Restriction Map of SPC72/YAL047C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SPC72/YAL047C on chromosome I from coordinates 56857 to 54989.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Csp6I |BccI |RsaI ||TstI ||MaeII ||| TaqI ||| SetI ||| TaiI ||| | Hpy99I ||| | | TfiI ||| | | HinfI MboII TstI BsrI ||| | | | MaeI | Cac8I |SfaNI TspRI \\\ \ \ \ \ \ \ \\ \ ATGGTACGTCGATGGATTCCTAGTGGCAGGCATCTTCGCAATAATGACAACACTGGTGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATGCAGCTACCTAAGGATCACCGTCCGTAGAAGCGTTATTACTGTTGTGACCACTA / // / / / / / / / / / / | || | TaqI | | | | TstI | TspRI BsrI | || MaeII | | | Cac8I SfaNI | |Hpy99I | | MboII | |Csp6I | MaeI | |BccI HinfI | RsaI TfiI | TaiI | SetI TstI M V R R W I P S G R H L R N N D N T G D W Y V D G F L V A G I F A I M T T L V M G T S M D S * W Q A S S Q * * Q H W * * ----:----|----:----|----:----|----:----|----:----|----:----| X T R R H I G L P L C R R L L S L V P S X P V D I S E * H C A D E C Y H C C Q H H Y T S P N R T A P M K A I I V V S T I FokI | MlyI Hpy166II | PleI | BccI TfiI | DdeI HphI | | TaqI HinfI BseGI | | BccI \ \ \ \ \ \ \ \ \ GATGACGACAGCGAGTTCACAAACTCGATGGATTCTGGGATGTCCATACCATCACTCAGG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGCTGTCGCTCAAGTGTTTGAGCTACCTAAGACCCTACAGGTATGGTAGTGAGTCC / / / / / / // / HphI | BccI TaqI HinfI BseGI || BccI Hpy166II TfiI || DdeI |PleI FokI MlyI D D D S E F T N S M D S G M S I P S L R M T T A S S Q T R W I L G C P Y H H S G * R Q R V H K L D G F W D V H T I T Q G ----:----|----:----|----:----|----:----|----:----|----:----| S S S L S N V F E I S E P I D M G D S L H H R C R T * L S S P N Q S T W V M V * I V V A L E C V R H I R P H G Y W * E P HinfI | FatI | |BplI | |BplI | |CviAII BinI* | || MnlI | MboI | || BspCNI | | DpnI | || |NlaIII | | |BstKTI | || |BseMII | | || BplI | || || BsiI* | | || BplI | || || |BslFI | | || | CviJI | || || || DrdI | | || | |BccI TfiI | || || || | SetI | | || | ||Cac8I Hpy188I HinfI \ \\ \\ \\ \ \ \ \ \\ \ \\\ \ \ GACTCCATGACCACGAGGTCATCTCATAACGATCCCATCAAGCCTGCTCTGATGAACGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGGTACTGGTGCTCCAGTAGAGTATTGCTAGGGTAGTTCGGACGAGACTACTTGCTA / ////// / /// / //// / / / | |||||| | ||BslFI | |||MboI | | Hpy188I | |||||| | |BsiI* | ||BplI | Cac8I | |||||| | SetI | ||BplI | BccI | |||||| DrdI | |DpnI CviJI | |||||FatI | BstKTI | ||||CviAII BinI* | |||BseMII | |||MnlI | ||BspCNI | |NlaIII | HinfI BplI BplI D S M T T R S S H N D P I K P A L M N D T P * P R G H L I T I P S S L L * * T I L H D H E V I S * R S H Q A C S D E R F ----:----|----:----|----:----|----:----|----:----|----:----| S E M V V L D D * L S G M L G A R I F S P S W S W S T M E Y R D W * A Q E S S R V G H G R P * R M V I G D L R S Q H V I BsaXI TspDTI | Hpy178III* | BsaXI | | TatI | | ApoI | | |Csp6I | | TspEI HindII | | TfiI ||RsaI | | | Hin4II* MmeI Hpy166II | | HinfI ||ScaI \ \ \ \ \ \ \ \ \ \\\ TCCAACAAAGTCAAAAATTTGGAGAAGGAGTTGACTAATGCCAAAATCAAGATTCAAGTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGTTTCAGTTTTTAAACCTCTTCCTCAACTGATTACGGTTTTAGTTCTAAGTTCAT / / / / / / / / / / // | | BsaXI | | MmeI | BsaXI | | |Csp6I | TspDTI | TspEI Hpy166II | | ScaI HinfI | ApoI HindII | | RsaI TfiI Hin4II* | HinfI | TfiI Hpy178III* S N K V K N L E K E L T N A K I K I Q V P T K S K I W R R S * L M P K S R F K Y Q Q S Q K F G E G V D * C Q N Q D S S T ----:----|----:----|----:----|----:----|----:----|----:----| E L L T L F K S F S N V L A L I L I * T N W C L * F N P S P T S * H W F * S E L G V F D F I Q L L L Q S I G F D L N L Y BseYI BceAI TfiI |BsiYI* HinfI CviRI* || BccI XmnI TspDTI BtgZI | BsrDI || |GsaI \ \ \ \ \ \\ \\ CTCTATGAATACATTCGCAGAATCCCTAATAAAGACGGCAATGCACCATCGCTGGGCAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GAGATACTTATGTAAGCGTCTTAGGGATTATTTCTGCCGTTACGTGGTAGCGACCCGTTA / / / / / / / / / / / TatI XmnI | HinfI BtgZI | | | | | TspRI | TfiI | | | | BseYI TspDTI | | | | BccI | | | BceAI | | GsaI | BsiYI* CviRI* BsrDI L Y E Y I R R I P N K D G N A P S L G N S M N T F A E S L I K T A M H H R W A M L * I H S Q N P * * R R Q C T I A G Q * ----:----|----:----|----:----|----:----|----:----|----:----| S * S Y M R L I G L L S P L A G D S P L V R H I C E C F G * Y L R C H V M A P C E I F V N A S D R I F V A I C W R Q A I ApoI TspEI | TaqI BsrDI TspRI | | MnlI TaqI Hpy178III* TspEI \ \ \ \ \ \ \ \ GACACTGATTTTAGAAATTCGATTATCGAGGGTCTAAATCTTGAAATAAACAAATTGAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGACTAAAATCTTTAAGCTAATAGCTCCCAGATTTAGAACTTTATTTGTTTAACTTT / /// / / / BsrDI ||TaqI TaqI Hpy178III* TspEI |MnlI TspEI ApoI D T D F R N S I I E G L N L E I N K L K T L I L E I R L S R V * I L K * T N * N H * F * K F D Y R G S K S * N K Q I E T ----:----|----:----|----:----|----:----|----:----|----:----| S V S K L F E I I S P R F R S I F L N F H C Q N * F N S * R P D L D Q F L C I S V S I K S I R N D L T * I K F Y V F Q F MseI TaqI Hpy178III* |AhaIII* | Csp6I | ApoI ||Hin4II* | |RsaI TspEI | TspEI \\\ \ \\ \ \ \ CAGGATTTAAAGGCGAAGGAAGTCGAGTACCAAGATACGCTACAATTCGTTCAAGAGAAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTAAATTTCCGCTTCCTTCAGCTCATGGTTCTATGCGATGTTAAGCAAGTTCTCTTA // / // / / |MseI | |Csp6I TspEI Hpy178III* AhaIII* | RsaI Hin4II* TaqI Q D L K A K E V E Y Q D T L Q F V Q E N R I * R R R K S S T K I R Y N S F K R I G F K G E G S R V P R Y A T I R S R E F ----:----|----:----|----:----|----:----|----:----|----:----| C S K F A F S T S Y W S V S C N T * S F V P N L P S P L R T G L Y A V I R E L S L I * L R L F D L V L I R * L E N L L I Hpy178III* | HphI | TstI BdaI | |MboI ApoI BdaI | || DpnI BdaI TspEI Hpy188I | || |BstKTI SetI BdaI TstI \ \ \ \\ \\ \ \ \ TTAGAAAATTCGGAAAGTATCGTGAATACGATCAATCACCTATTGTCCTTTATATTGACG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTTTAAGCCTTTCATAGCACTTATGCTAGTTAGTGGATAACAGGAAATATAACTGC / // / / // / / / / TspEI |Hpy188I | | || | SetI BdaI TstI ApoI TspEI | | || MboI BdaI ApoI | | |DpnI BdaI | | BstKTI BdaI | HphI Hpy178III* TstI L E N S E S I V N T I N H L L S F I L T * K I R K V S * I R S I T Y C P L Y * R R K F G K Y R E Y D Q S P I V L Y I D A ----:----|----:----|----:----|----:----|----:----|----:----| K S F E S L I T F V I L * R N D K I N V N L F N P F Y R S Y S * D G I T R * I S * F I R F T D H I R D I V * Q G K Y Q R MnlI TspDTI |MboII | Hpy178III* ||BssKI | |BccI ||SecI* MseI | || Ksp632I* ||EcoRII MslI | || | BsmAI ||| ScrFI |HgaI MboII | || | MnlI Eco31I ||| BseBI \\ \ \ \\ \ \ \ \\\ \ CATTTTAATGAGCAAGATGAAAATGCCCATCTTCTTGATAAAGAAGAGAGGGAGACCCTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAAATTACTCGTTCTACTTTTACGGGTAGAAGAACTATTTCTTCTCTCCCTCTGGGAC / / / / / / // / // // | | HgaI MboII | | |Ksp632I* | || |SecI* | MseI | | MnlI | || BseBI MslI | Hpy178III* | || ScrFI | BccI | || BplI TspDTI | || BplI | |MboII | MnlI Eco31I BsmAI H F N E Q D E N A H L L D K E E R E T L I L M S K M K M P I F L I K K R G R P W F * * A R * K C P S S * * R R E G D P G ----:----|----:----|----:----|----:----|----:----|----:----| C K L S C S S F A W R R S L S S L S V R A N * H A L H F H G D E Q Y L L S P S G M K I L L I F I G M K K I F F L P L G Q AluI CviJI |DdeI |EspI* ||SetI ||| GsuI ||| Eco57MI ||| |AluI ||| |CviJI ||| |Ecl136II ||| || SetI Hpy178III* ||| || SduI | BplI BplI ||| || SacI | BplI BplI ||| || HgiAI* | |Hin4I | BseMII ||| || HgiJII* | |Hin4I TspDTI | |BspCNI ||| || | Hpy188I | || BciVI |FokI \ \\ \\\ \\ \ \ \ \\ \ \\ GAGGAAACTTTAGAGCTGAGCTCGGATTATGTTCTTGAAAAAATGGATACTTTGTCCAAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTTGAAATCTCGACTCGAGCCTAATACAAGAACTTTTTTACCTATGAAACAGGTTC / // / / //// / // / / / / | |BspCNI | | |||| Hpy188I || | BciVI TspDTI FokI | BseMII | | |||Ecl136II || Hpy178III* EcoRII | | |||CviJI |Hin4I BssKI | | |||AluI |Hin4I | | ||EspI* BplI | | ||DdeI BplI | | |HgiJII* | | |HgiAI* | | |SacI | | |SduI | | |SetI | | Eco57MI | | GsuI | CviJI | AluI SetI E E T L E L S S D Y V L E K M D T L S K R K L * S * A R I M F L K K W I L C P S G N F R A E L G L C S * K N G Y F V Q V ----:----|----:----|----:----|----:----|----:----|----:----| S S V K S S L E S * T R S F I S V K D L P P F K L A S S P N H E Q F F P Y K T W L F S * L Q A R I I N K F F H I S Q G L TaqI BseGI | AciI | Hin4I | BsrBI | Hin4I BsmI | | TfiI FalI | |TspEI CviRI* CviRI* | | HinfI FalI \ \\ \ \ \ \ \ \ TTCATCATCCAATTCTTGCAGGACTTTTTGCATTCCAAAAGTCGAGCGGAATCAAAGCAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAGTAGGTTAAGAACGTCCTGAAAAACGTAAGGTTTTCAGCTCGCCTTAGTTTCGTC // / / / / / / / / / |Hin4I | CviRI* | CviRI* | | | | FalI |Hin4I TspEI BsmI | | | | FalI BseGI | | | HinfI | | | TfiI | | AciI | BsrBI TaqI F I I Q F L Q D F L H S K S R A E S K Q S S S N S C R T F C I P K V E R N Q S R H H P I L A G L F A F Q K S S G I K A G ----:----|----:----|----:----|----:----|----:----|----:----| N M M W N K C S K K C E L L R A S D F C T * * G I R A P S K A N W F D L P I L A E D D L E Q L V K Q M G F T S R F * L L MboII | BfiI MnlI | | AsuI* |MboI | | |CviJI || DpnI | | |HaeIII || |BstKTI | | |BmgT120I || || Tsp4CI* | | ||HphI || || |BinI* | | ||BsrI || || || Hin4I | | ||TspRI || || || Hin4I ApoI | | |||BsrI || || || | MlyI TspEI | | |||| FalI || || || | PleI |XmnI | | |||| FalI || || || | |HphI \\ \ \ \\\\ \ \\ \\ \\ \ \\ GATAAGGAAGAATTTCTTTCACTGGCCCAGTCCTCACCAGCAGGATCACAGTTAGAAAGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCCTTCTTAAAGAAAGTGACCGGGTCAGGAGTGGTCGTCCTAGTGTCAATCTTTCA / / // / //// / // / // / // | | || | |||AsuI* | || | || BinI* |PleI | | || | ||BmgT120I | || | |Hin4I MlyI | | || | ||FalI | || | |Hin4I HphI | | || | ||FalI | || | Tsp4CI* | | || | |HaeIII | || MboI | | || | |CviJI | |DpnI | | || | |BsrI | BstKTI | | || | |HphI MnlI | | || | BsrI | | || BfiI | | |MboII | | TspRI | TspEI | ApoI XmnI D K E E F L S L A Q S S P A G S Q L E S I R K N F F H W P S P H Q Q D H S * K V * G R I S F T G P V L T S R I T V R K * ----:----|----:----|----:----|----:----|----:----|----:----| S L S S N R E S A W D E G A P D C N S L P Y P L I E K V P G T R V L L I V T L F I L F F K K * Q G L G * W C S * L * F T HinfI | EcoP15I BciVI ApoI | | MnlI Hin4I | BseRI TspEI | | |BslFI Hin4I | | BdaI | FatI | | || BccI |BccI | | BdaI TspDTI | BspHI \ \ \\ \ \\ \ \ \ \ \ \ AGGGACTCACCATCAAGTAAAGAGGAGAATACTGATGGTGGATACCAGAATGACGAAATT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCTGAGTGGTAGTTCATTTCTCCTCTTATGACTACCACCTATGGTCTTACTGCTTTAA / / / // / / / / / / / | | MnlI || Hin4I | | | BdaI TspDTI NlaIII | EcoP15I || Hin4I | | | BdaI TspEI HinfI |BslFI | | BseRI ApoI BccI | BciVI BccI R D S P S S K E E N T D G G Y Q N D E I G T H H Q V K R R I L M V D T R M T K F G L T I K * R G E Y * W W I P E * R N S ----:----|----:----|----:----|----:----|----:----|----:----| L S E G D L L S S F V S P P Y W F S S I Y P S V M L Y L P S Y Q H H I G S H R F P V * W * T F L L I S I T S V L I V F N CviAII Hpy178III* TatI | NlaIII Tsp4CI* | | MaeIII |Csp6I | | Tsp4CI* ||RsaI | | | BdaI ||ScaI | | | BdaI ||| BceAI TspEI \ \ \ \ \\\ \ \ CATGACAGTAACAACCACATTGATACAGAAAATGTAATGGCAAACAGTACTTCCTTACCA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTGTCATTGTTGGTGTAACTATGTCTTTTACATTACCGTTTGTCATGAAGGAATGGT // / / / /// / || | MaeIII | ||| BceAI || | BdaI | ||TatI || | BdaI | |Csp6I || Tsp4CI* | ScaI |BspHI | RsaI |FatI Tsp4CI* Hpy178III* CviAII H D S N N H I D T E N V M A N S T S L P M T V T T T L I Q K M * W Q T V L P Y Q * Q * Q P H * Y R K C N G K Q Y F L T N ----:----|----:----|----:----|----:----|----:----|----:----| * S L L L W M S V S F T I A F L V E K G E H C Y C G C Q Y L F H L P L C Y K R V M V T V V V N I C F I Y H C V T S G * W CviJI | TaqI BsmAI | | HinfI |PleI DdeI | | Hpy99I ||MlyI |SetI TspEI \ \ \ \\\ \\ \ ATTTCAGCCGTCGAGTCTCGTTTTGAGAAAACCTTAGACACTCAATTAGAGATTGTCATA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGTCGGCAGCTCAGAGCAAAACTCTTTTGGAATCTGTGAGTTAATCTCTAACAGTAT / // / / / / / / / | || | HinfI | BsmAI SetI DdeI TspEI | || TaqI PleI | |Hpy99I MlyI | CviJI TspEI I S A V E S R F E K T L D T Q L E I V I F Q P S S L V L R K P * T L N * R L S * F S R R V S F * E N L R H S I R D C H R ----:----|----:----|----:----|----:----|----:----|----:----| I E A T S D R K S F V K S V * N S I T M L K L R R T E N Q S F R L C E I L S Q * N * G D L R T K L F G * V S L * L N D Y MboI BclI ApoI | DpnI PsiI TspEI ApoI | |BstKTI | ApoI | TaqI TspEI CviRI* | ||TspEI | TspEI | |Hpy178III* \ \ \ \\\ \ \ \ \\ GAAAATTTGCACAAAGAATATGATCAATTTATAAATTCCATTAGATTGAAATTCGAGAAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTAAACGTGTTTCTTATACTAGTTAAATATTTAAGGTAATCTAACTTTAAGCTCTTT / / // / / / / / // | CviRI* || | | PsiI TspEI | |Hpy178III* TspEI || | TspEI ApoI | TaqI ApoI || BclI TspEI || MboI ApoI |DpnI BstKTI E N L H K E Y D Q F I N S I R L K F E K K I C T K N M I N L * I P L D * N S R N K F A Q R I * S I Y K F H * I E I R E I ----:----|----:----|----:----|----:----|----:----|----:----| S F K C L S Y S * N I F E M L N F N S F L F N A C L I H D I * L N W * I S I R S F I Q V F F I I L K Y I G N S Q F E L F BsmAI | MaeI BdaI | | TfiI TspEI HgaI BdaI | | HinfI \ \ \ \ \ \ TCGCAAAAATTAGAAAAAATAATAGCGTCCAAACTAAATGAGCAGTCTCATCTACTAGAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGTTTTTAATCTTTTTTATTATCGCAGGTTTGATTTACTCGTCAGAGTAGATGATCTA / / / / / / TspEI HgaI BdaI | | BdaI BdaI | | BdaI | MaeI BsmAI S Q K L E K I I A S K L N E Q S H L L D R K N * K K * * R P N * M S S L I Y * I A K I R K N N S V Q T K * A V S S T R F ----:----|----:----|----:----|----:----|----:----|----:----| D C F N S F I I A D L S F S C D * R S S I A F I L F F L L T W V L H A T E D V L R L F * F F Y Y R G F * I L L R M * * I ApoI BdaI TspEI BdaI TspGWI MboI |DdeI | MaeI | DpnI || TspEI | | MboII | |BstKTI Hin4II* \\ \ \ \ \ \ \\ \ TCCTTAGAATTGGAAGAAAATTCTAGTTCCGTTATAGAAAAACAAGATCATTTGATTTCC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAATCTTAACCTTCTTTTAAGATCAAGGCAATATCTTTTTGTTCTAGTAAACTAAAGG / / / / / // // / / | DdeI | | | |MaeI || MboI Hin4II* HinfI | | | MboII |DpnI TfiI | | TspEI BstKTI | | ApoI | TspGWI TspEI S L E L E E N S S S V I E K Q D H L I S P * N W K K I L V P L * K N K I I * F P L R I G R K F * F R Y R K T R S F D F P ----:----|----:----|----:----|----:----|----:----|----:----| E K S N S S F E L E T I S F C S * K I E N R L I P L F N * N R * L F V L D N S K G * F Q F F I R T G N Y F F L I M Q N G MboI | DpnI | |TaqI | |BstKTI | || TfiI Eco57I Hpy178III* Hin4II* BsiYI* | || HinfI Eco57MI | TspEI |TspEI \ \ \\ \ \ \ \ \\ CAACTGAAGGAAAAGATCGAATCGCAATCTGTCTTGATAAACAATTTGGAAAAATTGAAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGACTTCCTTTTCTAGCTTAGCGTTAGACAGAACTATTTGTTAAACCTTTTTAACTTC / // // // / / / / BsiYI* || || |Eco57MI Hpy178III* | | TspEI || || |Eco57I | Hin4II* || || HinfI TspEI || || TfiI || |TaqI || MboI |DpnI BstKTI Q L K E K I E S Q S V L I N N L E K L K N * R K R S N R N L S * * T I W K N * R T E G K D R I A I C L D K Q F G K I E G ----:----|----:----|----:----|----:----|----:----|----:----| W S F S F I S D C D T K I F L K S F N F G V S P F S R I A I Q R S L C N P F I S L Q L F L D F R L R D Q Y V I Q F F Q L BstXI BbvII* | BsrI | MseI TspDTI | |TsoI | | MslI | MseI | || DdeI | | MboII | | TspDTI | || | Hpy188I \ \ \ \ \ \ \ \\ \ \ GAAGACATCATTAAAATGAAACAAAATGAAAAAGTTTTAACCAAAGAACTGGAAACTCAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTGTAGTAATTTTACTTTGTTTTACTTTTTCAAAATTGGTTTCTTGACCTTTGAGTC // / / / // // |MslI TspDTI | BstXI |TsoI |DdeI |MseI TspDTI BsrI Hpy188I BbvII* MseI MboII E D I I K M K Q N E K V L T K E L E T Q K T S L K * N K M K K F * P K N W K L R R H H * N E T K * K S F N Q R T G N S D ----:----|----:----|----:----|----:----|----:----|----:----| S S M M L I F C F S F T K V L S S S V * P L C * * F S V F H F L K L W L V P F E F V D N F H F L I F F N * G F F Q F S L AluI BspCNI CviJI |BseMII TspEI | SetI BslFI \\ \ \ \ \ ACCAAAATCAATAAACTAAAGGAAAATAATTGGGACAGCTACATCAATGACTTGGAAAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTTTAGTTATTTGATTTCCTTTTATTAACCCTGTCGATGTAGTTACTGAACCTTTTT // / / / / |BseMII | | CviJI BslFI BspCNI | | AluI | SetI TspEI T K I N K L K E N N W D S Y I N D L E K P K S I N * R K I I G T A T S M T W K N Q N Q * T K G K * L G Q L H Q * L G K T ----:----|----:----|----:----|----:----|----:----|----:----| V L I L L S F S F L Q S L * M L S K S F S W F * Y V L P F Y N P C S C * H S P F G F D I F * L F I I P V A V D I V Q F F TaqI Hpy188I MaeII ClaI | ApoI |BsaAI | Hin4II* | TspEI || SetI SetI | | MnlI | EcoRI || TaiI \ \ \ \ \ \ \\ \ CAAATCAATGACCTTCAAATCGATAAATCAGAGGAATTCCACGTAATACAAAATCAGTTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAGTTACTGGAAGTTTAGCTATTTAGTCTCCTTAAGGTGCATTATGTTTTAGTCAAT / /// / / / // SetI ||MnlI Hpy188I | | |MaeII |ClaI | | BsaAI |TaqI | TaiI Hin4II* | SetI EcoRI TspEI ApoI Q I N D L Q I D K S E E F H V I Q N Q L K S M T F K S I N Q R N S T * Y K I S * N Q * P S N R * I R G I P R N T K S V R ----:----|----:----|----:----|----:----|----:----|----:----| C I L S R * I S L D S S N W T I C F * N V F * H G E F R Y I L P I G R L V F D T L D I V K L D I F * L F E V Y Y L I L * TspEI TspEI TspEI | MseI MseI \ \ \ \ \ GACAAATTAGACTTGGAGAATTACCAATTAAAAAATCAGTTAAATACTTTGGACAACCAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTTAATCTGAACCTCTTAATGGTTAATTTTTTAGTCAATTTATGAAACCTGTTGGTT / / // / TspEI TspEI |MseI MseI TspEI D K L D L E N Y Q L K N Q L N T L D N Q T N * T W R I T N * K I S * I L W T T K Q I R L G E L P I K K S V K Y F G Q P K ----:----|----:----|----:----|----:----|----:----|----:----| S L N S K S F * W N F F * N F V K S L W L C I L S P S N G I L F D T L Y K P C G V F * V Q L I V L * F I L * I S Q V V L TspDTI | ApoI | TspEI Hpy188I MseI TspEI | | MseI | SetI \ \ \ \ \ \ \ AAGTTAATACTATCCCAATATGAAAGCAATTTTATCAAATTTAATCAGAACCTTTTACTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAATTATGATAGGGTTATACTTTCGTTAAAATAGTTTAAATTAGTCTTGGAAAATGAT / / / / / / / MseI | TspDTI | | | SetI TspEI | | Hpy188I | MseI TspEI ApoI K L I L S Q Y E S N F I K F N Q N L L L S * Y Y P N M K A I L S N L I R T F Y Y V N T I P I * K Q F Y Q I * S E P F T T ----:----|----:----|----:----|----:----|----:----|----:----| F N I S D W Y S L L K I L N L * F R K S F T L V I G I H F C N * * I * D S G K V L * Y * G L I F A I K D F K I L V K * * SspI | SfeI* | | CviRI* SetI Tsp4CI* | | | PstI TspEI \ \ \ \ \ \ \ CACCTTGACAGTATTTTCAATATTCTGCAGAAAATCTTACAAGAAAGTTCTATTGCCCAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGAACTGTCATAAAAGTTATAAGACGTCTTTTAGAATGTTCTTTCAAGATAACGGGTT / / / / / / SetI Tsp4CI* | | | SfeI* | | CviRI* | PstI SspI H L D S I F N I L Q K I L Q E S S I A Q T L T V F S I F C R K S Y K K V L L P N P * Q Y F Q Y S A E N L T R K F Y C P I ----:----|----:----|----:----|----:----|----:----|----:----| C R S L I K L I R C F I K C S L E I A W V G Q C Y K * Y E A S F R V L F N * Q G V K V T N E I N Q L F D * L F T R N G L TspDTI | Csp6I ApoI TfiI | |RsaI TspEI HinfI \ \\ \ \ TTTGACAGGAAAATGAAATCCATAAAATCTGTACCAAATGCGTTGAAAAACTTGAATTTG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTGTCCTTTTACTTTAGGTATTTTAGACATGGTTTACGCAACTTTTTGAACTTAAAC / / // / TspEI | |Csp6I TspEI | RsaI ApoI TspDTI F D R K M K S I K S V P N A L K N L N L L T G K * N P * N L Y Q M R * K T * I * * Q E N E I H K I C T K C V E K L E F D ----:----|----:----|----:----|----:----|----:----|----:----| N S L F I F D M F D T G F A N F F K F K I Q C S F S I W L I Q V L H T S F S S N K V P F H F G Y F R Y W I R Q F V Q I Q MaeI | TfiI CviRI* PleI CviJI | HinfI BsmAI | HinfI |MlyI \ \ \ \ \ \ \\ ATTCAGCCCAAACTAGAATCGCTCTACACTTTTATAGAGACTGCATTAGAGTCCATAATA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTCGGGTTTGATCTTAGCGAGATGTGAAAATATCTCTGACGTAATCTCAGGTATTAT / / / / / / / / | CviJI | HinfI BsmAI CviRI* HinfI PleI HinfI | TfiI MlyI TfiI MaeI I Q P K L E S L Y T F I E T A L E S I I F S P N * N R S T L L * R L H * S P * * S A Q T R I A L H F Y R D C I R V H N K ----:----|----:----|----:----|----:----|----:----|----:----| I * G L S S D S * V K I S V A N S D M I S E A W V L I A R C K * L S Q M L T W L N L G F * F R E V S K Y L S C * L G Y Y Ksp632I* | TspRI | | FatI | | NcoI | | StyI | | SecI* TseI | | DsaI* |BisI | | |CviAII ||BlsI MboII | | || NlaIII |||CviJI BbvI BsaXI \ \ \ \\ \ \\\\ \ \ AACTCATATATCTCTTCACTGATTTCCATGGAAACCCCAGAGCAGCCACATCAACAGGGC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGTATATAGAGAAGTGACTAAAGGTACCTTTGGGGTCTCGTCGGTGTAGTTGTCCCG / / / / // /// // MboII TspRI | | |DsaI* ||CviJI |BbvI | | |SecI* ||TseI BsaXI | | |StyI |BisI | | |NcoI BlsI | | |FatI | | CviAII | NlaIII Ksp632I* N S Y I S S L I S M E T P E Q P H Q Q G T H I S L H * F P W K P Q S S H I N R A L I Y L F T D F H G N P R A A T S T G Q ----:----|----:----|----:----|----:----|----:----|----:----| F E Y I E E S I E M S V G S C G C * C P L S M Y R K V S K W P F G L A A V D V P V * I D R * Q N G H F G W L L W M L L A TspEI MaeIII | BsrDI TspDTI BceAI SetI | PsrI | |MseI | PsrI | BsaXI | MnlI | | BccI \ \\ \ \ \ \ \ \ \ \ \ AATGAATTAACGGCAACTCCAAATAAAGAACTGACCTTACGAATAGAGGAGTTACAAAGA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTAATTGCCGTTGAGGTTTATTTCTTGACTGGAATGCTTATCTCCTCAATGTTTCT / // / // / / / / / / | |MseI TspDTI || SetI MnlI PsrI | | BseRI | TspEI PsrI |BceAI | BccI BsrDI BsaXI MaeIII N E L T A T P N K E L T L R I E E L Q R M N * R Q L Q I K N * P Y E * R S Y K E * I N G N S K * R T D L T N R G V T K K ----:----|----:----|----:----|----:----|----:----|----:----| L S N V A V G F L S S V K R I S S N C L C H I L P L E L Y L V S R V F L P T V F I F * R C S W I F F Q G * S Y L L * L S Hin4I | Hpy188I SfaNI | |MwoI BseRI | Eco57I | || AluI | BsaBI | Eco57MI | || CviJI | | EcoRV | |AluI | || | TaqI | | | MboII | |CviJI | || | SetI | | | |Hpy188I | || TaqI | || | | TfiI | | | || Hin4I | || SetI TspGWI | || | | HinfI \ \ \ \\ \ \ \\ \ \ \ \\ \ \ \ AGATGGATATCCGAAAGAGAAAGACGGAAGCTCGATGCTAACGCTTCAGAAGCTCGAATC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TCTACCTATAGGCTTTCTCTTTCTGCCTTCGAGCTACGATTGCGAAGTCTTCGAGCTTAG / //// // / / / / // / / / / | |||Hpy188I || | | | | || | | | HinfI | ||MboII || | | | | || | | | TfiI | |Hin4I || | | | | || | | TaqI | EcoRV || | | | | || | CviJI BsaBI || | | | | || | AluI || | | | | || SetI || | | | | |Hpy188I || | | | | MwoI || | | | Hin4I || | | TspGWI || | TaqI || CviJI || AluI |SfaNI |SetI Eco57MI Eco57I R W I S E R E R R K L D A N A S E A R I D G Y P K E K D G S S M L T L Q K L E S M D I R K R K T E A R C * R F R S S N Q ----:----|----:----|----:----|----:----|----:----|----:----| L H I D S L S L R F S S A L A E S A R I F I S I R F L F V S A R H * R K L L E F S P Y G F S F S P L E I S V S * F S S D PleI |MboI |MlyI || DpnI || |TaqI || |BstKTI CviJI HinfI || || XmnI SetI \ \ \\ \\ \ \ AAGGCTTTAGAACAGGAAAATGAGTCATTGAGATCGAAACTTTTCAACCTATCAATCAAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGAAATCTTGTCCTTTTACTCAGTAACTCTAGCTTTGAAAAGTTGGATAGTTAGTTG / / /// // / / CviJI HinfI ||| || XmnI SetI ||| |TaqI ||| MboI ||DpnI |BstKTI PleI MlyI K A L E Q E N E S L R S K L F N L S I N R L * N R K M S H * D R N F S T Y Q S T G F R T G K * V I E I E T F Q P I N Q Q ----:----|----:----|----:----|----:----|----:----|----:----| L A K S C S F S D N L D F S K L R D I L * P K L V P F H T M S I S V K * G I L * L S * F L F I L * Q S R F K E V * * D V AATCCCTAA ----:---- TTAGGGATT N P * I P X S L X ----:---- L G * C D R I G L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AhaIII* 1 DraI AluI 5 AluBI ApoI 13 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 9 BceAI 3 BciVI 2 BfuI BclI 1 FbaI,Ksp22I BdaI 6 BfiI 1 BmrI,BmuI BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 BplI 4 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 3 BseRI 2 BseYI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 3 BspHI 1 CciI,PagI,RcaI BsrBI 1 AccBSI,MbiI BsrDI 3 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 7 BstXI 1 BtgZI 1 Cac8I 2 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 5 CviQI,RsaNI CviAII 3 CviJI 11 CviKI-1 CviRI* 6 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 7 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 3 EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 3 FokI 2 GsaI 1 GsuI 1 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 5 Hin4II* 5 HpyAV HindII 1 HincII HinfI 16 HphI 4 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 8 Hpy99I 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 2 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 MlyI 5 SchI MmeI 1 MnlI 8 MseI 9 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 3 Hin1II,Hsp92II,FaeI PleI 5 PpsI PsiI 1 AanI PsrI 1 PstI 1 RsaI 5 AfaI SacI 1 Psp124BI,SstI ScaI 2 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 15 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 13 TatI 2 TfiI 11 PfeI TseI 1 ApeKI TsoI 1 Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 30 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 4 TscAI TstI 2 XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BcgI BetI* BglI BglII BmeT110I BmtI Bpu10I BsePI BseSI BsgI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI BtsI CauII* Cfr10I Cfr9I CfrI CspCI DinI DraII DraIII Eam1105I EciI Eco47III EcoNI EcoT22I EgeI EheI Esp3I FauI FnuDII* FseI FspAI GlaI HaeII HgiCI* HhaI Hin6I HindIII HinP1I HpaI HpaII HspAI KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PvuI PvuII RsrII SacII SalI SanDI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI Tsp45I TspMI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769