Restriction Map of ACS1/YAL054C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ACS1/YAL054C on chromosome I from coordinates 45022 to 42881.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.28525

EMBOSS_001 Csp6I Tsp4CI* |RsaI | MboII ||MnlI MaeI | | TspEI BslFI \\\ \ \ \ \ \ ATGTCGCCCTCTGCCGTACAATCATCAAAACTAGAAGAACAGTCAAGTGAAATTGACAAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCGGGAGACGGCATGTTAGTAGTTTTGATCTTCTTGTCAGTTCACTTTAACTGTTC // / / / / |Csp6I MaeI | MboII TspEI MnlI Tsp4CI* RsaI M S P S A V Q S S K L E E Q S S E I D K C R P L P Y N H Q N * K N S Q V K L T S V A L C R T I I K T R R T V K * N * Q V ----:----|----:----|----:----|----:----|----:----|----:----| X D G E A T C D D F S S S C D L S I S L X T A R Q R V I M L V L L V T L H F Q C H R G R G Y L * * F * F F L * T F N V L AciI BisI |BlsI ||TauI |||BtsI |||| MwoI |||| | Hin6I |||| | |GlaI BbvI |||| | |MstI* | FatI |||| | ||TseI | |CviAII |||| | ||HhaI | || MboII |||| | ||TspRI | || |NlaIII |||| | |||BisI | || ||MslI |||| | ||||BlsI | || |||BdaI BfiI BsrI |||| | |||||Hin4II* | || |||BdaI \ \ \\\\ \ \\\\\\ \ \\ \\\\ TTGAAAGCAAAAATGTCCCAGTCTGCCGCCACTGCGCAGCAGAAGAAGGAACATGAGTAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTCGTTTTTACAGGGTCAGACGGCGGTGACGCGTCGTCTTCTTCCTTGTACTCATA / / / //// ////// ////// BslFI BfiI BsrI |||MwoI |||||TseI |||||MslI |||AciI ||||Hin4II* ||||FatI ||TspRI ||||BisI ||||BdaI ||BisI |||BlsI ||||BdaI ||BtsI ||Hin6I |||CviAII |BlsI |MstI* ||MboII TauI |GlaI |BbvI HhaI NlaIII L K A K M S Q S A A T A Q Q K K E H E Y * K Q K C P S L P P L R S R R R N M S M E S K N V P V C R H C A A E E G T * V * ----:----|----:----|----:----|----:----|----:----|----:----| N F A F I D W D A A V A C C F F S C S Y T S L L F T G T Q R W Q A A S S P V H T Q F C F H G L R G G S R L L L L F M L I BdaI BdaI | BglI | MwoI | | AsuI* | | |CviJI | | |HaeIII | | |BmgT120I | | || DdeI | | || | Hpy188I | | || | |BccI | | || | || BceAI | | || | || | SfeI* | | || | || | | TseI | | || | || | | CviRI* TaqII | | || | || | | |BisI | EcoP15I | | || | || | | |BspCNI | | PshAI | | || | || | | ||BlsI | | |TspDTI | | || | || | | ||PstI | | || Hpy178III* | | || | || | | ||BseMII | | || | MboI | | || | || | | |||CviJI | | || | | DpnI | | || | || | | |||| AciI | | || | | |BstKTI | | || | || | | |||| Cac8I \ \ \\ \ \ \\ \ \ \\ \ \\ \ \ \\\\ \ GAACATTTGACTTCGGTCAAGATCGTGCCACAACGGCCCATCTCAGATAGACTGCAGCCC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTAAACTGAAGCCAGTTCTAGCACGGTGTTGCCGGGTAGAGTCTATCTGACGTCGGG / / // /// / // /// // / /////// / TaqII | |PshAI ||| MboI |MwoI ||AsuI* || | ||||||| Cac8I | TspDTI ||DpnI |BglI || || | ||||||CviJI EcoP15I |BstKTI BdaI || || | ||||||TseI | BdaI || || | |||||SfeI* Hpy178III* || || | |||||BisI || || | ||||BlsI || || | |||BseMII || || | |||CviRI* || || | ||BspCNI || || | |PstI || || | BceAI || || BccI || |DdeI || Hpy188I |BmgT120I HaeIII CviJI E H L T S V K I V P Q R P I S D R L Q P N I * L R S R S C H N G P S Q I D C S P T F D F G Q D R A T T A H L R * T A A R ----:----|----:----|----:----|----:----|----:----|----:----| S C K V E T L I T G C R G M E S L S C G H V N S K P * S R A V V A W R L Y V A A F M Q S R D L D H W L P G D * I S Q L G Hin6I |GlaI |Eco47III MfeI ||HhaI TspEI |||HaeII | FauI ||||Cac8I | BbvI CviRI* ||||| CviRI* \ \ \ \\\\\ \ GCAATTGCTACCCACTATTCTCCACACTTGGACGGGTTGCAGGACTATCAGCGCTTGCAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTAACGATGGGTGATAAGAGGTGTGAACCTGCCCAACGTCCTGATAGTCGCGAACGTG / / / / / //// / / AciI | | BbvI CviRI* |||| | CviRI* | FauI |||| Cac8I TspEI |||Hin6I MfeI ||Eco47III ||GlaI |HhaI HaeII A I A T H Y S P H L D G L Q D Y Q R L H Q L L P T I L H T W T G C R T I S A C T N C Y P L F S T L G R V A G L S A L A Q ----:----|----:----|----:----|----:----|----:----|----:----| A I A V W * E G C K S P N C S * * R K C R L Q * G S N E V S P R T A P S D A S A C N S G V I R W V Q V P Q L V I L A Q V BbvII* AluI |MboII CviJI PleI || DdeI | SetI MseI HinfI |MlyI || | MboII | | TspEI |AhaIII* \ \\ \\ \ \ \ \ \ \\ AAGGAGTCTATTGAAGACCCTGCTAAGTTCTTCGGTTCTAAAGCTACCCAATTTTTAAAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTCAGATAACTTCTGGGACGATTCAAGAAGCCAAGATTTCGATGGGTTAAAAATTTG / / / / / / / / // HinfI PleI | | DdeI | CviJI | |MseI MlyI | BbvII* | AluI | AhaIII* | MboII SetI TspEI MboII K E S I E D P A K F F G S K A T Q F L N R S L L K T L L S S S V L K L P N F * T G V Y * R P C * V L R F * S Y P I F K L ----:----|----:----|----:----|----:----|----:----|----:----| L S D I S S G A L N K P E L A V W N K F C P T * Q L G Q * T R R N * L * G I K L L L R N F V R S L E E T R F S G L K * V BsiYI* |BsiYI* BsrI || Cac8I |DdeI || |AsuI* || CviJI || |DraII || | FokI || ||CviJI || | |TaqI SetI || ||HaeIII || | ||TspDTI | BseGI || ||BmgT120I Hpy178III* \\ \ \\\ \ \ \\ \\\ \ TGGTCTAAGCCATTCGATAAGGTGTTCATCCCAGACCCTAAAACGGGCAGGCCCTCCTTC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGATTCGGTAAGCTATTCCACAAGTAGGGTCTGGGATTTTGCCCGTCCGGGAGGAAG / // / // / / // / /// BsrI || | || SetI BseGI |BsiYI* | ||DraII || | |FokI BsiYI* | ||AsuI* || | TaqI | |BmgT120I || TspDTI | HaeIII |CviJI | CviJI DdeI Cac8I W S K P F D K V F I P D P K T G R P S F G L S H S I R C S S Q T L K R A G P P S V * A I R * G V H P R P * N G Q A L L P ----:----|----:----|----:----|----:----|----:----|----:----| Q D L G N S L T N M G S G L V P L G E K S T * A M R Y P T * G L G * F P C A R R P R L W E I L H E D W V R F R A P G G E MnlI | Hin4II* | | FatI CfrI | | CviRI* | CviJI | | |CviAII | HaeIII Tsp4CI* | | ||EcoT22I | | MnlI | HindII | | ||| NlaIII | | TspEI BceAI | Hpy166II | | ||| | NlaIV | | | MseI |MaeIII | | FatI \ \ \\\ \ \ \ \ \ \ \\ \ \ \ CAGAACAATGCATGGTTCCTCAACGGCCAATTAAACGCCTGTTACAACTGTGTTGACAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTGTTACGTACCAAGGAGTTGCCGGTTAATTTGCGGACAATGTTGACACAACTGTCT / / / / // / /// // / / / / / | | | | || NlaIV ||| |MseI | | | | NlaIII | | | | |FatI ||| TspEI | | | | NspI | | | | CviAII ||CfrI | | | Hpy166II | | | CviRI* |MnlI | | | HindII | | | NlaIII HaeIII | | Tsp4CI* | | EcoT22I CviJI | MaeIII | Hin4II* BceAI Hpy178III* MnlI Q N N A W F L N G Q L N A C Y N C V D R R T M H G S S T A N * T P V T T V L T D E Q C M V P Q R P I K R L L Q L C * Q T ----:----|----:----|----:----|----:----|----:----|----:----| W F L A H N R L P W N F A Q * L Q T S L G S C H M T G * R G I L R R N C S H Q C L V I C P E E V A L * V G T V V T N V S BssKI CviJI EcoRII | ScrFI | BseBI | |CfrI | ||HphI | |||BalI Hin4II* | |||CviJI CviAII | TaqI | |||EcoNI | NspI | AsuII | |||HaeIII | NlaIII HinfI | | MaeIII | ||||StyI | | MlyI | BbvII* | | Tsp45I | ||||SecI* | | PleI | | MboII CviJI | | | SetI | |||||BsiYI* \ \ \ \ \ \ \ \ \ \ \ \ \\\\\\ CATGCCTTGAAGACTCCTAACAAGAAAGCCATTATTTTCGAAGGTGACGAGCCTGGCCAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTACGGAACTTCTGAGGATTGTTCTTTCGGTAATAAAAGCTTCCACTGCTCGGACCGGTT // // / / / / // / / ///// || |PleI | BbvII* | | |SetI | | ||||CfrI || MlyI | MboII | | AsuII | | |||EcoNI |FatI HinfI | | TaqI | | ||EcoRII CviAII | Hin4II* | | ||HaeIII CviJI | | ||BssKI | | ||CviJI | | ||BalI | | |BsiYI* | | BseBI | | ScrFI | | HphI | CviJI Tsp45I MaeIII H A L K T P N K K A I I F E G D E P G Q M P * R L L T R K P L F S K V T S L A K C L E D S * Q E S H Y F R R * R A W P R ----:----|----:----|----:----|----:----|----:----|----:----| C A K F V G L L F A M I K S P S S G P W V H R S S E * C S L W * K R L H R A Q G M G Q L S R V L F G N N E F T V L R A L CviJI SetI MboII \ \ \ GGCTATTCCATTACCTACAAGGAACTACTTGAAGAAGTTTGTCAAGTGGCACAAGTGCTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCGATAAGGTAATGGATGTTCCTTGATGAACTTCTTCAAACAGTTCACCGTGTTCACGAC // / / |CviJI SetI MboII SecI* StyI G Y S I T Y K E L L E E V C Q V A Q V L A I P L P T R N Y L K K F V K W H K C * L F H Y L Q G T T * R S L S S G T S A D ----:----|----:----|----:----|----:----|----:----|----:----| P * E M V * L S S S S S T Q * T A C T S L S N W * R C P V V Q L L K D L P V L A A I G N G V L F * K F F N T L H C L H Q Tsp4CI* | BslFI | |TatI | |Bsp1407I | ||Csp6I | ||Hpy166II | |||RsaI | ||||FatI | |||||CviAII | |||||| NspI | |||||| NlaIII | |||||| |MslI | |||||| ||BcgI | |||||| ||| AsuI* | |||||| ||| AvaII | |||||| ||| |BmgT120I BcgI BceAI | |||||| ||| ||NlaIV \ \ \ \\\\\\ \\\ \\\ ACTTACTCTATGGGCGTTCGCAAGGGCGATACTGTTGCCGTGTACATGCCTATGGTCCCA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGAATGAGATACCCGCAAGCGTTCCCGCTATGACAACGGCACATGTACGGATACCAGGGT / / / //// /// // BcgI BceAI Tsp4CI* |||| ||MslI |AvaII |||| |BcgI |AsuI* |||| |FatI BmgT120I |||| CviAII NlaIV |||Bsp1407I |||TatI ||NlaIII ||Csp6I ||BslFI ||NspI |RsaI Hpy166II T Y S M G V R K G D T V A V Y M P M V P L T L W A F A R A I L L P C T C L W S Q L L Y G R S Q G R Y C C R V H A Y G P R ----:----|----:----|----:----|----:----|----:----|----:----| V * E I P T R L P S V T A T Y M G I T G S K S * P R E C P R Y Q Q R T C A * P G S V R H A N A L A I S N G H V H R H D W SetI | CfrI | | BalI HgiCI* | | CviJI | NlaIV | | HaeIII | TspGWI \ \ \ \ \ GAAGCAATCATAACCTTGTTGGCCATTTCCCGTATCGGTGCCATTCACTCCGTAGTCTTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGTTAGTATTGGAACAACCGGTAAAGGGCATAGCCACGGTAAGTGAGGCATCAGAAA / / / / / / SetI | CfrI | | HgiCI* HaeIII | NlaIV CviJI TspGWI BalI E A I I T L L A I S R I G A I H S V V F K Q S * P C W P F P V S V P F T P * S L S N H N L V G H F P Y R C H S L R S L C ----:----|----:----|----:----|----:----|----:----|----:----| S A I M V K N A M E R I P A M * E T T K L L L * L R T P W K G Y R H W E S R L R F C D Y G Q Q G N G T D T G N V G Y D K MboI | DpnI | |BstKTI | ||Hin4I | ||| BccI | ||| | MmeI BssKI | ||| | | MlyI |MboII | ||| | | PleI |HpaII | ||| | | | Bce83I* ||ScrFI Hin4I | ||| | | | | HinfI ||CauII* | SmlI | ||| | | | | | Hin4I BslFI \\\ \ \ \ \\\ \ \ \ \ \ \ \ GCCGGGTTTTCTTCCAACTCCTTGAGAGATCGTATCAACGATGGGGACTCTAAAGTTGTC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCCCAAAAGAAGGTTGAGGAACTCTCTAGCATAGTTGCTACCCCTGAGATTTCAACAG / / / / // // / // // / / / | | BssKI Hin4I || || | || || | HinfI Hin4I | CauII* || || | || || Hin4I | HpaII || || | || |PleI | ScrFI || || | || Bce83I* MboII || || | || MlyI || || | |MmeI || || | BccI || || MboI || |DpnI || BstKTI |Hin4I SmlI A G F S S N S L R D R I N D G D S K V V P G F L P T P * E I V S T M G T L K L S R V F F Q L L E R S Y Q R W G L * S C H ----:----|----:----|----:----|----:----|----:----|----:----| A P N E E L E K L S R I L S P S E L T T Q R T K K W S R S L D Y * R H P S * L Q G P K R G V G Q S I T D V I P V R F N D Hin4I TfiI | SfeI* HinfI TspDTI MmeI | |CspCI | MnlI |SetI BsmAI CspCI TspEI \ \\ \ \ \\ \ \ \ ATCACTACAGATGAATCCAACAGAGGTGGTAAAGTCATTGAGACTAAAAGAATTGTTGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGATGTCTACTTAGGTTGTCTCCACCATTTCAGTAACTCTGATTTTCTTAACAACTA / / / // // // / | | SfeI* |HinfI |TspDTI |CspCI TspEI | CspCI |TfiI SetI |MmeI BslFI MnlI BsmAI I T T D E S N R G G K V I E T K R I V D S L Q M N P T E V V K S L R L K E L L M H Y R * I Q Q R W * S H * D * K N C * * ----:----|----:----|----:----|----:----|----:----|----:----| M V V S S D L L P P L T M S V L L I T S * * * L H I W C L H Y L * Q S * F F Q Q D S C I F G V S T T F D N L S F S N N I Hin6I FnuDII* |GlaI BssKI ||HhaI SecI* AflIII |||DdeI EcoRII | MaeII |||BsmAI | ScrFI | |BtrI |||Eco31I | BseBI | || SetI Hin4I |||| HgaI | |BsmAI | || TaiI Hin4I \\\\ \ \ \\ \ \\ \ \ GACGCGCTAAGAGAGACCCCAGGCGTGAGACACGTCTTGGTTTATAGAAAGACCAACAAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGCGATTCTCTCTGGGGTCCGCACTCTGTGCAGAACCAAATATCTTTCTGGTTGTTA /// // / /// / / // / ||| || HgaI ||| BsmAI | || Hin4I ||| |Eco31I ||EcoRII | || Hin4I ||| |BsmAI ||BssKI | |AflIII ||| DdeI |SecI* | |MaeII ||Hin6I BseBI | BtrI |GlaI ScrFI TaiI FnuDII* SetI HhaI D A L R E T P G V R H V L V Y R K T N N T R * E R P Q A * D T S W F I E R P T I R A K R D P R R E T R L G L * K D Q Q S ----:----|----:----|----:----|----:----|----:----|----:----| S A S L S V G P T L C T K T * L F V L L H R A L L S G L R S V R R P K Y F S W C V R * S L G W A H S V D Q N I S L G V I Hin4I Hin4I |FatI ||MwoI ||CviAII Hin4I BccI ||| NlaIII BstXI Hin4I \ \\\ \ \ \ CCATCTGTTGCTTTCCATGCCCCCAGAGATTTGGATTGGGCAACAGAAAAGAAGAAATAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGACAACGAAAGGTACGGGGGTCTCTAAACCTAACCCGTTGTCTTTTCTTCTTTATG // / / // / / || | | |FatI BstXI Hin4I || | | CviAII Hin4I || | NlaIII || MwoI |BccI Hin4I Hin4I P S V A F H A P R D L D W A T E K K K Y H L L L S M P P E I W I G Q Q K R R N T I C C F P C P Q R F G L G N R K E E I Q ----:----|----:----|----:----|----:----|----:----|----:----| G D T A K W A G L S K S Q A V S F F F Y D M Q Q K G H G W L N P N P L L F S S I W R N S E M G G S I Q I P C C F L L F V FatI |CviAII || CviRI* || NlaIII || | BseMII || | |BspCNI || | || Hin4I || | || Hin4I || | || |MnlI || | || ||TfiI || | || ||HinfI || | || ||| BinI* || | || ||| |DdeI || | || ||| ||Hpy188I || | || ||| ||| MboI || | || ||| ||| BamHI || | || ||| ||| XhoII || | || ||| ||| | DpnI AccI || | || ||| ||| | NlaIV |BssNAI MboII || | || ||| ||| | |BstKTI |Hpy166II | SetI || | || ||| ||| | || BinI* || MaeII \ \ \\ \ \\ \\\ \\\ \ \\ \ \\ \ AAGACCTACTATCCATGCACACCCGTTGATTCTGAGGATCCATTATTCTTGTTGTATACG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGGATGATAGGTACGTGTGGGCAACTAAGACTCCTAGGTAATAAGAACAACATATGC // / // // / // / // / / // / |SetI | || || MnlI || | || | BinI* || MaeII MboII | || |BspCNI || | || XhoII |AccI | || BseMII || | || BamHI |TaiI | || Hin4I || | || MboI |SetI | || Hin4I || | |NlaIV Hpy166II | |CviRI* || | |DpnI BssNAI | |FatI || | BstKTI | CviAII || DdeI NlaIII |Hpy188I |BinI* HinfI TfiI K T Y Y P C T P V D S E D P L F L L Y T R P T I H A H P L I L R I H Y S C C I R D L L S M H T R * F * G S I I L V V Y V ----:----|----:----|----:----|----:----|----:----|----:----| L V * * G H V G T S E S S G N N K N Y V C S R S D M C V R Q N Q P D M I R T T Y L G V I W A C G N I R L I W * E Q Q I R HgiCI* | BsrI | NlaIV | | SduI | | BseSI SetI | | | StyI MaeIII BseYI TaiI | | | SecI* BspMI AciI | SetI | GsaI \ \ \ \ \ \ \ \ \ \ \ TCTGGTTCTACTGGTGCCCCCAAGGGTGTTCAACATTCTACCGCAGGTTACTTGCTGGGA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AGACCAAGATGACCACGGGGGTTCCCACAAGTTGTAAGATGGCGTCCAATGAACGACCCT /// / / / // / / // ||| HgiCI* SecI* | |SetI | | |SetI ||NlaIV StyI | AciI | | BseYI |BseSI BspMI | GsaI |SduI MaeIII BsrI S G S T G A P K G V Q H S T A G Y L L G L V L L V P P R V F N I L P Q V T C W E W F Y W C P Q G C S T F Y R R L L A G S ----:----|----:----|----:----|----:----|----:----|----:----| D P E V P A G L P T * C E V A P * K S P T Q N * Q H G W P H E V N * R L N S A P R T R S T G G L T N L M R G C T V Q Q S MboII | MaeII | | SetI | | TaiI HindII | | BbvII* Hpy166II | | | MboII | FatI | | | | BsmAI | |CviAII | | | | | AluI | || Hin6I | | | | | CviJI AluI | || NlaIII | | | | | PvuII CviJI | || |GlaI | | | | | NspBII* | SetI | || ||HhaI HphI | | | | | | SetI \ \ \ \\ \\\ \ \ \ \ \ \ \ \ GCTTTGTTGACCATGCGCTACACTTTTGACACTCACCAAGAAGACGTTTTCTTCACAGCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACAACTGGTACGCGATGTGAAAACTGTGAGTGGTTCTTCTGCAAAAGAAGTGTCGA / / / //// / / / / / / / / CviJI | | |||Hin6I HphI | | | | | | BsmAI AluI | | ||GlaI | | | | | NspBII* | | |FatI | | | | | PvuII | | |HhaI | | | | | CviJI | | CviAII | | | | | AluI | NlaIII | | | | SetI Hpy166II | | | BbvII* HindII | | | MboII | | MaeII | TaiI | SetI MboII A L L T M R Y T F D T H Q E D V F F T A L C * P C A T L L T L T K K T F S S Q L F V D H A L H F * H S P R R R F L H S W ----:----|----:----|----:----|----:----|----:----|----:----| A K N V M R * V K S V * W S S T K K V A L K T S W A S C K Q C E G L L R K R * L S Q Q G H A V S K V S V L F V N E E C S GsuI Eco57MI | CviJI | HaeIII | | MslI AsuI* | | BslFI AvaII | | | OliI |BmgT120I CviJI | | | MslI ||NlaIV \ \ \ \ \ \\\ GGAGACATTGGCTGGATTACAGGCCACACTTATGTGGTTTATGGTCCCTTACTATATGGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCTGTAACCGACCTAATGTCCGGTGTGAATACACCAAATACCAGGGAATGATATACCA / / / / / / // CviJI | | | | BslFI |AvaII | | | MslI |AsuI* | | | OliI BmgT120I | | MslI NlaIV | HaeIII | CviJI Eco57MI GsuI G D I G W I T G H T Y V V Y G P L L Y G E T L A G L Q A T L M W F M V P Y Y M V R H W L D Y R P H L C G L W S L T I W L ----:----|----:----|----:----|----:----|----:----|----:----| P S M P Q I V P W V * T T * P G K S Y P Q L C Q S S * L G C K H P K H D R V I H S V N A P N C A V S I H N I T G * * I T Csp6I Hin4II* |RsaI | MlyI || BslFI BsiYI* | PleI HinfI || | TspEI |BsiYI* \ \ \ \\ \ \ \\ TGTGCCACTTTGGTCTTTGAAGGGACTCCTGCGTACCCAAATTACTCCCGTTATTGGGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGGTGAAACCAGAAACTTCCCTGAGGACGCATGGGTTTAATGAGGGCAATAACCCTA / // / // / / // | |PleI HinfI || | TspEI |BsiYI* | MlyI || BslFI BsiYI* Hin4II* |Csp6I RsaI C A T L V F E G T P A Y P N Y S R Y W D V P L W S L K G L L R T Q I T P V I G I C H F G L * R D S C V P K L L P L L G Y ----:----|----:----|----:----|----:----|----:----|----:----| Q A V K T K S P V G A Y G F * E R * Q S N H W K P R Q L S E Q T G L N S G N N P T G S Q D K F P S R R V W I V G T I P I Hin6I MaeIII TaqII Tsp45I |GlaI | TspDTI ||HhaI HphI | | TspEI ||| MwoI \ \ \ \ \\\ \ ATTATTGATGAACACAAAGTCACCCAATTTTATGTTGCGCCAACTGCTTTGCGTTTGTTG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAACTACTTGTGTTTCAGTGGGTTAAAATACAACGCGGTTGACGAAACGCAAACAAC / / / / / //// HphI | | TspEI | |||MwoI | Tsp45I | ||Hin6I | MaeIII | |GlaI TspDTI | HhaI TaqII I I D E H K V T Q F Y V A P T A L R L L L L M N T K S P N F M L R Q L L C V C * Y * * T Q S H P I L C C A N C F A F V E ----:----|----:----|----:----|----:----|----:----|----:----| I I S S C L T V W N * T A G V A K R K N Y * Q H V C L * G I K H Q A L Q K A N T N N I F V F D G L K I N R W S S Q T Q Q AluI CviJI | SetI | | TfiI HphI TaqII | | HinfI |TaqI MseI |EcoP15I \ \ \ \\ \ \\ AAAAGAGCTGGTGATTCCTACATCGAAAATCATTCCTTAAAATCTTTGCGTTGCTTGGGT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCTCGACCACTAAGGATGTAGCTTTTAGTAAGGAATTTTAGAAACGCAACGAACCCA / / / / / / / / | CviJI | | TaqI MseI | EcoP15I | AluI | HphI TaqII SetI HinfI TfiI K R A G D S Y I E N H S L K S L R C L G K E L V I P T S K I I P * N L C V A W V K S W * F L H R K S F L K I F A L L G F ----:----|----:----|----:----|----:----|----:----|----:----| F L A P S E * M S F * E K F D K R Q K P S F L Q H N R C R F D N R L I K A N S P F S S T I G V D F I M G * F R Q T A Q T CviJI | MfeI | TspEI | | TseI | | HphI Csp6I | | |BisI |RsaI | | ||BlsI || Eco57I SetI McrI* | | ||| BplI || Eco57MI BplI |BbvI | | ||| BplI || |Hpy188I BplI \\ \ \ \\\ \ \\ \\ \ TCGGTCGGTGAGCCAATTGCTGCTGAAGTTTGGGAGTGGTACTCTGAAAAAATAGGTAAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCAGCCACTCGGTTAACGACGACTTCAAACCCTCACCATGAGACTTTTTTATCCATTT / / / / /// /// / // McrI* | CviJI | ||TseI ||| Hpy188I |SetI BbvI | |BisI ||Eco57MI BplI | BlsI ||Eco57I BplI | BplI |Csp6I | BplI RsaI TspEI HphI MfeI S V G E P I A A E V W E W Y S E K I G K R S V S Q L L L K F G S G T L K K * V K G R * A N C C * S L G V V L * K N R * K ----:----|----:----|----:----|----:----|----:----|----:----| E T P S G I A A S T Q S H Y E S F I P L N P R H A L Q Q Q L K P T T S Q F F L Y R D T L W N S S F N P L P V R F F Y T F AccI MaeIII TspDTI TfiI Tsp45I |Hpy166II HinfI BstEII || SetI BsrI | AlwNI HphI | SfaNI \\ \ \ \ \ \ \ \ AATGAAATCCCCATTGTAGACACCTACTGGCAAACAGAATCTGGTTCGCATCTGGTCACC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTTAGGGGTAACATCTGTGGATGACCGTTTGTCTTAGACCAAGCGTAGACCAGTGG / // / / / / / / | || SetI BsrI | HinfI HphI BstEII | |AccI | TfiI Tsp45I | Hpy166II AlwNI MaeIII TspDTI N E I P I V D T Y W Q T E S G S H L V T M K S P L * T P T G K Q N L V R I W S P * N P H C R H L L A N R I W F A S G H P ----:----|----:----|----:----|----:----|----:----|----:----| F S I G M T S V * Q C V S D P E C R T V F H F G W Q L C R S A F L I Q N A D P * I F D G N Y V G V P L C F R T R M Q D G AciI | NspBII* | | Cac8I BssKI MnlI | | | CviJI |HpaII | SfaNI | | | BsiYI* ||ScrFI TspDTI | |BsiYI* | | | |FauI MaeIII ||CauII* | MboII | || Hin4II* \ \ \ \\ \ \\\ \ \ \ \\ \ CCGCTGGCTGGTGGTGTTACACCAATGAAACCGGGTTCTGCCTCATTCCCCTTCTTCGGT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GGCGACCGACCACCACAATGTGGTTACTTTGGCCCAAGACGGAGTAAGGGGAAGAAGCCA / /// / / / / / / / / / // | ||| | FauI MaeIII | | | MboII | | |Hin4II* | ||| CviJI | | TspDTI | | SfaNI | ||Cac8I | BssKI | BsiYI* | |BsiYI* CauII* MnlI | NspBII* HpaII | AciI ScrFI SfaNI P L A G G V T P M K P G S A S F P F F G R W L V V L H Q * N R V L P H S P S S V A G W W C Y T N E T G F C L I P L L R Y ----:----|----:----|----:----|----:----|----:----|----:----| G S A P P T V G I F G P E A E N G K K P G A P Q H H * V L S V P N Q R M G R R R R Q S T T N C W H F R T R G * E G E E T MseI | HphI | | MboII | | | CviJI BsiYI* | | | |MnlI | BsrI | | | || BceAI CviRI* Hpy178III* | TspRI | | | || | BsiYI* \ \ \ \ \ \ \ \\ \ \ ATTGATGCAGTTGTTCTTGACCCTAACACTGGTGAAGAACTTAACACCAGCCACGCAGAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTACGTCAACAAGAACTGGGATTGTGACCACTTCTTGAATTGTGGTCGGTGCGTCTC / / // / // / / / / CviRI* | || BsrI || | | | BceAI | |BsiYI* || | | BsiYI* | TspRI || | CviJI Hpy178III* || | MnlI || MboII |MseI HphI I D A V V L D P N T G E E L N T S H A E L M Q L F L T L T L V K N L T P A T Q R * C S C S * P * H W * R T * H Q P R R G ----:----|----:----|----:----|----:----|----:----|----:----| I S A T T R S G L V P S S S L V L W A S Y Q H L Q E Q G * C Q H L V * C W G R L N I C N N K V R V S T F F K V G A V C L MwoI | TseI | AluI | CviJI | |BisI | ||BlsI | ||SetI | |||FatI | |||CviRI* | ||||CviAII | ||||| CfrI | ||||| |NlaIII FatI | ||||| ||BalI BspHI | ||||| ||CviJI BccI |CviAII BbvI | ||||| ||HaeIII |CviRI* |Hpy178III* \ \ \\\\\ \\\ \\ \\ GGTGTCCTTGCCGTCAAAGCTGCATGGCCATCATTTGCAAGAACTATTTGGAAAAATCAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAGGAACGGCAGTTTCGACGTACCGGTAGTAAACGTTCTTGATAAACCTTTTTAGTA / / / //// /// / / / / | | | |||| ||| CfrI CviRI* | Hpy178III* | | | |||| ||HaeIII BccI | CviAII | | | |||| ||CviJI NlaIII | | | |||| ||BalI | | | |||| |FatI | | | |||| CviAII | | | |||CviRI* | | | |||NlaIII | | | |||TseI | | | ||BisI | | | |BlsI | | | CviJI | | | AluI | | SetI | MwoI BbvI G V L A V K A A W P S F A R T I W K N H V S L P S K L H G H H L Q E L F G K I M C P C R Q S C M A I I C K N Y L E K S * ----:----|----:----|----:----|----:----|----:----|----:----| P T R A T L A A H G D N A L V I Q F F * P H G Q R * L Q M A M M Q L F * K S F D T D K G D F S C P W * K C S S N P F I M BssKI NlaIII SecI* | BsaBI EcoRII | | SetI |BsiYI* | | | XbaI ||ScrFI | | | |MaeI ||BseBI BbvI BsrI | | | |Hpy178III* TsoI ||| CviJI |BccI TspRI \ \ \ \\ \ \\\ \ \\ \ GATAGGTATCTAGACACTTATTTGAACCCTTACCCTGGCTACTATTTCACTGGTGATGGT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCCATAGATCTGTGAATAAACTTGGGAATGGGACCGATGATAAAGTGACCACTACCA / / / // / / /// / / / | | BsaBI |XbaI TsoI | ||EcoRII | | BsrI | SetI Hpy178III* | ||BssKI | | BbvI BspHI MaeI | ||CviJI | BccI FatI | |SecI* TspRI | BseBI | ScrFI BsiYI* D R Y L D T Y L N P Y P G Y Y F T G D G I G I * T L I * T L T L A T I S L V M V * V S R H L F E P L P W L L F H W * W C ----:----|----:----|----:----|----:----|----:----|----:----| S L Y R S V * K F G * G P * * K V P S P H Y T D L C K N S G K G Q S S N * Q H H I P I * V S I Q V R V R A V I E S T I T TseI |BisI AccI ||BlsI |Hpy166II |||HphI || Hin4I |||CviRI* Hin4I || Hin4I |||| TsoI Hin4I Hpy178III* || | Hpy166II |||| | BccI BseGI |FokI || | | MaeII \\\\ \ \ \ \\ \\ \ \ \ GCTGCAAAGGATAAGGATGGTTATATCTGGATTTTGGGTCGTGTAGACGATGTGGTGAAC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGTTTCCTATTCCTACCAATATAGACCTAAAACCCAGCACATCTGCTACACCACTTG /// / / / / / / // / // / ||| TsoI BccI | BseGI | FokI || Hin4I || HphI ||CviRI* Hin4I Hpy178III* || Hin4I |TaiI ||TseI Hin4I |AccI |SetI |HphI Hpy166II Hpy166II |BisI BlsI A A K D K D G Y I W I L G R V D D V V N L Q R I R M V I S G F W V V * T M W * T C K G * G W L Y L D F G S C R R C G E R ----:----|----:----|----:----|----:----|----:----|----:----| A A F S L S P * I Q I K P R T S S T T F H Q L P Y P H N Y R S K P D H L R H P S S C L I L I T I D P N Q T T Y V I H H V HphI |SetI |TaiI || HphI || BsmAI || Esp3I || |MaeIII || |Tsp45I || |BstEII BinI* || || Tsp4CI* |TaqI || || | AccI || MboI || || | |Hpy166II || XhoII || || | || AciI || | DpnI || || | || |BbvI TseI || | |BstKTI || || | || ||NspBII* CviJI || | || MfeI || || | || ||| MnlI |BisI || | || TspEI || || | || ||| | TspEI ||BlsI || | || | MmeI \\ \\ \ \\ \\\ \ \ \\\ \\ \ \\ \ \ GTCTCTGGTCACCGTCTGTCTACCGCTGAAATTGAGGCTGCTATTATCGAAGATCCAATT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGACCAGTGGCAGACAGATGGCGACTTTAACTCCGACGATAATAGCTTCTAGGTTAA / / / / // // / / //// / / // / / / | HphI | Tsp4CI* || || BbvI | |||TseI | | || | | MboII MaeII | BstEII || |MnlI | ||BisI | | || | | TspEI | Tsp45I || NspBII* | |BlsI | | || | | MfeI | MaeIII || AciI | CviJI | | || | MmeI Esp3I |AccI TspEI | | || XhoII BsmAI Hpy166II | | || MboI | | |DpnI | | BstKTI | TaqI BinI* V S G H R L S T A E I E A A I I E D P I S L V T V C L P L K L R L L L S K I Q L L W S P S V Y R * N * G C Y Y R R S N C ----:----|----:----|----:----|----:----|----:----|----:----| T E P * R R D V A S I S A A I I S S G I R R Q D G D T * R Q F Q P Q * * R L D L D R T V T Q R G S F N L S S N D F I W N TseI MwoI MboII AlwNI |CfrI BstAPI || CviJI Hpy188I |BisI || HaeIII |TfiI BbvI ||BlsI || | MwoI |HinfI NmeAIII | BsrI |||CviRI* \\ \ \ \\ \ \ \ \\\\ GTGGCCGAGTGTGCTGTTGTCGGATTCAACGATGACTTGACTGGTCAAGCAGTTGCTGCA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CACCGGCTCACACGACAACAGCCTAAGTTGCTACTGAACTGACCAGTTCGTCAACGACGT / // / / / / / / /// | |MwoI | | NmeAIII | BbvI | ||CviRI* | CfrI | HinfI BsrI | ||TseI HaeIII | TfiI | |BisI CviJI Hpy188I | BlsI BstAPI AlwNI MwoI V A E C A V V G F N D D L T G Q A V A A W P S V L L S D S T M T * L V K Q L L H G R V C C C R I Q R * L D W S S S C C I ----:----|----:----|----:----|----:----|----:----|----:----| T A S H A T T P N L S S K V P * A T A A Q P R T H Q Q R I * R H S S Q D L L Q Q H G L T S N D S E V I V Q S T L C N S C AsuI* AvaII |BmgT120I || Hpy166II MaeI || | AciI TspEI EcoRV \ \\ \ \ \ \ TTTGTGGTGTTGAAAAACAAATCTAGTTGGTCCACCGCAACAGATGATGAATTACAAGAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AAACACCACAACTTTTTGTTTAGATCAACCAGGTGGCGTTGTCTACTACTTAATGTTCTA / // / / / MaeI || AciI TspEI TspDTI |Hpy166II EcoRV |AvaII |AsuI* BmgT120I F V V L K N K S S W S T A T D D E L Q D L W C * K T N L V G P P Q Q M M N Y K I C G V E K Q I * L V H R N R * * I T R Y ----:----|----:----|----:----|----:----|----:----|----:----| N T T N F F L D L Q D V A V S S S N C S M Q P T S F C I * N T W R L L H H I V L K H H Q F V F R T P G G C C I I F * L I AsuI* AciI |BmgT120I BisI TspDTI ||CviJI |BlsI |Hpy178III* Tsp4CI* ||HaeIII ||TauI TspEI \\ \ \\\ \\\ \ ATCAAGAAGCATTTGGTCTTTACTGTTAGAAAAGACATCGGGCCATTTGCCGCACCAAAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTCTTCGTAAACCAGAAATGACAATCTTTTCTGTAGCCCGGTAAACGGCGTGGTTTT / / // //// Hpy178III* Tsp4CI* |AsuI* |||AciI | ||BisI | |BlsI | TauI BmgT120I HaeIII CviJI I K K H L V F T V R K D I G P F A A P K S R S I W S L L L E K T S G H L P H Q N Q E A F G L Y C * K R H R A I C R T K I ----:----|----:----|----:----|----:----|----:----|----:----| I L F C K T K V T L F S M P G N A A G F Y * S A N P R * Q * F L C R A M Q R V L D L L M Q D K S N S F V D P W K G C W F FokI |BinI* MboI || MboI BclI || XhoII | DpnI || | DpnI TspEI MaeII | |BstKTI || | |BstKTI |Esp3I | SetI | || MslI BseGI || | ||HpaII |BsmAI | TaiI \ \\ \ \ \\ \ \\\ \\ \ \ TTGATCATTTTAGTGGATGACTTGCCCAAGACAAGATCCGGCAAAATTATGAGACGTATT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAGTAAAATCACCTACTGAACGGGTTCTGTTCTAGGCCGTTTTAATACTCTGCATAA /// / / / / / // / / // / / ||| | MslI BseGI | | || | HpaII || | MaeII ||| BclI | | || XhoII || TaiI ||| MboI | | || MboI || SetI ||DpnI | | |DpnI |BsmAI |BstKTI | | BstKTI |Esp3I TspEI | FokI TspEI BinI* L I I L V D D L P K T R S G K I M R R I * S F * W M T C P R Q D P A K L * D V F D H F S G * L A Q D K I R Q N Y E T Y F ----:----|----:----|----:----|----:----|----:----|----:----| N I M K T S S K G L V L D P L I I L R I I S * K L P H S A W S L I R C F * S V Y Q D N * H I V Q G L C S G A F N H S T N MaeII | Hpy99I BssKI MaeIII | |SetI SecI* MseI MaeI Tsp45I MaeI | |TaiI EcoRII \ \ \ \ \ \\ \ TTAAGAAAAATCCTAGCAGGAGAAAGTGACCAACTAGGCGACGTTTCTACATTGTCAAAC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCTTTTTAGGATCGTCCTCTTTCACTGGTTGATCCGCTGCAAAGATGTAACAGTTTG / / / / / / / MseI MaeI | | | | MaeII | | | TaiI | | | SetI | | Hpy99I | MaeI Tsp45I MaeIII L R K I L A G E S D Q L G D V S T L S N * E K S * Q E K V T N * A T F L H C Q T K K N P S R R K * P T R R R F Y I V K P ----:----|----:----|----:----|----:----|----:----|----:----| K L F I R A P S L S W S P S T E V N D F K L F F G L L L F H G V L R R K * M T L * S F D * C S F T V L * A V N R C Q * V TaqII | TspEI ScrFI | | TfiI BseBI | | HinfI \ \ \ \ CCTGGCATTGTTAGACATCTAATTGATTCGGTCAAGTTGTAA 2110 2120 2130 2140 ----:----|----:----|----:----|----:----|-- GGACCGTAACAATCTGTAGATTAACTAAGCCAGTTCAACATT /// / / / ||EcoRII TaqII | HinfI ||BssKI | TfiI |SecI* TspEI BseBI ScrFI P G I V R H L I D S V K L * L A L L D I * L I R S S C X W H C * T S N * F G Q V V X ----:----|----:----|----:----|----:----|-- G P M T L C R I S E T L N Y G Q C Q * V D L Q N P * T T R A N N S M * N I R D L Q L # Enzymes that cut Frequency Isoschizomers AccI 4 FblI,XmiI AciI 7 BspACI,SsiI AflIII 1 AhaIII* 1 DraI AluI 5 AluBI AlwNI 2 CaiI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BalI 3 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 7 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 1 BpuEI BceAI 4 BcgI 1 BclI 1 FbaI,Ksp22I BdaI 2 BfiI 1 BmrI,BmuI BglI 1 BinI* 4 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmgT120I 6 BplI 2 BsaBI 1 Bse8I,BseJI BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 2 BseSI 1 BaeGI,BstSLI BseYI 1 BsiYI* 10 Bsc4I,BseLI,BslI,AfiI BslFI 5 BsmFI,FaqI BsmAI 6 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrI 7 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 6 BstXI 1 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 4 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I CfrI 5 AcoI,EaeI Csp6I 4 CviQI,RsaNI CspCI 1 CviAII 9 CviJI 25 CviKI-1 CviRI* 10 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 6 MalI DraII 1 EcoO109I Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 2 EcoNI 1 BstENI,XagI EcoP15I 2 EcoRII 4 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 2 BsmBI FatI 9 FauI 2 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 5 GsaI 1 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 9 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 5 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 5 HpyAV Hin6I 5 HinP1I,HspAI HindII 2 HincII HinfI 10 HpaII 3 HapII,BsiSI,MspI HphI 10 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 4 Hpy99I 1 MaeI 5 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 8 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 13 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 3 MunI MlyI 4 SchI MmeI 3 MnlI 8 MseI 5 Tru1I,Tru9I MslI 5 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 7 HpyF10VI,BstMWI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 3 MspA1I NspI 2 BstNSI,XceI OliI 1 AleI PleI 4 PpsI PshAI 1 BstPAI,BoxI PstI 1 PvuII 1 RsaI 4 AfaI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 21 SfaNI 2 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 4 TaqII 4 TatI 1 TauI 2 TfiI 6 PfeI TseI 7 ApeKI TsoI 2 Tsp45I 5 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 14 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI XbaI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AjuI AlfI AloI ApaI ApaLI ApoI AscI Asp718I AvaI AvrII BaeI BarI BbvCI BciVI BetI* BglII BmeT110I BmtI Bpu10I BsaAI BsaXI BsePI BseRI BsgI BsiI* BsmI Bsp120I BspLU11I* BspMII* BspOI BsrBI BsrDI BtgZI Cfr10I Cfr9I ClaI DinI DraIII DrdI DsaI* Eam1105I EciI Ecl136II EcoICRI EcoRI EgeI EheI EspI* FalI FseI FspAI HgiAI* HgiJII* HindIII HpaI KasI KpnI Ksp632I* MauBI MluI MroNI NaeI NarI NcoI NdeI NgoMIV NheI NotI NruI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TspMI TstI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769