V FatI |CviAII || BdaI || BdaI || NlaIII || | NdeI || | |CspCI MaeI MnlI || | || TspDTI \ \ \\ \ \\ \ ACACTTGCTCAACATATACTATTCCCCTCTAGGCAAGTTTTAGACATGACATATGAGTTG 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGAACGAGTTGTATATGATAAGGGGAGATCCGTTCAAAATCTGTACTGTATACTCAAC / / / /// / / / | MnlI | ||| | | TspDTI MaeI | ||| | NdeI | ||| CspCI | ||FatI | |CviAII | BdaI | BdaI NlaIII T L A Q H I L F P S R Q V L D M T Y E L H L L N I Y Y S P L G K F * T * H M S * T C S T Y T I P L * A S F R H D I * V D ----:----|----:----|----:----|----:----|----:----|----:----| V S A * C I S N G E L C T K S M V Y S N C V Q E V Y V I G R * A L K L C S M H T C K S L M Y * E G R P L N * V H C I L Q TspEI | FatI MaeI | |CviAII | BdaI CspCI | || NlaIII | BdaI |BslFI SetI \ \\ \ \ \ \\ \ ATACAATTCATGTGGGACACTAGAGATAAACAACTGATATGGCACAAAAACAAACCTACC 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TATGTTAAGTACACCCTGTGATCTCTATTTGTTGACTATACCGTGTTTTTGTTTGGATGG / // / / / / / | |FatI | | CspCI BslFI SetI | CviAII | MaeI NlaIII BdaI TspEI BdaI I Q F M W D T R D K Q L I W H K N K P T Y N S C G T L E I N N * Y G T K T N L P T I H V G H * R * T T D M A Q K Q T Y R ----:----|----:----|----:----|----:----|----:----|----:----| I C N M H S V L S L C S I H C L F L G V S V I * T P C * L Y V V S I A C F C V * Y L E H P V S S I F L Q Y P V F V F R G SpeI |MaeI FalI || FalI FalI || FalI | Tsp4CI* CviJI || | SfaNI | | PsiI \ \\ \ \ \ \ \ GAGCCAGATAATAAACTAGTCGCAATAAGTGATGCTTCGTATGGCAACCAACCGTATTAT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGTCTATTATTTGATCAGCGTTATTCACTACGAAGCATACCGTTGGTTGGCATAATA / / // / / / / CviJI FalI |SpeI SfaNI FalI | PsiI FalI MaeI FalI Tsp4CI* E P D N K L V A I S D A S Y G N Q P Y Y S Q I I N * S Q * V M L R M A T N R I I A R * * T S R N K * C F V W Q P T V L * ----:----|----:----|----:----|----:----|----:----|----:----| S G S L L S T A I L S A E Y P L W G Y * R A L Y Y V L R L L H H K T H C G V T N L W I I F * D C Y T I S R I A V L R I I TspDTI MnlI Hpy166II |SetI | StyI TspEI MseI |TspEI | SecI* \ \ \\ \ \ AAATCACAAATTGGCAACATATATTTACTTAATGGAAAGGTAATTGGAGGAAAGTCCACC 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTGTTTAACCGTTGTATATAAATGAATTACCTTTCCATTAACCTCCTTTCAGGTGG / / / / / / / TspEI MseI | MnlI TspEI | Hpy166II SetI TspDTI K S Q I G N I Y L L N G K V I G G K S T N H K L A T Y I Y L M E R * L E E S P P I T N W Q H I F T * W K G N W R K V H Q ----:----|----:----|----:----|----:----|----:----|----:----| L D C I P L M Y K S L P F T I P P F D V Y I V F Q C C I N V * H F P L Q L F T W F * L N A V Y I * K I S L Y N S S L G G MseI | MslI | |FatI | |AflIII | |BspLU11I* | ||CviAII | ||| TatI | ||| |NspI | ||| |Csp6I TspGWI TfiI | ||| |NlaIII | BslFI BarI CviJI | ||| ||RsaI BarI | FnuDII* HinfI \ \ \\\ \\\ \ \ \ \ AAGGCTTCATTAACATGTACTTCAACTACGGAAGCAGAAATACACGCGATAAGTGAATCT 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGAAGTAATTGTACATGAAGTTGATGCCTTCGTCTTTATGTGCGCTATTCACTTAGA // // ///// / / / / |CviJI || ||||TatI | | BslFI HinfI SecI* || |||Csp6I | | BarI TfiI StyI || ||RsaI | FnuDII* || ||BarI TspGWI || |BspLU11I* || |AflIII || |FatI || CviAII |NlaIII |NspI MslI MseI K A S L T C T S T T E A E I H A I S E S R L H * H V L Q L R K Q K Y T R * V N L G F I N M Y F N Y G S R N T R D K * I C ----:----|----:----|----:----|----:----|----:----|----:----| L A E N V H V E V V S A S I C A I L S D W P K M L M Y K L * P L L F V R S L H I L S * * C T S * S R F C F Y V R Y T F R FalI DdeI FalI MseI | MaeIII SetI MseI TspEI MseI \ \ \ \ \ \ \ GTCCCATTATTAAATAATCTAAGTTACCTGATACAAGAACTTAACAAGAAACCAATTATT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CAGGGTAATAATTTATTAGATTCAATGGACTATGTTCTTGAATTGTTCTTTGGTTAATAA / / / / / / / MseI | | MaeIII MseI FalI TspEI | SetI FalI DdeI V P L L N N L S Y L I Q E L N K K P I I S H Y * I I * V T * Y K N L T R N Q L L P I I K * S K L P D T R T * Q E T N Y * ----:----|----:----|----:----|----:----|----:----|----:----| T G N N F L R L * R I C S S L L F G I I Q G M I L Y D L N G S V L V * C S V L * D W * * I I * T V Q Y L F K V L F W N N MboI | DpnI | |FalI | |FalI | |BstKTI | || MboI | || | DpnI | || | |BstKTI AccI | || | || TspEI Hin4I CviJI | || | || |Hin4I Hin4I | Hin4I Hin4I | || | || |Hin4I |Hpy166II | Hin4I Hin4I | || | || || MseI || Ksp632I* \ \ \ \ \\ \ \\ \\ \ \\ \ AAAGGCTTACTTACTGATAGTAGATCAACGATCAGTATAATTAAGTCTACAAATGAAGAG 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCGAATGAATGACTATCATCTAGTTGCTAGTCATATTAATTCAGATGTTTACTTCTC // / / / // / // // /// // / || | Hin4I | || | || |Hin4I ||| |AccI Ksp632I* || | Hin4I | || | || |Hin4I ||| Hpy166II || CviJI | || | || MboI ||MseI |Hin4I | || | |DpnI |TspEI |Hin4I | || | BstKTI Hin4I MseI | || MboI Hin4I | |DpnI | BstKTI FalI FalI K G L L T D S R S T I S I I K S T N E E K A Y L L I V D Q R S V * L S L Q M K R R L T Y * * * I N D Q Y N * V Y K * R E ----:----|----:----|----:----|----:----|----:----|----:----| L P K S V S L L D V I L I I L D V F S S * L S V * Q Y Y I L S * Y L * T * L H L F A * K S I T S * R D T Y N L R C I F L Hin4I Hin4I ApoI MboII |BsrDI TspEI |TspDTI BsmAI || DdeI SetI \ \\ \ \\ \ \ AAATTTAGAAACAGATTTTTTGGCACAAAGGCAATGAGACTTAGAGATGAAGTATCAGGT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAATCTTTGTCTAAAAAACCGTGTTTCCGTTACTCTGAATCTCTACTTCATAGTCCA // / / / / / / |TspDTI | | BsrDI DdeI | TspDTI |MboII | BsmAI SetI TspEI Hin4I ApoI Hin4I K F R N R F F G T K A M R L R D E V S G N L E T D F L A Q R Q * D L E M K Y Q V I * K Q I F W H K G N E T * R * S I R * ----:----|----:----|----:----|----:----|----:----|----:----| F N L F L N K P V F A I L S L S S T D P S I * F C I K Q C L P L S V * L H L I L F K S V S K K A C L C H S K S I F Y * T Hin4I Hin4I | MaeII | |BsaAI | |SnaBI | || AccI | || SetI | || TaiI | || |BssNAI | || |Hpy166II | || || BsmAI | || || Eco31I TspDTI | || || | TaqI Hin4I |TspEI | || || | |Hpy178III* BsrDI MboII MboII \\ \ \\ \\ \ \\ \ \ \ AATAATTTATACGTATACTACATCGAGACCAAGAAGAACATTGCTGATGTGATGACAAAA 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTAAATATGCATATGATGTAGCTCTGGTTCTTCTTGTAACGACTACACTACTGTTTT / / / // // / // / / / / / | | | || |AccI | || | | MboII | SetI | | | || | | || | Hin4I MboII | | | || | | || BsrDI | | | || | | |Hpy178III* | | | || | | TaqI | | | || | Eco31I | | | || | BsmAI | | | || Hpy166II | | | || BssNAI | | | |MaeII | | | SnaBI | | | BsaAI | | TaiI | | SetI | TspEI Hin4I Hin4I N N L Y V Y Y I E T K K N I A D V M T K I I Y T Y T T S R P R R T L L M * * Q N * F I R I L H R D Q E E H C * C D D K T ----:----|----:----|----:----|----:----|----:----|----:----| L L K Y T Y * M S V L F F M A S T I V F Y Y N I R I S C R S W S S C Q Q H S S L I I * V Y V V D L G L L V N S I H H C F Hin4I Hpy188I | MseI Ksp632I* | |AhaIII* TfiI SetI | MnlI | || MseI TspDTI HinfI \ \ \ \ \\ \ \ \ CCTCTTCCGATAAAAACATTTAAACTATTAACTAACAAATGGATTCATTAG 3550 3560 3570 3580 3590 ----:----|----:----|----:----|----:----|----:----|- GGAGAAGGCTATTTTTGTAAATTTGATAATTGATTGTTTACCTAAGTAATC / /// // / / / | ||Hin4I |MseI | TspDTI HinfI | |Ksp632I* AhaIII* MseI TfiI | MnlI Hpy188I P L P I K T F K L L T N K W I H * L F R * K H L N Y * L T N G F I X S S D K N I * T I N * Q M D S L X ----:----|----:----|----:----|----:----|----:----|- G R G I F V N L S N V L L H I * * V E E S L F M * V I L * C I S E N R K R Y F C K F * * S V F P N M L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 4 FblI,XmiI AciI 2 BspACI,SsiI AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 1 AlfI 2 AluI 7 AluBI ApaLI 1 Alw44I,VneI ApoI 12 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 1 BpuEI BceAI 2 BclI 1 FbaI,Ksp22I BdaI 8 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmgT120I 2 Bpu10I 1 BsaAI 3 BstBAI,Ppu21I BsaXI 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 10 BstF5I,BtsCI BseMII 4 BseSI 1 BaeGI,BstSLI BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 7 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 4 BspLU11I* 1 PscI,PciI BsrDI 4 BseMI,Bse3DI BsrI 9 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BssNAI 2 Bst1107I,BstZ17I BstKTI 11 BstXI 1 BtgZI 2 Cac8I 4 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 18 CviQI,RsaNI CspCI 1 CviAII 14 CviJI 15 CviKI-1 CviRI* 13 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 11 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 4 EcoRI 2 EcoRII 4 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 4 FatI 14 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 10 GlaI 2 GsuI 2 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 16 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HindII 6 HincII HinfI 18 HpaII 2 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 16 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 10 Hpy99I 3 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 8 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 18 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 6 SchI MmeI 4 MnlI 15 MseI 22 Tru1I,Tru9I MslI 5 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 3 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 14 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 2 MspA1I NspI 3 BstNSI,XceI PleI 6 PpsI PpiI 1 PsiI 1 AanI PvuII 1 RsaI 18 AfaI SacI 1 Psp124BI,SstI SalI 1 ScaI 2 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 45 SexAI 1 MabI SfaNI 4 LweI SmlI 1 SmoI SnaBI 2 Eco105I,BstSNI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 4 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 8 TaqI 13 TaqII 4 TatI 5 TfiI 12 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 5 NmuCI Tsp4CI* 13 HpyCH4III,TaaI,Bst4CI TspDTI 21 TspEI 30 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 5 TscAI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflII AloI AlwNI ApaI AscI AvrII BalI BamHI BbvCI BcgI BciVI BglI BmtI BplI BsaBI BsePI BseRI BseYI BsgI Bsp120I BspHI BspMI BspMII* BspOI BsrBI BstAPI BstEII BtrI BtsI CauII* Cfr9I CfrI DinI DraII DraIII Eam1105I EciI Eco47III EcoNI EcoP15I EgeI EheI EspI* FauI FseI FspAI GsaI HaeII HindIII HpaI KasI MauBI MfeI MluI MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI OliI PacI PasI PflMI PfoI PmaCI PmeI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI RsrII SacII SanDI SapI SauI* SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SrfI Sse232I* Sse8387I StuI SwaI TauI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769