Restriction Map of CDC24/YAL041W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CDC24/YAL041W on chromosome I from coordinates 62840 to 65404.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.11442

SecI* |AvaI ||BmeT110I MboI ||| SduI AjuI | DpnI ||| BseSI FalI | |BstKTI ||| | MnlI Hpy188I FalI \ \\ \\\ \ \ \ \ ATGGCGATCCAAACCCGTTTTGCCTCGGGCACATCTTTATCCGATTTGAAACCAAAACCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGCTAGGTTTGGGCAAAACGGAGCCCGTGTAGAAATAGGCTAAACTTTGGTTTTGGT // / // / / / || MboI || MnlI | FalI |DpnI |AvaI | FalI BstKTI BmeT110I | AjuI SecI* Hpy188I BseSI SduI M A I Q T R F A S G T S L S D L K P K P W R S K P V L P R A H L Y P I * N Q N Q G D P N P F C L G H I F I R F E T K T K ----:----|----:----|----:----|----:----|----:----|----:----| X A I W V R K A E P V D K D S K F G F G X P S G F G N Q R P C M K I R N S V L V H R D L G T K G R A C R * G I Q F W F W FatI BspHI |CviAII BccI |Hpy178III* | MslI || NlaIII | |FatI || | CviJI | |AjuI || | | MaeIII | |FalI || | | Tsp45I | |FalI || | | | AloI | ||CviAII || | | | TspDTI | ||| CviRI* || | | | | MlyI CviRI* | ||| NlaIII || | | | | PleI \ \ \\\ \ \\ \ \ \ \ \ AGTGCAACTTCCATCTCCATACCCATGCAAAATGTCATGAACAAGCCTGTCACGGAACAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCACGTTGAAGGTAGAGGTATGGGTACGTTTTACAGTACTTGTTCGGACAGTGCCTTGTC / / / // // / // / / / / // CviRI* | | || |CviRI* | |BspHI | | | | |PleI | | || |FatI | |FatI | | | | MlyI | | || CviAII | | | | | Tsp45I | | |NlaIII | | | | | MaeIII | | MslI | | | | TspDTI | BccI | | | AloI FalI | | CviJI FalI | Hpy178III* AjuI | CviAII NlaIII S A T S I S I P M Q N V M N K P V T E Q V Q L P S P Y P C K M S * T S L S R N R C N F H L H T H A K C H E Q A C H G T G ----:----|----:----|----:----|----:----|----:----|----:----| L A V E M E M G M C F T M F L G T V S C L H L K W R W V W A F H * S C A Q * P V T C S G D G Y G H L I D H V L R D R F L Hin6I |GlaI |MstI* ||HhaI ||| AloI ||| | BseGI ||| | | BetI* TspGWI ||| | | BspMII* |Tsp4CI* ||| | | |HpaII BsrI || TspRI ||| | | |Hpy178III* | SetI HinfI || | FokI ||| | | || MnlI | MaeIII SetI \ \\ \ \ \\\ \ \ \\ \ \ \ \ GACTCACTGTTCCATATATGCGCAAACATCCGGAAAAGACTGGAGGTGTTACCTCAACTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGTGACAAGGTATATACGCGTTTGTAGGCCTTTTCTGACCTCCACAATGGAGTTGAG / // / / //// / // / // / / / | || Tsp4CI* | |||| BseGI || MnlI |SetI | MaeIII Eco57MI | |TspGWI | |||Hin6I |BspMII* BsrI SetI GsuI | HinfI | ||MstI* |BetI* TspRI | ||GlaI Hpy178III* | |HhaI HpaII | AloI FokI D S L F H I C A N I R K R L E V L P Q L T H C S I Y A Q T S G K D W R C Y L N S L T V P Y M R K H P E K T G G V T S T Q ----:----|----:----|----:----|----:----|----:----|----:----| S E S N W I H A F M R F L S S T N G * S P S V T G Y I R L C G S F V P P T V E V V * Q E M Y A C V D P F S Q L H * R L E GsuI Eco57MI |MnlI MfeI CviJI MnlI || SetI TspEI HaeIII |TaqI SetI \\ \ \ \ \\ \ AAACCTTTTTTACAATTGGCCTACCAATCGAGCGAGGTTTTGAGTGAAAGGCAATCTCTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGAAAAAATGTTAACCGGATGGTTAGCTCGCTCCAAAACTCACTTTCCGTTAGAGAA // / / / / / |SetI | HaeIII | | SetI MnlI | CviJI | TaqI TspEI MnlI MfeI K P F L Q L A Y Q S S E V L S E R Q S L N L F Y N W P T N R A R F * V K G N L F T F F T I G L P I E R G F E * K A I S F ----:----|----:----|----:----|----:----|----:----|----:----| L G K K C N A * W D L S T K L S L C D R * V K K V I P R G I S R P K S H F A I E F R K * L Q G V L R A L N Q T F P L R K Hin6I TseI |GlaI |BisI ||HhaI |Bce83I* |||HaeII || Hpy178III* |||| BssKI || | BbvI |||| |HpaII || | AlwNI |||| ||ScrFI || | SfaNI |||| ||CauII* ||BlsI | | SmlI |||| ||| Tsp4CI* \\\ \ \ \ \\\\ \\\ \ TTGCTATCCCAAAAGCAGCATCAGGAACTGCTCAAGTCCAATGGCGCTAACCGGGACAGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACGATAGGGTTTTCGTCGTAGTCCTTGACGAGTTCAGGTTACCGCGATTGGCCCTGTCA / /// / / / //// / / / | ||TseI | | SmlI |||Hin6I | | Tsp4CI* | |BisI | SfaNI ||GlaI | BssKI | BlsI | BbvI |HhaI CauII* Bce83I* Hpy178III* HaeII HpaII AlwNI ScrFI L L S Q K Q H Q E L L K S N G A N R D S C Y P K S S I R N C S S P M A L T G T V A I P K A A S G T A Q V Q W R * P G Q * ----:----|----:----|----:----|----:----|----:----|----:----| K S D W F C C * S S S L D L P A L R S L K A I G F A A D P V A * T W H R * G P C Q * G L L L M L F Q E L G I A S V P V T FatI |BccI |CviAII SetI ||BsmAI |MaeI AluI ||| NlaIII BslFI || AluI CviJI ||| |TaqI | HgiCI* || CviJI | SetI ||| |MslI | | NlaIV MseI || | SetI | | BsrI ||| |Hin4II* \ \ \ \ \\ \ \ \ \ \ \\\ \\ AGCGACTTGGCACCAACTTTAAGGTCTAGCTCTATCTCCACAGCTACCAGTCTCATGTCG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTGAACCGTGGTTGAAATTCCAGATCGAGATAGAGGTGTCGATGGTCAGAGTACAGC / / / /// / / / / ////// | HgiCI* MseI ||CviJI | | BsrI | |||||TaqI BslFI SetI ||AluI | CviJI | ||||BsmAI NlaIV |MaeI | AluI | |||MslI SetI SetI | ||Hin4II* | ||FatI | |CviAII | BccI NlaIII S D L A P T L R S S S I S T A T S L M S A T W H Q L * G L A L S P Q L P V S C R R L G T N F K V * L Y L H S Y Q S H V D ----:----|----:----|----:----|----:----|----:----|----:----| L S K A G V K L D L E I E V A V L R M D Y R S P V L K L T * S * R W L * W D * T A V Q C W S * P R A R D G C S G T E H R ApoI TspEI EcoRI | TaqI | AsuII | | TfiI | | HinfI | | | SecI* | | | | CfrI | | | | | CviJI | | | | | HaeIII | | | | | | MnlI | | | | | | | MnlI SetI | | | | | | | XcmI | NmeAIII | | | | | | | | BsiYI* \ \ \ \ \ \ \ \ \ \ \ ATGGAAGGTATATCATACACGAATTCGAATCCCTCGGCCACCCCAAATATGGAGGACACT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTCCATATAGTATGTGCTTAAGCTTAGGGAGCCGGTGGGGTTTATACCTCCTGTGA / / / / / // / / // SetI NmeAIII | | HinfI || | | |BsiYI* | | TfiI || | | XcmI | AsuII || | | MnlI | TaqI || | MnlI EcoRI || CfrI TspEI |HaeIII ApoI |CviJI SecI* M E G I S Y T N S N P S A T P N M E D T W K V Y H T R I R I P R P P Q I W R T L G R Y I I H E F E S L G H P K Y G G H F ----:----|----:----|----:----|----:----|----:----|----:----| I S P I D Y V F E F G E A V G F I S S V S P L Y I M C S N S D R P W G L Y P P C H F T Y * V R I R I G R G G W I H L V S MslI |FatI |NcoI |StyI |SecI* |DsaI* ||BstXI ||CviAII MaeIII ||| NlaIII Tsp45I \\\ \ \ TTACTGACTTTTAGTATGGGTATTTTGCCCATTACCATGGATTGCGACCCTGTGACACAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATGACTGAAAATCATACCCATAAAACGGGTAATGGTACCTAACGCTGGGACACTGTGTT / // // / | || |DsaI* Tsp45I | || |SecI* MaeIII | || |StyI | || |NcoI | || |FatI | || CviAII | |NlaIII | MslI BstXI L L T F S M G I L P I T M D C D P V T Q Y * L L V W V F C P L P W I A T L * H N T D F * Y G Y F A H Y H G L R P C D T T ----:----|----:----|----:----|----:----|----:----|----:----| K S V K L I P I K G M V M S Q S G T V C K V S K * Y P Y K A W * W P N R G Q S V * Q S K T H T N Q G N G H I A V R H C L AluI CviJI CviJI SetI AccI |AciI PvuII |Hin6I |BssNAI |BisI NspBII* ||GlaI |Hpy166II ||BlsI | SetI |||HhaI || MnlI |||TauI \ \ \\\\ \\ \ \\\\ CTATCACAGCTGTTTCAACAAGGTGCGCCCCTCTGTATACTTTTCAACTCTGTGAAGCCG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GATAGTGTCGACAAAGTTGTTCCACGCGGGGAGACATATGAAAAGTTGAGACACTTCGGC / / / /// /// //// | NspBII* SetI ||Hin6I ||MnlI |||AciI | PvuII |GlaI |AccI ||BisI | CviJI HhaI Hpy166II |BlsI | AluI BssNAI CviJI SetI TauI L S Q L F Q Q G A P L C I L F N S V K P Y H S C F N K V R P S V Y F S T L * S R I T A V S T R C A P L Y T F Q L C E A A ----:----|----:----|----:----|----:----|----:----|----:----| S D C S N * C P A G R Q I S K L E T F G V I V A T E V L H A G R Y V K * S Q S A * * L Q K L L T R G E T Y K E V R H L R TspEI | MseI | |SwaI | |AhaIII* | ||TspEI | ||| AgeI | ||| BetI* | ||| Cfr10I Hpy188I | ||| |HpaII | SfaNI \ \\\ \\ \ \ CAATTTAAATTACCGGTAATAGCATCTGACGATTTGAAAGTCTGTAAAAAATCCATTTAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAATTTAATGGCCATTATCGTAGACTGCTAAACTTTCAGACATTTTTTAGGTAAATA /// / // / / ||| | |Cfr10I Hpy188I SfaNI ||| | |BetI* ||| | |AgeI ||| | HpaII ||| TspEI ||MseI |AhaIII* |SwaI TspEI Q F K L P V I A S D D L K V C K K S I Y N L N Y R * * H L T I * K S V K N P F M I * I T G N S I * R F E S L * K I H L * ----:----|----:----|----:----|----:----|----:----|----:----| C N L N G T I A D S S K F T Q L F D M * A I * I V P L L M Q R N S L R Y F I W K L K F * R Y Y C R V I Q F D T F F G N I FalI FalI | TseI | CviJI AluI | |BisI CviRI* CviJI | ||BlsI | MseI FalI | SetI BbvI | |||CviRI* | |MnlI FalI | | BcgI BseRI \ \ \\\\ \ \\ \ \ \ \ \ GACTTTATATTGGGCTGCAAGAAACACTTTGCATTTAACGATGAGGAGCTTTTCACTATA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAATATAACCCGACGTTCTTTGTGAAACGTAAATTGCTACTCCTCGAAAAGTGATAT / //// / / / / / / / BbvI |||CviRI* | | FalI | | BcgI BseRI FalI |||TseI | | FalI | CviJI FalI ||BisI | | MseI | AluI |BlsI | MnlI SetI CviJI CviRI* D F I L G C K K H F A F N D E E L F T I T L Y W A A R N T L H L T M R S F S L Y L Y I G L Q E T L C I * R * G A F H Y I ----:----|----:----|----:----|----:----|----:----|----:----| S K I N P Q L F C K A N L S S S S K V I H S * I P S C S V S Q M * R H P A K * * V K Y Q A A L F V K C K V I L L K E S Y BcgI MmeI BseYI | AluI Hpy188I | GsaI | MaeII | CviJI | | Hpy99I | PvuII | | |SetI | NspBII* | | |TaiI | | SetI MaeI \ \ \\ \ \ \ \ TCCGACGTTTTTGCCAACTCTACTTCCCAGCTGGTCAAAGTGCTAGAAGTAGTAGAAACG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCTGCAAAAACGGTTGAGATGAAGGGTCGACCAGTTTCACGATCTTCATCATCTTTGC / / / / / / / / | | MaeII | | | NspBII* MaeI | TaiI | | | BseYI | SetI | | | PvuII Hpy188I | | | CviJI Hpy99I | | | AluI | | SetI | GsaI MmeI BcgI S D V F A N S T S Q L V K V L E V V E T P T F L P T L L P S W S K C * K * * K R R R F C Q L Y F P A G Q S A R S S R N A ----:----|----:----|----:----|----:----|----:----|----:----| D S T K A L E V E W S T L T S S T T S V I R R K Q W S * K G A P * L A L L L L F G V N K G V R S G L Q D F H * F Y Y F R FatI BspHI ApoI |CviAII TspEI CviJI |Hpy178III* EcoRI | TspDTI DdeI MnlI || NlaIII \ \ \ \ \ \\ \ CTAATGAATTCCAGCCCTACTATTTTCCCCTCTAAGAGTAAGACACAGCAAATCATGAAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GATTACTTAAGGTCGGGATGATAAAAGGGGAGATTCTCATTCTGTGTCGTTTAGTACTTG / / / / / / // | | TspDTI | MnlI | |BspHI | CviJI DdeI | |FatI EcoRI | Hpy178III* TspEI | CviAII ApoI NlaIII L M N S S P T I F P S K S K T Q Q I M N * * I P A L L F S P L R V R H S K S * T N E F Q P Y Y F P L * E * D T A N H E R ----:----|----:----|----:----|----:----|----:----|----:----| S I F E L G V I K G E L L L V C C I M F A L S N W G * * K G R * S Y S V A F * S * H I G A R S N E G R L T L C L L D H V CviJI | DdeI MnlI | MboII | TaqI | BbvCI | AsuII | BbvII* | | BspCNI EcoP15I TspDTI | Bpu10I | | |BseMII MboII |MseI \ \ \ \ \ \\ \ \\ GCAGAAAACCAACACCGACATCAGCCTCAGCAGTCTTCGAAGAAGCATAACGAGTATGTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTTTTGGTTGTGGCTGTAGTCGGAGTCGTCAGAAGCTTCTTCGTATTGCTCATACAA / // // / /// / / TspDTI || || | ||AsuII MboII EcoP15I || || | ||TaqI || || | |BseMII || || | BspCNI || || MnlI || |BbvII* || Bpu10I || BbvCI || DdeI |MboII CviJI A E N Q H R H Q P Q Q S S K K H N E Y V Q K T N T D I S L S S L R R S I T S M L R K P T P T S A S A V F E E A * R V C * ----:----|----:----|----:----|----:----|----:----|----:----| A S F W C R C * G * C D E F F C L S Y T R L F G V G V D A E A T K S S A Y R T H C F V L V S M L R L L R R L L M V L I N TspGWI | Hpy166II ApoI | |Hpy178III* TspEI | || ApoI TspEI EcoRI CviRI* | || TspEI \ \ \ \ \\ \ AAAATTATCAAGGAATTCGTTGCAACGGAAAGAAAATATGTTCACGATTTGGAAATTTTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAATAGTTCCTTAAGCAACGTTGCCTTTCTTTTATACAAGTGCTAAACCTTTAAAAC / / / / / / / / MseI TspEI | CviRI* | | Hpy178III* TspEI EcoRI | Hpy166II ApoI TspEI TspGWI ApoI K I I K E F V A T E R K Y V H D L E I L K L S R N S L Q R K E N M F T I W K F W N Y Q G I R C N G K K I C S R F G N F G ----:----|----:----|----:----|----:----|----:----|----:----| L I I L S N T A V S L F Y T * S K S I K * F * * P I R Q L P F F I H E R N P F K F N D L F E N C R F S F I N V I Q F N Q TatI Bsp1407I |Csp6I ||RsaI MaeII |||FatI |Ksp632I* |||AflIII || SetI |||BspLU11I* || TaiI ||||CviAII || EcoP15I |||||MboII || | Hpy188I |||||| NspI || | |PsrI |||||| NlaIII \\ \ \\ \\\\\\ \ GATAAATATAGACAGCAGTTATTAGACAGCAATCTAATAACGTCTGAAGAGTTGTACATG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTATATCTGTCGTCAATAATCTGTCGTTAGATTATTGCAGACTTCTCAACATGTAC / // // /// // | || |EcoP15I ||| |BspLU11I* | || Ksp632I* ||| |AflIII | || Hpy188I ||| |FatI | |MaeII ||| CviAII | PsrI ||Bsp1407I TaiI ||MboII SetI ||TatI |NlaIII |Csp6I |NspI RsaI D K Y R Q Q L L D S N L I T S E E L Y M I N I D S S Y * T A I * * R L K S C T C * I * T A V I R Q Q S N N V * R V V H V ----:----|----:----|----:----|----:----|----:----|----:----| S L Y L C C N N S L L R I V D S S N Y M P Y I Y V A T I L C C D L L T Q L T T C I F I S L L * * V A I * Y R R F L Q V H TaqII |Eco57I |Eco57MI || SfaNI || TspEI || | BsiYI* MboII || | |BsiYI* SfeI* | StyI || | || PsrI | HphI | SecI* \\ \ \\ \ \ \ \ \ TTGTTCCCTAATTTGGGTGATGCTATAGATTTTCAAAGAAGATTTCTAATATCCTTGGAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AACAAGGGATTAAACCCACTACGATATCTAAAAGTTTCTTCTAAAGATTATAGGAACCTT // // / / / / || || TspEI SfeI* MboII SecI* || || SfaNI HphI StyI || || PsrI || |BsiYI* || BsiYI* |Eco57MI |Eco57I TaqII L F P N L G D A I D F Q R R F L I S L E C S L I W V M L * I F K E D F * Y P W K V P * F G * C Y R F S K K I S N I L G N ----:----|----:----|----:----|----:----|----:----|----:----| N N G L K P S A I S K * L L N R I D K S T T G * N P H H * L N E F F I E L I R P Q E R I Q T I S Y I K L S S K * Y G Q F Hin4II* | TfiI | HinfI | | TspDTI | | | CviJI | | | | SduI | | | | HgiJII* | | | | | FatI | | | | | |CviAII | | | | | || BsmI | | | | | || CviRI* | | | | | || NlaIII SetI | | | | | || | EcoT22I \ \ \ \ \ \ \\ \ \ ATAAATGCTTTAGTAGAACCTTCCAAGCAAAGAATCGGGGCTCTTTTCATGCATTCCAAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTACGAAATCATCTTGGAAGGTTCGTTTCTTAGCCCCGAGAAAAGTACGTAAGGTTT / / // / / / /// SetI | || | CviJI | ||CviRI* | || HgiJII* | ||FatI | || SduI | |CviAII | |HinfI | EcoT22I | |TfiI | BsmI | TspDTI NlaIII Hin4II* I N A L V E P S K Q R I G A L F M H S K * M L * * N L P S K E S G L F S C I P N K C F S R T F Q A K N R G S F H A F Q T ----:----|----:----|----:----|----:----|----:----|----:----| I F A K T S G E L C L I P A R K M C E L F L H K L L V K W A F F R P E K * A N W Y I S * Y F R G L L S D P S K E H M G F Hin4I |TseI |CviRI* ||BisI |||BlsI ||||CviJI ||||| TaqI ||||| | ApoI CfrI ||||| | TspEI CviJI | BalI ||||| | |MboII MseI |StyI | CviJI ||||| | || BccI | Hin4I |SecI* | HaeIII ||||| | || BbvI \ \ \\ \ \ \\\\\ \ \\ \ CATTTTTTTAAGTTGTATGAGCCTTGGTCTATTGGCCAAAATGCAGCCATCGAATTTCTC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAAAAAATTCAACATACTCGGAACCAGATAACCGGTTTTACGTCGGTAGCTTAAAGAG / / / / / / //// / / / | MseI | SecI* | Hin4I |||CviJI | | BbvI Hin4I | StyI | CfrI |||TseI | TspEI CviJI HaeIII ||BisI | BccI CviJI |BlsI | ApoI BalI CviRI* MboII TaqI H F F K L Y E P W S I G Q N A A I E F L I F L S C M S L G L L A K M Q P S N F S F F * V V * A L V Y W P K C S H R I S L ----:----|----:----|----:----|----:----|----:----|----:----| C K K L N Y S G Q D I P W F A A M S N R V N K * T T H A K T * Q G F H L W R I E M K K L Q I L R P R N A L I C G D F K E TfiI HinfI | TspDTI | | TseI | | |BisI | | ||BlsI | | |||AciI | | |||NspBII* | | |||| TspDTI Ksp632I* | | |||| | TspEI | CviRI* | | |||| | |BbvI | | MnlI | | |||| | || MseI \ \ \ \ \ \\\\ \ \\ \ TCTTCAACTTTGCACAAGATGAGGGTTGATGAATCGCAGCGGTTCATAATTAACAATAAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTTGAAACGTGTTCTACTCCCAACTACTTAGCGTCGCCAAGTATTAATTGTTATTT / // / / /// // // | |MnlI | | ||| |TspDTI |BbvI | CviRI* | | ||| AciI |MseI Ksp632I* | | ||NspBII* TspEI | | ||TseI | | |BisI | | BlsI | HinfI | TfiI TspDTI S S T L H K M R V D E S Q R F I I N N K L Q L C T R * G L M N R S G S * L T I N F N F A Q D E G * * I A A V H N * Q * T ----:----|----:----|----:----|----:----|----:----|----:----| E E V K C L I L T S S D C R N M I L L L R K L K A C S S P Q H I A A T * L * C Y R * S Q V L H P N I F R L P E Y N V I F TspEI CviRI* |BsrI PsiI | BsiYI* FalI || CviRI* |Hin4II* | | CviJI EcoRV FalI \\ \ \\ \ \ \ \ \ CTGGAATTGCAATCCTTCCTTTATAAACCCGTGCAAAGGCTTTGTAGATATCCCCTGTTG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GACCTTAACGTTAGGAAGGAAATATTTGGGCACGTTTCCGAAACATCTATAGGGGACAAC / // / // / / / BsrI |CviRI* Hin4II* || CviJI | FalI TspEI PsiI |CviRI* | FalI BsiYI* EcoRV L E L Q S F L Y K P V Q R L C R Y P L L W N C N P S F I N P C K G F V D I P C W G I A I L P L * T R A K A L * I S P V G ----:----|----:----|----:----|----:----|----:----|----:----| S S N C D K R * L G T C L S Q L Y G R N V P I A I R G K Y V R A F A K Y I D G T Q F Q L G E K I F G H L P K T S I G Q Q Cac8I | TfiI | HinfI TseI | | TaqI AluI | | | MaeIII CviJI | | | Tsp45I |BisI | | | | FalI ||BlsI TspEI | | | | FalI BbvI ||SetI \ \ \ \ \ \ \ \\\ GTCAAAGAATTGCTTGCTGAATCGAGTGACGATAATAATACGAAAGAACTTGAAGCTGCT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTTCTTAACGAACGACTTAGCTCACTGCTATTATTATGCTTTCTTGAACTTCGACGA / / /// / / / //// | Cac8I ||TaqI Tsp45I BbvI | |||TseI TspEI |FalI MaeIII | ||BisI |FalI | |BlsI HinfI | CviJI TfiI | AluI SetI V K E L L A E S S D D N N T K E L E A A S K N C L L N R V T I I I R K N L K L L Q R I A C * I E * R * * Y E R T * S C F ----:----|----:----|----:----|----:----|----:----|----:----| T L S N S A S D L S S L L V F S S S A A P * L I A Q Q I S H R Y Y Y S L V Q L Q D F F Q K S F R T V I I I R F F K F S S SspI MboII \ \ TTAGATATTTCTAAAAATATTGCGAGAAGTATCAACGAAAATCAAAGAAGAACAGAAAAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTATAAAGATTTTTATAACGCTCTTCATAGTTGCTTTTAGTTTCTTCTTGTCTTTTA / / SspI MboII L D I S K N I A R S I N E N Q R R T E N * I F L K I L R E V S T K I K E E Q K I R Y F * K Y C E K Y Q R K S K K N R K S ----:----|----:----|----:----|----:----|----:----|----:----| K S I E L F I A L L I L S F * L L V S F K L Y K * F Y Q S F Y * R F D F F F L F * I N R F I N R S T D V F I L S S C F I HindII Hin4II* HphI Hpy166II ApoI | MboII | BsrI TspEI \ \ \ \ \ CATCAAGTGGTGAAGAAACTTTATGGTAGAGTGGTCAACTGGAAGGGTTATAGAATTTCC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGTTCACCACTTCTTTGAAATACCATCTCACCAGTTGACCTTCCCAATATCTTAAAGG / / // / / | MboII || BsrI TspEI HphI |Hpy166II ApoI |HindII Hin4II* H Q V V K K L Y G R V V N W K G Y R I S I K W * R N F M V E W S T G R V I E F P S S G E E T L W * S G Q L E G L * N F Q ----:----|----:----|----:----|----:----|----:----|----:----| * * T T F F S * P L T T L Q F P * L I E D D L P S S V K H Y L P * S S P N Y F K M L H H L F K I T S H D V P L T I S N G AluI CviJI HphI | SetI | TaqI | |SecI* | |TspDTI BseRI | || Hpy188I \ \\ \ \ \\ \ AAGTTCGGTGAGTTATTATATTTCGATAAAGTGTTCATTTCAACAACAAATAGCTCCTCG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAGCCACTCAATAATATAAAGCTATTTCACAAGTAAAGTTGTTGTTTATCGAGGAGC / / / / / / // | | TaqI BseRI | CviJI |SecI* | TspDTI | AluI Hpy188I HphI SetI K F G E L L Y F D K V F I S T T N S S S S S V S Y Y I S I K C S F Q Q Q I A P R V R * V I I F R * S V H F N N K * L L G ----:----|----:----|----:----|----:----|----:----|----:----| L N P S N N Y K S L T N M E V V F L E E W T R H T I I N R Y L T * K L L L Y S R L E T L * * I E I F H E N * C C I A G R NlaIV MnlI | SetI |ApoI | MnlI |TspEI SetI FokI BseGI MnlI Hpy188I \ \ \\ \ \ \ \ \ GAACCTGAAAGAGAATTTGAGGTTTATCTTTTTGAAAAAATCATCATCCTTTTTTCAGAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGACTTTCTCTTAAACTCCAAATAGAAAAACTTTTTTAGTAGTAGGAAAAAAGTCTC / / / / / / / / / / | MnlI MnlI | SetI FokI BseGI MnlI | SetI NlaIV TspEI Hpy188I SetI ApoI E P E R E F E V Y L F E K I I I L F S E N L K E N L R F I F L K K S S S F F Q R T * K R I * G L S F * K N H H P F F R G ----:----|----:----|----:----|----:----|----:----|----:----| S G S L S N S T * R K S F I M M R K E S P V Q F L I Q P K D K Q F F * * G K K L F R F S F K L N I K K F F D D D K K * L MboII | DdeI | BbvCI SetI | Bpu10I |MaeIII SmlI | |SetI |Tsp45I AflII | || EciI || DdeI CviRI* SfaNI |MseI | || MnlI \\ \ \ \ \\ \ \\ \ GTAGTGACTAAGAAATCTGCATCATCACTAATCCTTAAGAAGAAATCCTCAACCTCAGCA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CATCACTGATTCTTTAGACGTAGTAGTGATTAGGAATTCTTCTTTAGGAGTTGGAGTCGT / / / / // // /// | DdeI CviRI* | |AflII || ||Bpu10I Tsp45I | |SmlI || ||BbvCI MaeIII | MseI || ||DdeI SfaNI || |MnlI || EciI |SetI MboII V V T K K S A S S L I L K K K S S T S A * * L R N L H H H * S L R R N P Q P Q H S D * E I C I I T N P * E E I L N L S I ----:----|----:----|----:----|----:----|----:----|----:----| T T V L F D A D D S I R L F F D E V E A P L S * S I Q M M V L G * S S I R L R L Y H S L F R C * * * D K L L F G * G * C MnlI HphI | SfaNI |TseI BbvI | BspCNI ||BisI | MaeIII | |AciI |||BlsI | Tsp4CI* | |BseMII |||TspGWI | |MnlI | || TaqI MnlI ||||CviJI | || MnlI \ \\ \ \ \\\\\ \ \\ \ TCAATCTCCGCCTCGAACATAACGGACAACAATGGCAGCCCTCACCACAGTTACCATAAG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTAGAGGCGGAGCTTGTATTGCCTGTTGTTACCGTCGGGAGTGGTGTCAATGGTATTC / // // / / / //// // // / | || || TaqI MnlI | |||CviJI || || MaeIII | || |SfaNI | |||TseI || |MnlI | || AciI | ||BisI || BbvI | |BseMII | |BlsI |MnlI | BspCNI | TspGWI Tsp4CI* MnlI HphI S I S A S N I T D N N G S P H H S Y H K Q S P P R T * R T T M A A L T T V T I R N L R L E H N G Q Q W Q P S P Q L P * E ----:----|----:----|----:----|----:----|----:----|----:----| D I E A E F M V S L L P L G * W L * W L M L R R R S C L P C C H C G E G C N G Y * D G G R V Y R V V I A A R V V T V M L TseI |BisI ||BlsI MboII |||AciI Eco57I |||NspBII* Eco57MI ||||BisI | MboII |||||BlsI | BbvII* ||||||TauI \ \ \\\\\\\ AGGCATAGCAATAGTAGTAGCAGTAATAATATCCATTTATCTTCGTCTTCAGCAGCGGCG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGTATCGTTATCATCATCGTCATTATTATAGGTAAATAGAAGCAGAAGTCGTCGCCGC // / / ///// |MboII | BbvII* ||||BisI | MboII ||||AciI Eco57MI |||BlsI Eco57I ||NspBII* ||TseI ||TauI |BisI BlsI R H S N S S S S N N I H L S S S S A A A G I A I V V A V I I S I Y L R L Q Q R R A * Q * * * Q * * Y P F I F V F S S G D ----:----|----:----|----:----|----:----|----:----|----:----| L C L L L L L L L L I W K D E D E A A A S A Y C Y Y Y C Y Y Y G N I K T K L L P P M A I T T A T I I D M * R R R * C R R TspEI BsrI EcoP15I | TspDTI | Csp6I | MaeIII | | FokI BbvI | |RsaI | Tsp45I | | | TspEI BseGI \ \ \\ \ \ \ \ \ \ \ ATAATACATTCCAGTACCAATAGTAGTGACAACAATTCCAACAATTCATCATCATCCTCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TATTATGTAAGGTCATGGTTATCATCACTGTTGTTAAGGTTGTTAAGTAGTAGTAGGAGT // // / / / / / / / / |BsrI |Csp6I EcoP15I | | TspEI | | BseGI MmeI BbvI RsaI | TspDTI | TspEI Tsp45I FokI MaeIII I I H S S T N S S D N N S N N S S S S S * Y I P V P I V V T T I P T I H H H P H N T F Q Y Q * * * Q Q F Q Q F I I I L I ----:----|----:----|----:----|----:----|----:----|----:----| I I C E L V L L L S L L E L L E D D D E S L V N W Y W Y Y H C C N W C N M M M R Y Y M G T G I T T V V I G V I * * * G * DdeI Bpu10I |SetI || AluI || CviJI || | SetI || | |MboI || | |XhoII || | ||MnlI || | |||DpnI || | ||||BstKTI || | |||||DdeI MmeI || | |||||| BinI* | MnlI || | |||||| | TaqI | | AluI || | |||||| | SetI | | CviJI || | |||||| | Hin4I | | | SetI || | |||||| | Hin4I BdaI TfiI | | | | AciI || | |||||| | | TspEI BdaI HinfI \ \ \ \ \ \\ \ \\\\\\ \ \ \ \ \ TTATTCAAGCTGTCCGCTAACGAACCTAAGCTGGATCTAAGAGGTCGAATTATGATAATG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AATAAGTTCGACAGGCGATTGCTTGGATTCGACCTAGATTCTCCAGCTTAATACTATTAC / / / / / /// /// / /// / // | | CviJI AciI SetI ||| ||| | ||| | |BdaI | | AluI ||| ||| | ||| | |BdaI | SetI ||| ||| | ||| | TspEI MnlI ||| ||| | ||| TaqI ||| ||| | ||BinI* ||| ||| | |SetI ||| ||| | Hin4I ||| ||| | Hin4I ||| ||| | DdeI ||| ||| XhoII ||| ||| MboI ||| ||DpnI ||| |BstKTI ||| MnlI ||CviJI ||AluI |Bpu10I |DdeI SetI L F K L S A N E P K L D L R G R I M I M Y S S C P L T N L S W I * E V E L * * * I Q A V R * R T * A G S K R S N Y D N E ----:----|----:----|----:----|----:----|----:----|----:----| N N L S D A L S G L S S R L P R I I I I M I * A T R * R V * A P D L L D F * S L * E L Q G S V F R L Q I * S T S N H Y H BdaI BdaI FatI TspDTI |AgeI |CviAII Hpy188I | Hin4I |BetI* || NlaIII |TfiI | Hin4I |Cfr10I || | TfiI |HinfI | | AciI ||HpaII MseI || | HinfI \\ \ \ \ \\\ \ \\ \ \ AATCTGAATCAAATCATACCGCAAAACAACCGGTCATTAAATATAACATGGGAATCCATA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGACTTAGTTTAGTATGGCGTTTTGTTGGCCAGTAATTTATATTGTACCCTTAGGTAT // / // / / // / / // / || | |Hin4I AciI BdaI || MseI | |FatI HinfI || | |Hin4I BdaI |Cfr10I | | TfiI || | TspDTI |BetI* | CviAII || HinfI |AgeI NlaIII || TfiI HpaII |Hpy188I HinfI TfiI N L N Q I I P Q N N R S L N I T W E S I I * I K S Y R K T T G H * I * H G N P * S E S N H T A K Q P V I K Y N M G I H K ----:----|----:----|----:----|----:----|----:----|----:----| F R F * I M G C F L R D N F I V H S D M S D S D F * V A F C G T M L Y L M P I W I Q I L D Y R L V V P * * I Y C P F G Y ApoI SetI TspEI Hin4I TspEI | MnlI Hin4I TspEI \ \ \ \ \ AAAGAGCAAGGTAATTTCCTTTTGAAATTCAAAAATGAGGAAACAAGAGATAATTGGTCA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTCGTTCCATTAAAGGAAAACTTTAAGTTTTTACTCCTTTGTTCTCTATTAACCAGT / / / / / SetI TspEI TspEI Hin4I TspEI ApoI Hin4I MnlI K E Q G N F L L K F K N E E T R D N W S K S K V I S F * N S K M R K Q E I I G H R A R * F P F E I Q K * G N K R * L V I ----:----|----:----|----:----|----:----|----:----|----:----| F S C P L K R K F N L F S S V L S L Q D L L A L Y N G K S I * F H P F L L Y N T F L L T I E K Q F E F I L F C S I I P * Hpy166II | Hin4I | Hin4I | |TspDTI | || Hin4I | || Hin4I | || | Tsp4CI* | || | | TfiI | || | | HinfI | || | | | FatI | || | | | BspHI | || | | | |CviAII | || | | | |Hpy178III* | || | | | || MboI | || | | | || |NlaIII | || | | | || ||DpnI Hin4I | || | | | || |||BstKTI Hin4I | || | | | || |||| Hpy188I | MseI MboII \ \\ \ \ \ \\ \\\\ \ \ \ \ TCGTGTTTACAACAGTTGATTCATGATCTGAAAAATGAGCAGTTTAAGGCAAGACATCAC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AGCACAAATGTTGTCAACTAAGTACTAGACTTTTTACTCGTCAAATTCCGTTCTGTAGTG / // / / /// / / / / | || Tsp4CI* | ||| Hpy188I Hin4I MseI MboII | |TspDTI | ||| MboI Hin4I | Hpy166II | ||DpnI | Hin4I | |BstKTI | Hin4I | |BspHI Hin4I | |FatI Hin4I | Hpy178III* | CviAII NlaIII HinfI TfiI S C L Q Q L I H D L K N E Q F K A R H H R V Y N S * F M I * K M S S L R Q D I T V F T T V D S * S E K * A V * G K T S L ----:----|----:----|----:----|----:----|----:----|----:----| D H K C C N I * S R F F S C N L A L C * M T N V V T S E H D S F H A T * P L V D R T * L L Q N M I Q F I L L K L C S M V Ksp632I* | TspDTI CviJI MaeIII | | TaqI Hpy99I TaqI |MboII HphI Tsp45I \ \ \ \ \ \\ \ \ TCTTCAACATCGACGACTTCATCGACAGCCAAATCATCTTCAATGATGTCACCCACCACA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTTGTAGCTGCTGAAGTAGCTGTCGGTTTAGTAGAAGTTACTACAGTGGGTGGTGT / // / / / / / | || TaqI | CviJI HphI Tsp45I | |Hpy99I | MboII MaeIII | Ksp632I* TaqI TspDTI S S T S T T S S T A K S S S M M S P T T L Q H R R L H R Q P N H L Q * C H P P Q F N I D D F I D S Q I I F N D V T H H N ----:----|----:----|----:----|----:----|----:----|----:----| E E V D V V E D V A L D D E I I D G V V S K L M S S K M S L W I M K L S T V W W R * C R R S * R C G F * R * H H * G G C CviJI |AciI TfiI |BisI HinfI ||BlsI Bce83I* MslI TaqII | TspDTI |||TauI | CviJI SmlI \ \ \ \ \\\\ \ \ \ ACTATGAATACACCGAATCATCACAACAGCCGCCAGACACACGATAGTATGGCTTCTTTC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TGATACTTATGTGGCTTAGTAGTGTTGTCGGCGGTCTGTGTGCTATCATACCGAAGAAAG / / // //// / / | TaqII |HinfI |||AciI Bce83I* CviJI MslI |TfiI ||BisI TspDTI |BlsI CviJI TauI T M N T P N H H N S R Q T H D S M A S F L * I H R I I T T A A R H T I V W L L S Y E Y T E S S Q Q P P D T R * Y G F F L ----:----|----:----|----:----|----:----|----:----|----:----| V I F V G F * * L L R W V C S L I A E K L * S Y V S D D C C G G S V R Y Y P K K S H I C R I M V V A A L C V I T H S R E Hpy188I |TspDTI || BseGI || | MnlI || | | FokI || | | | TspDTI || | | | | AsuI* || | | | | AvaII NdeI || | | | | |BmgT120I TspGWI \ \\ \ \ \ \ \\ \ TCAAGTTCTCATATGAAAAGGGTTTCGGATGTCCTGCCTAAACGGAGGACCACTTCATCA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCAAGAGTATACTTTTCCCAAAGCCTACAGGACGGATTTGCCTCCTGGTGAAGTAGT / / / / / / / // / SmlI NdeI | BseGI MnlI | FokI || TspGWI Hpy188I TspDTI |AvaII TspDTI |AsuI* BmgT120I S S S H M K R V S D V L P K R R T T S S Q V L I * K G F R M S C L N G G P L H Q K F S Y E K G F G C P A * T E D H F I K ----:----|----:----|----:----|----:----|----:----|----:----| E L E * I F L T E S T R G L R L V V E D R L N E Y S F P K P H G A * V S S W K M * T R M H F P N R I D Q R F P P G S * * MboII | Hpy178III* | | Eco57I | | Eco57MI Hpy188I | | |TfiI TaqI TspEI | ApoI | | |HinfI AsuII | MseI | TspEI Hpy178III* | | || MboII \ \ \ \ \ \ \ \ \\ \ AGTTTCGAAAGTGAAATTAAATCCATTTCAGAAAATTTCAAGAACTCTATTCCAGAATCT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAAGCTTTCACTTTAATTTAGGTAAAGTCTTTTAAAGTTCTTGAGATAAGGTCTTAGA / // / / / / / / // AsuII |MseI Hpy188I | | | | | |MboII TaqI TspEI | | | | | HinfI | | | | | TfiI | | | | Hpy178III* | | | Eco57MI | | | Eco57I | | MboII | Hpy178III* TspEI ApoI S F E S E I K S I S E N F K N S I P E S V S K V K L N P F Q K I S R T L F Q N L F R K * N * I H F R K F Q E L Y S R I F ----:----|----:----|----:----|----:----|----:----|----:----| L K S L S I L D M E S F K L F E I G S D L N R F H F * I W K L F N * S S * E L I T E F T F N F G N * F I E L V R N W F R SetI |MaeI || MboII || | MnlI || | | MboI || | | BglII Hpy178III* || | | XhoII |Ksp632I* || | | | DpnI || EcoRV || | | | |BstKTI \\ \ \\ \ \ \ \\ TCCATACTCTTCAGGATATCATATAATAACAACTCTAATAATACCTCTAGTAGCGAGATC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTATGAGAAGTCCTATAGTATATTATTGTTGAGATTATTATGGAGATCATCGCTCTAG / // / // / // / | |EcoRV SetI || | || XhoII | Ksp632I* || | || BglII Hpy178III* || | || MboI || | |DpnI || | BstKTI || MnlI |MboII MaeI S I L F R I S Y N N N S N N T S S S E I P Y S S G Y H I I T T L I I P L V A R S H T L Q D I I * * Q L * * Y L * * R D L ----:----|----:----|----:----|----:----|----:----|----:----| E M S K L I D Y L L L E L L V E L L S I K W V R * S I M Y Y C S * Y Y R * Y R S G Y E E P Y * I I V V R I I G R T A L D MboI | DpnI ApoI | |BstKTI TspEI | ||TspEI \ \ \\\ TTCACACTTTTGGTAGAAAAAGTTTGGAATTTTGACGACTTGATAATGGCGATCAATTCT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTGTGAAAACCATCTTTTTCAAACCTTAAAACTGCTGAACTATTACCGCTAGTTAAGA / // / / TspEI || | TspEI ApoI || MboI |DpnI BstKTI F T L L V E K V W N F D D L I M A I N S S H F W * K K F G I L T T * * W R S I L H T F G R K S L E F * R L D N G D Q F * ----:----|----:----|----:----|----:----|----:----|----:----| K V S K T S F T Q F K S S K I I A I L E R * V K P L F L K S N Q R S S L P S * N E C K Q Y F F N P I K V V Q Y H R D I R ApoI TspEI MboI | TaqI Hin4I | DpnI Hpy178III* | AsuII HphI HphI Hin4I | |BstKTI | BccI \ \ \ \ \ \ \\ \ \ AAAATTTCGAATACACATAATAACAACATTTCACCAATCACCAAGATCAAATATCAGGAC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAAAGCTTATGTGTATTATTGTTGTAAAGTGGTTAGTGGTTCTAGTTTATAGTCCTG / / / / / // / / / | AsuII HphI | Hin4I || MboI | BccI | TaqI | Hin4I |DpnI Hpy178III* TspEI HphI BstKTI ApoI K I S N T H N N N I S P I T K I K Y Q D K F R I H I I T T F H Q S P R S N I R T N F E Y T * * Q H F T N H Q D Q I S G R ----:----|----:----|----:----|----:----|----:----|----:----| L I E F V C L L L M E G I V L I L Y * S * F K S Y V Y Y C C K V L * W S * I D P F N R I C M I V V N * W D G L D F I L V Hin4I BtgZI Hin4I | MboII | MboII SetI | |TspDTI \ \ \ \ \\ GAAGATGGGGATTTTGTTGTGTTAGGTAGCGATGAAGATTGGAATGTTGCTAAAGAAATG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTACCCCTAAAACAACACAATCCATCGCTACTTCTAACCTTACAACGATTTCTTTAC / / / / / Hin4I MboII SetI | BtgZI Hin4I TspDTI MboII E D G D F V V L G S D E D W N V A K E M K M G I L L C * V A M K I G M L L K K C R W G F C C V R * R * R L E C C * R N V ----:----|----:----|----:----|----:----|----:----|----:----| S S P S K T T N P L S S S Q F T A L S I R L H P N Q Q T L Y R H L N S H Q * L F F I P I K N H * T A I F I P I N S F F H ApoI EciI TspEI AciI | Hpy178III* \ \ \ TTGGCGGAAAACAATGAGAAATTCTTGAACATTCGTCTGTATTGA 2530 2540 2550 2560 ----:----|----:----|----:----|----:----|----: AACCGCCTTTTGTTACTCTTTAAGAACTTGTAAGCAGACATAACT / / / / AciI EciI | Hpy178III* TspEI ApoI L A E N N E K F L N I R L Y * W R K T M R N S * T F V C I X G G K Q * E I L E H S S V L X ----:----|----:----|----:----|----:----|----: N A S F L S F N K F M R R Y Q T P P F C H S I R S C E D T N Q R F V I L F E Q V N T Q I S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 8 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AgeI 2 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 1 AloI 1 AluI 9 AluBI AlwNI 1 CaiI ApoI 12 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 4 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvCI 2 BbvI 7 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 2 BpuEI BcgI 1 BdaI 2 BetI* 3 BsaWI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 10 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 10 BmeT110I 1 BmgT120I 1 Bpu10I 3 BseGI 4 BstF5I,BtsCI BseMII 2 BseRI 2 BseSI 1 BaeGI,BstSLI BseYI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspHI 3 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 5 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 6 BstXI 1 BtgZI 1 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 2 CviQI,RsaNI CviAII 9 CviJI 25 CviKI-1 CviRI* 11 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 6 MalI DsaI* 1 BtgI,BstDSI EciI 2 Eco57I 3 AcuI Eco57MI 4 EcoP15I 3 EcoRI 3 EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 6 FatI 9 FokI 4 GlaI 3 GsaI 1 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 9 Hin4II* 4 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HinfI 11 HpaII 4 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 10 Hpy99I 2 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 8 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 17 MfeI 1 MunI MlyI 1 SchI MmeI 2 MnlI 24 MseI 10 Tru1I,Tru9I MslI 4 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 4 MspA1I NspI 1 BstNSI,XceI PleI 1 PpsI PsiI 1 AanI PsrI 1 PvuII 2 RsaI 2 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 28 SfaNI 5 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 3 SmoI SspI 1 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 2 TaqI 13 TaqII 2 TatI 1 TauI 3 TfiI 10 PfeI TseI 7 ApeKI Tsp45I 6 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 15 TspEI 27 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 1 TscAI XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AlfI ApaI ApaLI AscI Asp718I AvrII BaeI BamHI BarI BceAI BciVI BclI BfiI BglI BmtI BplI BsaAI BsaBI BsaXI BseBI BsePI BsgI BsiI* Bsp120I BspMI BspOI BsrBI BsrDI Bst2UI BstAPI BstEII BstNI BstOI BtrI BtsI Cfr9I ClaI CspCI DinI DraII DraIII DrdI Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRII EgeI EheI Esp3I EspI* FauI FnuDII* FseI FspAI HgaI HgiAI* HindIII HpaI KasI KpnI MauBI McrI* MluI MroNI MvaI MwoI NaeI NarI NgoMIV NheI NotI NruI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI TsoI TspMI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769