Restriction Map of RFA1/YAR007C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RFA1/YAR007C on chromosome I from coordinates 158619 to 156754.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.32438

EMBOSS_001 BtsI TspRI TaqI MboII | MnlI | TspDTI | HphI SfaNI Csp6I \ \ \ \ \ \ \ \ ATGAGCAGTGTTCAACTTTCGAGGGGCGATTTTCATAGCATCTTCACCAATAAGCAAAGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGTCACAAGTTGAAAGCTCCCCGCTAAAAGTATCGTAGAAGTGGTTATTCGTTTCC / / / // / / / / TspRI | MnlI |TaqI | HphI SfaNI SetI BtsI TspDTI MboII M S S V Q L S R G D F H S I F T N K Q R * A V F N F R G A I F I A S S P I S K G E Q C S T F E G R F S * H L H Q * A K V ----:----|----:----|----:----|----:----|----:----|----:----| X L L T * S E L P S K * L M K V L L C L X S C H E V K S P R N E Y C R * W Y A F H A T N L K R P A I K M A D E G I L L P AgeI BetI* BssKI SgrAI EcoRII Cfr10I | ScrFI RsaI |HpaII | BseBI Hpy188I SetI || BsiYI* PsiI | | BccI | CviJI \ \\ \ \ \ \ \ \ \ TACGATAATCCCACCGGTGGCGTTTATCAAGTTTATAACACCAGGAAATCTGATGGGGCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTATTAGGGTGGCCACCGCAAATAGTTCAAATATTGTGGTCCTTTAGACTACCCCGA // / // / / / / / / |Csp6I | |Cfr10I PsiI | | | Hpy188I CviJI RsaI | |SgrAI | | BccI | |BetI* | EcoRII | |AgeI | BssKI | HpaII BseBI BsiYI* ScrFI Y D N P T G G V Y Q V Y N T R K S D G A T I I P P V A F I K F I T P G N L M G L R * S H R W R L S S L * H Q E I * W G * ----:----|----:----|----:----|----:----|----:----|----:----| Y S L G V P P T * * T * L V L F D S P A T R Y D W R H R K D L K Y C W S I Q H P V I I G G T A N I L N I V G P F R I P S ApoI TspEI | MboI | BclI | | DpnI | | |FatI | | |BspHI | | |BstKTI Hin4II* | | ||CviAII | NdeI | | ||Hpy178III* | | BsiYI* | | ||| NlaIII | | | CviJI | | ||| |BccI Hpy188I | | | | BbvI \ \ \\\ \\ \ \ \ \ \ \ AACAGCAACAGAAAGAATTTGATCATGATTTCCGATGGTATTTACCATATGAAGGCTCTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCGTTGTCTTTCTTAAACTAGTACTAAAGGCTACCATAAATGGTATACTTCCGAGAC / //// // / / / // / | |||| || | Hpy188I | |NdeI CviJI | |||| || BccI | BsiYI* | |||| |BspHI Hin4II* | |||| |FatI | |||| Hpy178III* | |||| CviAII | |||BclI | |||MboI | ||NlaIII | |DpnI | BstKTI TspEI ApoI N S N R K N L I M I S D G I Y H M K A L T A T E R I * S * F P M V F T I * R L C Q Q Q K E F D H D F R W Y L P Y E G S V ----:----|----:----|----:----|----:----|----:----|----:----| L L L L F F K I M I E S P I * W I F A R * C C C F S N S * S K R H Y K G Y S P E V A V S L I Q D H N G I T N V M H L S Q TseI AluI CviJI |BisI ||BlsI ||SetI FokI |||BseGI SfaNI PflMI |TspDTI |||CviRI* | BsrI BsiYI* EcoRV \\ \\\\ \ \ \ \ TTGAGAAACCAAGCTGCATCCAAGTTCCAGTCAATGGAACTACAAAGGGGTGATATCATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCTTTGGTTCGACGTAGGTTCAAGGTCAGTTACCTTGATGTTTCCCCACTATAGTAA / / / / //// / // / / | | | | |||CviRI* | |BsiYI* EcoRV HphI | | | | |||TseI | |PflMI | | | | ||BisI | SfaNI | | | | |BseGI BsrI | | | | |BlsI | | | | CviJI | | | | AluI | | | SetI | | FokI | BbvI TspDTI L R N Q A A S K F Q S M E L Q R G D I I * E T K L H P S S S Q W N Y K G V I S F E K P S C I Q V P V N G T T K G * Y H S ----:----|----:----|----:----|----:----|----:----|----:----| N L F W A A D L N W D I S S C L P S I M T S F G L Q M W T G T L P V V F P H Y * Q S V L S C G L E L * H F * L P T I D N MslI HphI |FnuDII* || TspEI || | CviRI* || | | MwoI || | | AlwNI MaeII || | | BstAPI | SetI || | | | SetI BspMI | TaiI \\ \ \ \ \ \ \ \ CGCGTGATAATTGCAGAACCTGCTATTGTCAGGGAAAGAAAGAAATACGTTCTTTTAGTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GCGCACTATTAACGTCTTGGACGATAACAGTCCCTTTCTTTCTTTATGCAAGAAAATCAT // // // / / / |FnuDII* || |SetI BspMI | MaeII MslI || BstAPI TaiI || AlwNI SetI || MwoI |CviRI* TspEI R V I I A E P A I V R E R K K Y V L L V A * * L Q N L L L S G K E R N T F F * * R D N C R T C Y C Q G K K E I R S F S R ----:----|----:----|----:----|----:----|----:----|----:----| R T I I A S G A I T L S L F F Y T R K T E R S L Q L V Q * Q * P F F S I R E K L A H Y N C F R S N D P F S L F V N K * Y HindII Hpy166II | SpeI AsuI* | |MaeI AvaII | || TatI |BmgT120I | || |Csp6I || FnuDII* | || ||RsaI || BsrI | Cac8I | || ||ScaI \\ \ \ \ \ \\ \\\ GATGACTTTGAGTTGGTCCAGTCGCGTGCTGATATGGTCAACCAAACTAGTACTTTTTTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGAAACTCAACCAGGTCAGCGCACGACTATACCAGTTGGTTTGATCATGAAAAAAC /// / / / ///// ||AvaII | Cac8I Hpy166II ||||TatI ||AsuI* FnuDII* HindII |||Csp6I |BmgT120I ||ScaI BsrI ||RsaI |SpeI MaeI D D F E L V Q S R A D M V N Q T S T F L M T L S W S S R V L I W S T K L V L F W * L * V G P V A C * Y G Q P N * Y F F G ----:----|----:----|----:----|----:----|----:----|----:----| S S K S N T W D R A S I T L W V L V K K L H S Q T P G T A H Q Y P * G F * Y K K I V K L Q D L R T S I H D V L S T S K Q DdeI | Hpy188I | | BseGI | | | MslI | | | | BspCNI | | | | |BseMII MseI MboII FokI | | | | ||SfaNI SetI TspDTI | Tsp4CI* \ \ \ \ \ \\\ \ \ \ \ GATAACTATTTCTCAGAGCATCCAAATGAAACCTTAAAAGACGAAGATATAACTGACAGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTGATAAAGAGTCTCGTAGGTTTACTTTGGAATTTTCTGCTTCTATATTGACTGTCA / /// // // / / / / FokI ||BseGI || || | TspDTI | Tsp4CI* |DdeI || || MseI MboII Hpy188I || |SfaNI TspRI || SetI |BseMII BspCNI MslI D N Y F S E H P N E T L K D E D I T D S I T I S Q S I Q M K P * K T K I * L T V * L F L R A S K * N L K R R R Y N * Q W ----:----|----:----|----:----|----:----|----:----|----:----| S L * K E S C G F S V K F S S S I V S L P Y S N R L A D L H F R L L R L Y L Q C I V I E * L M W I F G * F V F I Y S V T TseI |BisI BslFI ||BlsI | Cac8I BsrDI |||BsmI TspRI | | MwoI | BbvI |||CviRI* \ \ \ \ \ \ \\\\ GGTAATGTTGCCAATCAAACAAACGCCAGCAATGCTGGTGTCCCTGATATGCTGCATTCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTACAACGGTTAGTTTGTTTGCGGTCGTTACGACCACAGGGACTATACGACGTAAGT /// / / /// ||| BsrDI BbvI ||CviRI* ||BslFI ||TseI |MwoI |BisI Cac8I BlsI BsmI G N V A N Q T N A S N A G V P D M L H S V M L P I K Q T P A M L V S L I C C I Q * C C Q S N K R Q Q C W C P * Y A A F K ----:----|----:----|----:----|----:----|----:----|----:----| P L T A L * V F A L L A P T G S I S C E H Y H Q W D F L R W C H Q H G Q Y A A N T I N G I L C V G A I S T D R I H Q M * CviRI* ApoI TspEI | BsmI TspEI | TspDTI \ \ \ \ \ AACTCAAACTTGAATGCAAATGAGAGAAAATTCGCCAATGAAAACCCTAATTCGCAAAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGTTTGAACTTACGTTTACTCTCTTTTAAGCGGTTACTTTTGGGATTAAGCGTTTTT / / // CviRI* TspEI |TspEI BsmI ApoI TspDTI N S N L N A N E R K F A N E N P N S Q K T Q T * M Q M R E N S P M K T L I R K K L K L E C K * E K I R Q * K P * F A K N ----:----|----:----|----:----|----:----|----:----|----:----| F E F K F A F S L F N A L S F G L E C F L S L S S H L H S F I R W H F G * N A F V * V Q I C I L S F E G I F V R I R L F AclI BccI MaeII | Tsp4CI* | SetI TspEI TaqI | | BsmAI | TaiI \ \ \ \ \ \ \ ACCAGACCAATTTTTGCCATCGAACAACTGTCTCCATACCAAAACGTTTGGACTATCAAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTCTGGTTAAAAACGGTAGCTTGTTGACAGAGGTATGGTTTTGCAAACCTGATAGTTT / / / / / / / TspEI | | Tsp4CI* | | MaeII | BccI | | AclI TaqI | TaiI | SetI BsmAI T R P I F A I E Q L S P Y Q N V W T I K P D Q F L P S N N C L H T K T F G L S K Q T N F C H R T T V S I P K R L D Y Q S ----:----|----:----|----:----|----:----|----:----|----:----| V L G I K A M S C S D G Y W F T Q V I L F W V L K Q W R V V T E M G F R K S * * G S W N K G D F L Q R W V L V N P S D F MaeII TspEI | SetI | MseI | TaiI MnlI BccI SetI Hpy166II \ \ \ \ \ \ \ \ GCAAGAGTTTCCTACAAGGGAGAAATTAAAACGTGGCACAATCAAAGAGGTGATGGTAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCTCAAAGGATGTTCCCTCTTTAATTTTGCACCGTGTTAGTTTCTCCACTACCATTT // / / / / / / || | MaeII MnlI SetI | HphI || TaiI BccI Hpy166II || SetI |MseI TspEI A R V S Y K G E I K T W H N Q R G D G K Q E F P T R E K L K R G T I K E V M V N K S F L Q G R N * N V A Q S K R * W * T ----:----|----:----|----:----|----:----|----:----|----:----| A L T E * L P S I L V H C L * L P S P L L L L K R C P L F * F T A C D F L H H Y C S N G V L S F N F R P V I L S T I T F SetI |Hpy178III* || MnlI || | Hpy188I || | | CviJI || | | |SecI* || | | |DsaI* || | | ||BsiYI* HindII || | | ||| GsuI Hpy166II || | | ||| Eco57MI HphI | BciVI || | | ||| | MseI \ \ \ \\ \ \ \\\ \ \ CTATTCAATGTCAACTTCTTGGATACCTCTGGAGAAATCCGAGCCACGGCGTTTAATGAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GATAAGTTACAGTTGAAGAACCTATGGAGACCTCTTTAGGCTCGGTGCCGCAAATTACTA / / / / / / // / / | BciVI SetI | | | || | MseI Hpy166II | | | || Eco57MI HindII | | | || DsaI* | | | || SecI* | | | || GsuI | | | |CviJI | | | BsiYI* | | Hpy188I | MnlI Hpy178III* L F N V N F L D T S G E I R A T A F N D Y S M S T S W I P L E K S E P R R L M I I Q C Q L L G Y L W R N P S H G V * * F ----:----|----:----|----:----|----:----|----:----|----:----| S N L T L K K S V E P S I R A V A N L S V I * H * S R P Y R Q L F G L W P T * H * E I D V E Q I G R S F D S G R R K I I ApoI ApoI AccI TspEI TspEI |BssNAI BceAI | MseI | Hin4II* |Hpy166II \ \ \ \ \ \\ TTTGCTACAAAATTTAACGAAATTTTACAAGAAGGCAAAGTATACTATGTATCAAAGGCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGATGTTTTAAATTGCTTTAAAATGTTCTTCCGTTTCATATGATACATAGTTTCCGT / / / / // BceAI | MseI Hin4II* |AccI TspEI TspEI Hpy166II ApoI ApoI BssNAI F A T K F N E I L Q E G K V Y Y V S K A L L Q N L T K F Y K K A K Y T M Y Q R Q C Y K I * R N F T R R Q S I L C I K G K ----:----|----:----|----:----|----:----|----:----|----:----| K A V F N L S I K C S P L T Y * T D F A N Q * L I * R F K V L L C L I S H I L P K S C F K V F N * L F A F Y V I Y * L C AluI CviJI |DdeI |EspI* ||SetI ApoI ||| CviJI TspEI ||| | TspEI MmeI MslI | BsmAI \\\ \ \ \ \ \ \ AAACTCCAACCAGCTAAGCCCCAATTTACTAATCTAACACACCCTTATGAACTGAATTTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGAGGTTGGTCGATTCGGGGTTAAATGATTAGATTGTGTGGGAATACTTGACTTAAAC / / // / / / / / | | |CviJI | MmeI MslI | TspDTI | | EspI* TspEI TspEI | | DdeI ApoI | CviJI | AluI SetI K L Q P A K P Q F T N L T H P Y E L N L N S N Q L S P N L L I * H T L M N * I W T P T S * A P I Y * S N T P L * T E F G ----:----|----:----|----:----|----:----|----:----|----:----| F S W G A L G W N V L R V C G * S S F K L V G V L * A G I * * D L V G K H V S N F E L W S L G L K S I * C V R I F Q I Q TspDTI Hpy188I Tsp4CI* TaqI | TspDTI TspDTI | TspRI | MboII | | TspEI \ \ \ \ \ \ \ \ GATAGAGACACTGTTATAGAAGAATGTTTCGATGAAAGTAATGTTCCGAAAACCCATTTC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCTCTGTGACAATATCTTCTTACAAAGCTACTTTCATTACAAGGCTTTTGGGTAAAG / / / // // / | | Tsp4CI* |TaqI || TspDTI | TspRI MboII |Hpy188I BsmAI TspDTI D R D T V I E E C F D E S N V P K T H F I E T L L * K N V S M K V M F R K P I S * R H C Y R R M F R * K * C S E N P F Q ----:----|----:----|----:----|----:----|----:----|----:----| S L S V T I S S H K S S L L T G F V W K P Y L C Q * L L I N R H F Y H E S F G N I S V S N Y F F T E I F T I N R F G M E MaeII | AccI | SetI | TaiI | |Hpy166II | || AcyI | || MaeII Hpy188I | || |ZraI | BssKI | || || SetI | EcoRII | || || TaiI | | ScrFI ApoI | || || AatII SfaNI MaeI | | BseBI TspEI | || || |SecI* \ \ \ \ \ \ \ \\ \\ \\ AATTTCATCAAACTAGATGCTATTCAGAACCAGGAAGTAAATTCCAACGTAGACGTCCTC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAGTAGTTTGATCTACGATAAGTCTTGGTCCTTCATTTAAGGTTGCATCTGCAGGAG / / / / / / / / / // // TspEI | MaeI | | EcoRII | | | || |MaeII SfaNI | | BssKI | | | || |AcyI | BseBI | | | || ZraI | ScrFI | | | |AatII Hpy188I | | | |AccI | | | |TaiI | | | |SetI | | | Hpy166II | | MaeII | TaiI | SetI TspEI ApoI N F I K L D A I Q N Q E V N S N V D V L I S S N * M L F R T R K * I P T * T S S F H Q T R C Y S E P G S K F Q R R R P R ----:----|----:----|----:----|----:----|----:----|----:----| L K M L S S A I * F W S T F E L T S T R * N * * V L H * E S G P L L N W R L R G I E D F * I S N L V L F Y I G V Y V D E ApoI XmnI AluI BseYI TspEI MnlI CviJI CviJI | TaqI |MmeI | SetI | GsaI | |MboI \\ \ \ \ \ \ \\ GGTATTATCCAAACTATAAACCCACATTTTGAGCTAACTTCAAGGGCTGGGAAGAAATTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAATAGGTTTGATATTTGGGTGTAAAACTCGATTGAAGTTCCCGACCCTTCTTTAAG / / / / / / / / | MmeI | CviJI | | | TspEI | MnlI | AluI | | | ApoI SecI* SetI | | XmnI | BseYI CviJI GsaI G I I Q T I N P H F E L T S R A G K K F V L S K L * T H I L S * L Q G L G R N S Y Y P N Y K P T F * A N F K G W E E I R ----:----|----:----|----:----|----:----|----:----|----:----| P I I W V I F G C K S S V E L A P F F N R Y * G F * L G V N Q A L K L P Q S S I T N D L S Y V W M K L * S * P S P L F E DpnI |PvuI |McrI* |MboII |BstKTI || MaeIII || Tsp45I || Hpy178III* || | MfeI || | TspEI || | | MlyI || | | PleI || | | | HindII || | | | Hpy166II CviJI TfiI || |Hpy99I | | | HinfI HaeIII HinfI \\ \\ \ \ \ \ \ \ GATCGTCGTGACATCACAATTGTTGACGACTCTGGGTTTTCTATCTCTGTTGGCCTATGG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGCAGCACTGTAGTGTTAACAACTGCTGAGACCCAAAAGATAGAGACAACCGGATACC //// / / //// / / |||MboI | Tsp45I |||| HinfI HaeIII ||| | MaeIII |||Hpy166II CviJI ||| Hpy178III* |||HindII ||Hpy99I ||PleI |MboII |MlyI |DpnI TspEI BstKTI MfeI McrI* TaqI PvuI D R R D I T I V D D S G F S I S V G L W I V V T S Q L L T T L G F L S L L A Y G S S * H H N C * R L W V F Y L C W P M E ----:----|----:----|----:----|----:----|----:----|----:----| S R R S M V I T S S E P N E I E T P R H R D D H C * L Q Q R S Q T K * R Q Q G I I T T V D C N N V V R P K R D R N A * P Hin4II* |SetI || Hpy178III* MseI || | BbvI TseI Eco57I Cac8I || | | Hin4II* |BisI Eco57MI | CviJI || | | | SetI ||BlsI | SetI \ \ \\ \ \ \ \ \\\ \ \ AATCAGCAAGCCCTTGATTTCAACCTTCCTGAAGGTTCTGTTGCTGCCATTAAAGGTGTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTCGTTCGGGAACTAAAGTTGGAAGGACTTCCAAGACAACGACGGTAATTTCCACAA / / / / / / /// /// / // | | CviJI | | | ||BbvI ||| | |SetI | Cac8I | | | |Hin4II* ||| | MseI HinfI | | | SetI ||| Eco57MI TfiI | | Hpy178III* ||| Eco57I | Hin4II* ||TseI SetI |BisI BlsI N Q Q A L D F N L P E G S V A A I K G V I S K P L I S T F L K V L L L P L K V F S A S P * F Q P S * R F C C C H * R C S ----:----|----:----|----:----|----:----|----:----|----:----| F * C A R S K L R G S P E T A A M L P T S D A L G Q N * G E Q L N Q Q Q W * L H I L L G K I E V K R F T R N S G N F T N MaeI TfiI |Hin4I HinfI |Hin4I | Hpy188I MaeIII || Csp6I | |TfiI Tsp45I TspGWI || |RsaI | |HinfI \ \ \\ \\ \ \\ CGTGTGACGGATTTTGGTGGCAAATCTTTGTCTATGGGATTTTCTAGTACCCTGATTCCG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GCACACTGCCTAAAACCACCGTTTAGAAACAGATACCCTAAAAGATCATGGGACTAAGGC / / / / // // Tsp45I TspGWI Hin4I | |Csp6I |Hpy188I MaeIII Hin4I | RsaI HinfI MaeI TfiI R V T D F G G K S L S M G F S S T L I P V * R I L V A N L C L W D F L V P * F R C D G F W W Q I F V Y G I F * Y P D S E ----:----|----:----|----:----|----:----|----:----|----:----| R T V S K P P L D K D I P N E L V R I G E H S P N Q H C I K T * P I K * Y G S E T H R I K T A F R Q R H S K R T G Q N R TfiI Hpy178III* HinfI |BseMII | StyI ||BspCNI | SecI* ||| ApoI | | AsuI* ||| TspEI | | |BmgT120I ||| |MnlI | | ||CviJI ||| || Hpy178III* | | ||HaeIII ||| || |DdeI | | |||AciI ||| || |SauI* | | |||BisI ||| || || Hin4I | | ||||BlsI ||| || || Hin4I | | |||||TauI ||| || || | NdeI MseI | | ||||||TspDTI \\\ \\ \\ \ \ \ \ \ \\\\\\\ AATCCAGAAATTCCTGAGGCATATGCCTTAAAGGGTTGGTATGATTCCAAGGGCCGCAAC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGGTCTTTAAGGACTCCGTATACGGAATTTCCCAACCATACTAAGGTTCCCGGCGTTG // / / / / / / / / / //// || | | | | SauI* NdeI MseI | | |||AciI || | | | | DdeI | | ||TspDTI || | | | Hpy178III* | | ||BisI || | | Hin4I | | |AsuI* || | | Hin4I | | |BlsI || | | TspEI | | BmgT120I || | | ApoI | | HaeIII || | MnlI | | CviJI || Hpy178III* | | TauI |BspCNI | SecI* BseMII | StyI HinfI HinfI TfiI TfiI N P E I P E A Y A L K G W Y D S K G R N I Q K F L R H M P * R V G M I P R A A T S R N S * G I C L K G L V * F Q G P Q R ----:----|----:----|----:----|----:----|----:----|----:----| F G S I G S A Y A K F P Q Y S E L P R L S D L F E Q P M H R L P N T H N W P G C I W F N R L C I G * L T P I I G L A A V TseI CviJI |BisI ||BlsI |||NheI ||||MaeI TaqII |||||Cac8I | BssKI |||||| AluI | | HpaII |||||| BmtI | | ScrFI |||||| CviJI | | CauII* |||||| |TspDTI MseI | | | BsiYI* |||||| ||MseI |AhaIII* | | | | BbvI |||||| ||SetI \\ \ \ \ \ \ \\\\\\ \\\ GCAAACTTCATCACTTTAAAGCAAGAACCCGGTATGGGTGGTCAATCGGCTGCTAGCTTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTGAAGTAGTGAAATTTCGTTCTTGGGCCATACCCACCAGTTAGCCGACGATCGAAT // / /// / //// /// / |MseI TaqII ||BssKI BbvI |||| ||| MseI AhaIII* |BsiYI* |||| ||CviJI |HpaII |||| ||NheI CauII* |||| ||AluI ScrFI |||| |TspDTI |||| |MaeI |||| Cac8I |||| SetI |||TseI |||BmtI ||BisI |BlsI CviJI A N F I T L K Q E P G M G G Q S A A S L Q T S S L * S K N P V W V V N R L L A * K L H H F K A R T R Y G W S I G C * L N ----:----|----:----|----:----|----:----|----:----|----:----| A F K M V K F C S G P I P P * D A A L K R L S * * K L A L V R Y P H D I P Q * S C V E D S * L L F G T H T T L R S S A * AluI CviJI Ecl136II |SmlI ||SetI ||SduI ||SacI ||HgiAI* Bce83I* ||HgiJII* ApoI | BspCNI ||| AluI TspEI DdeI | |BseMII ||| CviJI | BsrDI EspI* | || MaeI ||| | SetI MaeI \ \ \ \ \\ \ \\\ \ \ \ ACAAAATTCATTGCTCAGCGTATTACTATTGCTAGAGCTCAAGCTGAAAATCTAGGAAGA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTTAAGTAACGAGTCGCATAATGATAACGATCTCGAGTTCGACTTTTAGATCCTTCT / / / / // // / /// / | TspEI | | |BseMII || | ||CviJI MaeI | ApoI | | BspCNI || | ||AluI BsrDI | Bce83I* || | |SmlI EspI* || | SetI DdeI || Ecl136II || CviJI || AluI |HgiJII* |HgiAI* |SacI |SduI |SetI MaeI T K F I A Q R I T I A R A Q A E N L G R Q N S L L S V L L L L E L K L K I * E E K I H C S A Y Y Y C * S S S * K S R K K ----:----|----:----|----:----|----:----|----:----|----:----| V F N M A * R I V I A L A * A S F R P L L L I * Q E A Y * * Q * L E L Q F D L F C F E N S L T N S N S S S L S F I * S S TseI AluI MboII CviJI | MaeIII BbvI |BisI | Tsp45I | HphI ||BlsI | | SetI | | MseI ||SetI MseI TspEI \ \ \ \ \ \ \\\ \ \ AGCGAGAAAGGTGACTTTTTTAGTGTTAAAGCTGCTATAAGTTTCTTAAAAGTTGATAAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTCTTTCCACTGAAAAAATCACAATTTCGACGATATTCAAAGAATTTTCAACTATTA // / // // //// / |SetI | |BbvI || |||TseI MseI MboII | HphI || ||BisI Tsp45I || |BlsI MaeIII || CviJI || AluI |SetI MseI S E K G D F F S V K A A I S F L K V D N A R K V T F L V L K L L * V S * K L I I R E R * L F * C * S C Y K F L K S * * F ----:----|----:----|----:----|----:----|----:----|----:----| L S F P S K K L T L A A I L K K F T S L F R S L H S K * H * L Q * L N R L L Q Y A L F T V K K T N F S S Y T E * F N I I CviRI* Hpy178III* | MwoI | BccI | BstAPI TspEI | | CviJI \ \ \ \ \ \ TTTGCATATCCTGCCTGTTCTAATGAGAATTGTAATAAGAAAGTTCTGGAACAGCCTGAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGTATAGGACGGACAAGATTACTCTTAACATTATTCTTTCAAGACCTTGTCGGACTA / / / / / // | | BstAPI TspEI | |CviJI | | MwoI | BccI | CviRI* Hpy178III* TspEI F A Y P A C S N E N C N K K V L E Q P D L H I L P V L M R I V I R K F W N S L M C I S C L F * * E L * * E S S G T A * W ----:----|----:----|----:----|----:----|----:----|----:----| K A Y G A Q E L S F Q L L F T R S C G S N Q M D Q R N * H S N Y Y S L E P V A Q K C I R G T R I L I T I L F N Q F L R I CviRI* | CviJI Csp6I | HaeIII |RsaI | | TspEI Hpy178III* \\ \ \ \ \ GGTACTTGGAGATGTGAGAAGTGCGACACCAATAATGCAAGGCCAAATTGGAGATACATC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGAACCTCTACACTCTTCACGCTGTGGTTATTACGTTCCGGTTTAACCTCTATGTAG // / / / |Csp6I | HaeIII TspEI RsaI | CviJI CviRI* G T W R C E K C D T N N A R P N W R Y I V L G D V R S A T P I M Q G Q I G D T S Y L E M * E V R H Q * C K A K L E I H L ----:----|----:----|----:----|----:----|----:----|----:----| P V Q L H S F H S V L L A L G F Q L Y M H Y K S I H S T R C W Y H L A L N S I C T S P S T L L A V G I I C P W I P S V D TspEI CviJI \ \ TTGACAATATCAATTATTGACGAAACCAATCAACTATGGCTCACTTTATTTGACGACCAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGTTATAGTTAATAACTGCTTTGGTTAGTTGATACCGAGTGAAATAAACTGCTGGTT / / / / Hpy178III* TspEI CviJI SetI L T I S I I D E T N Q L W L T L F D D Q * Q Y Q L L T K P I N Y G S L Y L T T K D N I N Y * R N Q S T M A H F I * R P S ----:----|----:----|----:----|----:----|----:----|----:----| K V I D I I S S V L * S H S V K N S S W R S L I L * Q R F W D V I A * K I Q R G Q C Y * N N V F G I L * P E S * K V V L AluI CviJI | SetI | |TaqII | || TspEI MseI | || | SfaNI VspI Hin4II* BbvII* \ \\ \ \ \ \ \ GCTAAACAATTATTGGGTGTTGATGCTAATACATTAATGTCTTTGAAGGAAGAAGACCCC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTTGTTAATAACCCACAACTACGATTATGTAATTACAGAAACTTCCTTCTTCTGGGG // / / / / / |TaqII | SfaNI | Hin4II* MboII CviJI TspEI VspI AluI MseI A K Q L L G V D A N T L M S L K E E D P L N N Y W V L M L I H * C L * R K K T P * T I I G C * C * Y I N V F E G R R P Q ----:----|----:----|----:----|----:----|----:----|----:----| A L C N N P T S A L V N I D K F S S S G L * V I I P H Q H * Y M L T K S P L L G S F L * Q T N I S I C * H R Q L F F V G MboII | ApoI | TspEI | EcoRI | MboII TspEI BciVI TspDTI MnlI \ \ \ \ \ \ AACGAATTCACAAAAATTACTCAAAGTATCCAAATGAACGAATATGACTTTAGGATTAGA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTAAGTGTTTTTAATGAGTTTCATAGGTTTACTTGCTTATACTGAAATCCTAATCT / / / / / / | EcoRI TspEI BciVI TspDTI MnlI | TspEI | ApoI BbvII* MboII N E F T K I T Q S I Q M N E Y D F R I R T N S Q K L L K V S K * T N M T L G L E R I H K N Y S K Y P N E R I * L * D * S ----:----|----:----|----:----|----:----|----:----|----:----| L S N V F I V * L I W I F S Y S K L I L W R I * L F * E F Y G F S R I H S * S * V F E C F N S L T D L H V F I V K P N S Hin6I |GlaI MboI ||HhaI BclI ||BciVI | DpnI ||FnuDII* | |BstKTI TspEI Tsp4CI* SetI \\\ \ \\ \ \ \ GCGCGTGAGGATACATACAATGATCAAAGCAGAATTAGATATACCGTTGCTAACCTACAC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGCACTCCTATGTATGTTACTAGTTTCGTCTTAATCTATATGGCAACGATTGGATGTG /// // / / / / / ||FnuDII* || BclI TspEI Tsp4CI* SetI SetI ||Hin6I || MboI |BciVI |DpnI |GlaI BstKTI HhaI A R E D T Y N D Q S R I R Y T V A N L H R V R I H T M I K A E L D I P L L T Y T A * G Y I Q * S K Q N * I Y R C * P T Q ----:----|----:----|----:----|----:----|----:----|----:----| A R S S V Y L S * L L I L Y V T A L R C L A H P Y M C H D F C F * I Y R Q * G V R T L I C V I I L A S N S I G N S V * V AluI StyI CviJI BcgI MwoI | SetI BcgI Hin4I Eco57I SecI* | Hin4I | | TspEI | CviJI CviJI Hin4I Eco57MI | CviJI | Hin4I \ \ \ \ \ \ \ \ \ \ \ \ AGCTTGAATTACAGGGCTGAAGCCGACTATCTTGCCGATGAGTTATCCAAGGCTTTGTTA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAACTTAATGTCCCGACTTCGGCTGATAGAACGGCTACTCAATAGGTTCCGAAACAAT / // / // / / // / / CviJI |BcgI CviJI |Hin4I Eco57MI BcgI || | SetI AluI TspEI |Hin4I Eco57I || Hin4I CviJI || Hin4I || MwoI |CviJI SecI* StyI S L N Y R A E A D Y L A D E L S K A L L A * I T G L K P T I L P M S Y P R L C * L E L Q G * S R L S C R * V I Q G F V S ----:----|----:----|----:----|----:----|----:----|----:----| L K F * L A S A S * R A S S N D L A K N C S S N C P Q L R S D Q R H T I W P K T A Q I V P S F G V I K G I L * G L S Q * AluI CviJI | MseI | SetI \ \ GCTTAA ----:- CGAATT / / | MseI CviJI AluI A * L X L X ----:- A * L K S L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 2 FblI,XmiI AciI 1 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AluI 10 AluBI AlwNI 1 CaiI ApoI 10 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BceAI 1 BcgI 1 BciVI 3 BfuI BclI 2 FbaI,Ksp22I BetI* 1 BsaWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 2 BmtI 1 BspOI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 3 BseYI 1 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 3 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 2 BstKTI 3 BtsI 1 Cac8I 4 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 4 CviQI,RsaNI CviAII 1 CviJI 25 CviKI-1 CviRI* 6 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 3 MalI DsaI* 1 BtgI,BstDSI Ecl136II 1 EcoICRI Eco57I 2 AcuI Eco57MI 3 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EspI* 2 Bpu1102I,Bsp1720I,CelII,BlpI FatI 1 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 1 GsaI 1 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 5 HpyAV Hin6I 1 HinP1I,HspAI HindII 3 HincII HinfI 5 HpaII 2 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 7 Hpy99I 1 MaeI 6 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 3 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 1 SchI MmeI 2 MnlI 6 MseI 12 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NdeI 2 FauNDI NheI 1 AsuNHI NlaIII 1 Hin1II,Hsp92II,FaeI PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PsiI 1 AanI PvuI 1 MvrI,Ple19I,BpvUI RsaI 4 AfaI SacI 1 Psp124BI,SstI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 25 SfaNI 5 LweI SgrAI 1 SmlI 1 SmoI SpeI 1 BcuI,AhlI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 4 TaqII 2 TatI 1 TauI 1 TfiI 4 PfeI TseI 5 ApeKI Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 25 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI VspI 1 PshBI,AseI XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflII AflIII AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BdaI BfiI BglI BglII BinI* BmeT110I BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseSI BsgI BsiI* Bsp120I Bsp1407I BspLU11I* BspMII* BsrBI BstEII BstXI BtgZI BtrI Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Eco31I Eco47III EcoNI EcoP15I EcoT22I EgeI EheI Esp3I FalI FauI FseI FspAI HaeII HgaI HgiCI* HindIII HpaI KasI KpnI Ksp632I* MauBI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuII RsrII SacII SalI SanDI SapI SexAI SfeI* SfiI SfoI SgfI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TsoI TspMI TstI Tth111I XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769