Restriction Map of ATS1/YAL020C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ATS1/YAL020C on chromosome I from coordinates 114615 to 113614.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.12336

EMBOSS_001 BfiI |BsrI ||MnlI ||| SduI ||| BseSI ||| | BfiI BsrI ||| | |BslFI \ \\\ \ \\ ATGAGTTGTGTGTATGCGTTTGGGTCTAATGGGCAAAGGCAACTGGGACTGGGGCACGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCAACACACATACGCAAACCCAGATTACCCGTTTCCGTTGACCCTGACCCCGTGCTA / /// / BsrI ||| BfiI ||MnlI |BseSI |SduI BfiI BsrI M S C V Y A F G S N G Q R Q L G L G H D * V V C M R L G L M G K G N W D W G T M E L C V C V W V * W A K A T G T G A R * ----:----|----:----|----:----|----:----|----:----|----:----| X L Q T Y A N P D L P C L C S P S P C S X S N H T H T Q T * H A F A V P V P A R H T T H I R K P R I P L P L Q S Q P V I BssKI EcoRII | ScrFI | BseBI | | BccI BsiYI* | | |Hin4I BciVI MnlI | SetI | | |BsaXI Hpy178III* \ \ \ \ \ \ \\ \ GAGGATATGGATACCCCACAGAGGTCTGTGCCAGGAGATGATGGAGCAATAGTCAGGAAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTATACCTATGGGGTGTCTCCAGACACGGTCCTCTACTACCTCGTTATCAGTCCTTC // / / / / // / / |BslFI | | SetI | || EcoRII Hpy178III* BciVI | BsiYI* | || BssKI MnlI | || BccI | |BseBI | |ScrFI | BsaXI Hin4I E D M D T P Q R S V P G D D G A I V R K R I W I P H R G L C Q E M M E Q * S G R G Y G Y P T E V C A R R * W S N S Q E D ----:----|----:----|----:----|----:----|----:----|----:----| S S I S V G C L D T G P S S P A I T L F H P Y P Y G V S T Q A L L H H L L L * S L I H I G W L P R H W S I I S C Y D P L BsaXI |Cac8I ||Hin4I |||AciI NlaIV TfiI ||||MboII |SfaNI DraIII HinfI \\\\\ \\ \ \ ATAGCGTGCGGTGGGAACCACAGCGTGATGCTGACAAATGACGGGAATCTGGTAGGATGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TATCGCACGCCACCCTTGGTGTCGCACTACGACTGTTTACTGCCCTTAGACCATCCTACA / / / / / / / / | | | AciI | DraIII HinfI BseGI | | MboII | SfaNI TfiI | Cac8I NlaIV BsaXI Hin4I I A C G G N H S V M L T N D G N L V G C * R A V G T T A * C * Q M T G I W * D V S V R W E P Q R D A D K * R E S G R M W ----:----|----:----|----:----|----:----|----:----|----:----| I A H P P F W L T I S V F S P F R T P H S L T R H S G C R S A S L H R S D P L I Y R A T P V V A H H Q C I V P I Q Y S T Hin6I |GlaI |MstI* ||HhaI ||| Cac8I ||| |AarI ||| |BspMI ||| ||BtsI ||| ||| MwoI ||| ||| BstAPI ||| ||| | AciI ||| ||| | |BisI ||| ||| | ||BlsI ||| ||| | ||TspRI ||| ||| | |||TauI ||| ||| | |||| MwoI ||| ||| | |||| | SetI ||| ||| | |||| | |FatI ||| ||| | |||| | |CviRI* ||| ||| | |||| | ||CviAII ||| ||| | |||| | |||MnlI BseGI FokI BsrI ||| ||| | |||| | |||| NlaIII \ \ \ \\\ \\\ \ \\\\ \ \\\\ \ GGAGATAACAGACGGGGAGAACTGGATAGTGCGCAAGCACTGCGGCAGGTGCATGACTGG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCTATTGTCTGCCCCTCTTGACCTATCACGCGTTCGTGACGCCGTCCACGTACTGACC / / /// // / ///// // // / FokI BsrI ||| || | ||||SetI || || BsrI ||| || | |||MwoI || |FatI ||| || | ||BisI || CviAII ||| || | ||AciI |MnlI ||| || | |BlsI CviRI* ||| || | TauI NlaIII ||| || BspMI ||| || AarI ||| |BstAPI ||| |MwoI ||| Cac8I ||| TspRI ||| BtsI ||Hin6I |MstI* |GlaI HhaI G D N R R G E L D S A Q A L R Q V H D W E I T D G E N W I V R K H C G R C M T G R * Q T G R T G * C A S T A A G A * L E ----:----|----:----|----:----|----:----|----:----|----:----| P S L L R P S S S L A C A S R C T C S Q H L Y C V P L V P Y H A L V A A P A H S S I V S P S F Q I T R L C Q P L H M V P Csp6I |RsaI BseGI ||Cfr10I | Cac8I |||HpaII | | AciI BsrI |||| GsuI | | |BisI |AsuI* |||| HgiCI* | | ||BlsI ||CviJI |||| Eco57MI | | ||FokI ||HaeIII |||| | NlaIV | | |||TauI ||BmgT120I |||| | | TstI | | |||BseYI TstI ||| SecI* |||| | | |SecI* | | |||CviJI | SfaNI ||| DsaI* |||| | | |DsaI* | | |||| GsaI | Tsp4CI* \\\ \ \\\\ \ \ \\ \ \ \\\\ \ \ \ AGGCCCGTGGAAGTACCGGCACCCGTGGTGGATGTGGCGTGCGGCTGGGACACGACAGTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGGGCACCTTCATGGCCGTGGGCACCACCTACACCGCACGCCGACCCTGTGCTGTCAA /// / /////// / / / / //// /// / ||| | ||||||| | DsaI* | | |||| ||TstI Tsp4CI* ||| | ||||||| | SecI* | | |||| |BseYI ||| | ||||||| HgiCI* | | |||| FokI ||| | ||||||NlaIV | | |||CviJI ||| | |||||Cfr10I | | |||GsaI ||| | ||||HpaII | | ||BisI ||| | |||TstI | | ||AciI ||| | ||Eco57MI | | |BlsI ||| | ||GsuI | | TauI ||| | |Csp6I | Cac8I ||| | RsaI BseGI ||| DsaI* ||| SecI* ||AsuI* |BmgT120I HaeIII CviJI R P V E V P A P V V D V A C G W D T T V G P W K Y R H P W W M W R A A G T R Q L A R G S T G T R G G C G V R L G H D S Y ----:----|----:----|----:----|----:----|----:----|----:----| L G T S T G A G T T S T A H P Q S V V T S A R P L V P V R P P H P T R S P C S L P G H F Y R C G H H I H R A A P V R C N BseGI | CfrI BslFI | | CviJI |BceAI | | HaeIII MnlI Hpy166II || BccI | | | FokI | MnlI AciI BseRI | DdeI \\ \ \ \ \ \ \ \ \ \ \ \ ATTGTGGATGCTGATGGCCGTGTATGGCAGAGAGGAGGCGGTTGCTACGAGTTCACTCAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAACACCTACGACTACCGGCACATACCGTCTCTCCTCCGCCAACGATGCTCAAGTGAGTC / // / / / / // / / / / / | || | BseGI | | || MnlI AciI BseRI | DdeI | || BccI | | |MnlI Hpy166II | |BslFI | | FokI | BceAI | CfrI SfaNI HaeIII CviJI I V D A D G R V W Q R G G G C Y E F T Q L W M L M A V Y G R E E A V A T S S L S C G C * W P C M A E R R R L L R V H S A ----:----|----:----|----:----|----:----|----:----|----:----| I T S A S P R T H C L P P P Q * S N V * * Q P H Q H G H I A S L L R N S R T * E N H I S I A T Y P L S S A T A V L E S L FatI AflIII BspLU11I* |CviAII || MwoI || BstAPI || |NspI || |NlaIII || || BspCNI || || |BseMII AccI || || || ApoI SfaNI BseGI || || || TspEI Hin6I |BssNAI | Hpy178III* || || || EcoRI |GlaI |Hpy166II | | FokI || || || | BtgZI ||HhaI || MmeI | | TspGWI \\ \\ \\ \ \ \\\ \\ \ \ \ \ CAACATGTGCCATTGAATTCCAACGATGAGCGCATCGCAGTATACGGATGTTTCCAGAAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTACACGGTAACTTAAGGTTGCTACTCGCGTAGCGTCATATGCCTACAAAGGTCTTG / /// / / /// // / / // | ||BseMII | BtgZI ||Hin6I || | BseGI |TspGWI | |BspLU11I* EcoRI |GlaI || SfaNI Hpy178III* | |BspCNI TspEI HhaI |AccI | |AflIII ApoI Hpy166II | |FatI BssNAI | CviAII MmeI BstAPI NlaIII MwoI NspI Q H V P L N S N D E R I A V Y G C F Q N N M C H * I P T M S A S Q Y T D V S R T T C A I E F Q R * A H R S I R M F P E L ----:----|----:----|----:----|----:----|----:----|----:----| C C T G N F E L S S R M A T Y P H K W F A V H A M S N W R H A C R L I R I N G S L M H W Q I G V I L A D C Y V S T E L V CviRI* | HgiCI* | | NlaIV | | | AvaI | | | |BmeT110I | | | || AccI | | | || |BssNAI | | | || |Hpy166II | | | || || BseYI BceAI | | | || || CviJI | BbvI | | | || || | GsaI | DraIII | | | || || | | TseI | | MfeI | | | || || | | MwoI | | Hin4I | | | || || | | |BisI | | TspEI | | | || || | | ||BlsI | | | CviRI* \ \ \ \\ \\ \ \ \\\ \ \ \ \ TTTGTGGTGGTGCAAGGCACCCGAGTATACGGCTGGGGCAGCAACACAAAGTGTCAATTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAACACCACCACGTTCCGTGGGCTCATATGCCGACCCCGTCGTTGTGTTTCACAGTTAAC / / / / // // / // /// / / / // FokI | | | || || | || ||TseI | | BbvI |CviRI* | | | || || | || |BisI | Hin4I TspEI | | | || || | || BlsI DraIII MfeI | | | || || | |BseYI BceAI | | | || || | MwoI | | | || || CviJI | | | || || GsaI | | | || |AccI | | | || Hpy166II | | | || BssNAI | | | |AvaI | | | BmeT110I | | HgiCI* | NlaIV CviRI* F V V V Q G T R V Y G W G S N T K C Q L L W W C K A P E Y T A G A A T Q S V N C C G G A R H P S I R L G Q Q H K V S I A ----:----|----:----|----:----|----:----|----:----|----:----| K T T T C P V R T Y P Q P L L V F H * N S Q P P A L C G L I R S P C C C L T D I K H H H L A G S Y V A P A A V C L T L Q TspRI |Hin4I || CviJI || | SduI || | HgiJII* || | | Hin4I || | | Hin4I || | | | Csp6I CviJI || | | | Hpy166II | SduI || | | | |RsaI | HgiJII* || | | | || BceAI | | Hpy178III* || | | | || | BssKI | | | MboI || | | | || | |HpaII | | | | DpnI || | | | || | ||ScrFI | | | | |BstKTI || | | | || | ||CauII* CfrI \ \ \ \ \\ \\ \ \ \ \\ \ \\\ \ CAAGAGCCCAAATCCCGATCACTGAAAGAGCCCGTATTGGTGTACGATACCGGGTCTGTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCGGGTTTAGGGCTAGTGACTTTCTCGGGCATAACCACATGCTATGGCCCAGACAC / / /// / / / / / /// / / / | CviJI ||| | Hin4I | | Hin4I ||| | | BssKI HgiJII* ||| MboI | | Hin4I ||| | CauII* SduI ||DpnI | CviJI ||| | HpaII |BstKTI HgiJII* ||| | ScrFI |TspRI SduI ||| BceAI Hpy178III* ||Csp6I |RsaI Hpy166II Q E P K S R S L K E P V L V Y D T G S V K S P N P D H * K S P Y W C T I P G L W R A Q I P I T E R A R I G V R Y R V C G ----:----|----:----|----:----|----:----|----:----|----:----| C S G L D R D S F S G T N T Y S V P D T A L A W I G I V S L A R I P T R Y R T Q L L G F G S * Q F L G Y Q H V I G P R H CviJI HaeIII FatI | AccI |CviAII | |Hpy166II ||DrdI | || Hin4I ||| NlaIII | || Hin4I ||| | MnlI | || | MaeII ||| | | Hpy166II | || | |BsaAI ||| | | | AciI | || | || CfrI ||| | | | |CfrI | || | || SetI ||| | | | |BisI | || | || TaiI ||| | | | |NotI | || | || | BalI ||| | | | |XmaIII* | || | || | CviJI ||| | | | ||BlsI | || | || | HaeIII ||| | | | |||TauI | || | || | |FatI ||| | | | |||CviJI | || | || | |NcoI ||| | | | |||HaeIII | || | || | |StyI ||| | | | ||||FokI | || | || | |SecI* ||| | | | ||||AciI | || | || | |DsaI* ||| | | | ||||BisI | || | || | ||CviAII ||| | | | ||||McrI* | || | || | ||| TspDTI ||| | | | |||||BlsI | || | || | ||| NlaIII ||| | | | ||||||TauI \ \\ \ \\ \ \\\ \ \\\ \ \ \ \\\\\\\ GCCGTAGACTACGTGGCCATGGGCAAGGACTTCATGGTCATAGTGGACGAGGGCGGCCGC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCATCTGATGCACCGGTACCCGTTCCTGAAGTACCAGTATCACCTGCTCCCGCCGGCG / // // / // ////// / // / / /////// | || || | || |||||DsaI* | |FatI | | ||||||AciI | || || | || |||||SecI* | | | | |||||XmaIII* | || || | || |||||StyI | | | | |||||NotI | || || | || |||||NcoI | | | | |||||CfrI | || || | || |||||FatI | | | | |||||BisI | || || | || ||||CviAII | | | | ||||BlsI | || || | || |||TspDTI | | | | |||HaeIII | || || | || ||CfrI | | | | |||CviJI | || || | || |NlaIII | | | | |||TauI | || || | || HaeIII | | | | ||McrI* | || || | || CviJI | | | | ||BisI | || || | || BalI | | | | ||AciI | || || | |MaeII | | | | |BlsI | || || | BsaAI | | | | TauI | || || TaiI | | | Hpy166II | || || SetI | | MnlI | || |AccI | CviAII | || Hpy166II NlaIII | |Hin4I DrdI | |Hin4I | CfrI HaeIII CviJI A V D Y V A M G K D F M V I V D E G G R P * T T W P W A R T S W S * W T R A A A R R L R G H G Q G L H G H S G R G R P H ----:----|----:----|----:----|----:----|----:----|----:----| A T S * T A M P L S K M T M T S S P P R P R L S R P W P C P S * P * L P R P R G G Y V V H G H A L V E H D Y H V L A A A ApaLI | CviRI* BsrI | Hpy166II TspRI | | SduI | TaqI | | Cac8I | | BfiI | | BseSI | | |AluI | | HgiAI* | | |CviJI | | | BseGI | | |Ecl136II | | | | BetI* | | || SetI | | | | |HpaII | | || SduI | | | | || McrI* | | || SacI | | | | || |SfaNI | | || HgiAI* | | | | || || Cac8I | | || HgiJII* \ \ \ \ \\ \\ \ \ \ \\ \ ATAGTGCACGCATCCGGTCGCCTGCCCACTGGGTTCGAGCTCAAACAACAGCAAAAAAGA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TATCACGTGCGTAGGCCAGCGGACGGGTGACCCAAGCTCGAGTTTGTTGTCGTTTTTTCT / / / / // /// / / / | | | ApaLI || ||TspRI BsrI | Ecl136II | | | Cac8I || |SfaNI | CviJI | | | BseGI || Cac8I | AluI | | Hpy166II |BetI* HgiJII* | | CviRI* HpaII HgiAI* | HgiAI* McrI* BfiI | BseSI TaqI | SduI SacI FokI SduI SetI I V H A S G R L P T G F E L K Q Q Q K R * C T H P V A C P L G S S S N N S K K D S A R I R S P A H W V R A Q T T A K K T ----:----|----:----|----:----|----:----|----:----|----:----| M T C A D P R R G V P N S S L C C C F L C L A R M R D G A W Q T R A * V V A F F Y H V C G T A Q G S P E L E F L L L F S Csp6I |RsaI || Tsp4CI* || | FatI || | CviRI* || | |CviAII || | || NspI || | || NlaIII || | || | AsuI* || | || | AvaII || | || | Hpy166II BsePI || | || | |BinI* Hin6I || | || | |BmgT120I |GlaI || | || | || TaqI ||HhaI || | || | || SetI ||BsmI || | || | || |MboI ||Hin6I || | || | || || DpnI ||Cac8I || | || | || || |BstKTI ||FnuDII* || | || | || || || MnlI |||GlaI MaeI || | || | || || || | SetI ||||HhaI BsiYI* \ \\ \ \\ \ \\ \\ \\ \ \ \\\\\ \ CACAATCTAGTGGTACTGTGCATGTGGACCTCGATCCACCTGTGGAATGCGCGCCTCAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTTAGATCACCATGACACGTACACCTGGAGCTAGGTGGACACCTTACGCGCGGAGTTA / /// / // //// // /// ///// / MaeI ||| | || |||| || ||MnlI ||||| BsiYI* ||| | || |||| || |SetI ||||BsePI ||| | || |||| || MboI ||||Hin6I ||| | || |||| |DpnI |||GlaI ||| | || |||| BstKTI ||FnuDII* ||| | || |||| TaqI ||Hin6I ||| | || |||AvaII ||Cac8I ||| | || |||AsuI* ||HhaI ||| | || ||BmgT120I |GlaI ||| | || ||BinI* BsmI ||| | || |SetI HhaI ||| | || Hpy166II ||| | |FatI ||| | CviAII ||| CviRI* ||| NlaIII ||| NspI ||Tsp4CI* |Csp6I RsaI H N L V V L C M W T S I H L W N A R L N T I * W Y C A C G P R S T C G M R A S I Q S S G T V H V D L D P P V E C A P Q Y ----:----|----:----|----:----|----:----|----:----|----:----| C L R T T S H M H V E I W R H F A R R L V C D L P V T C T S R S G G T S H A G * V I * H Y Q A H P G R D V Q P I R A E I AciI Ksp632I* | FauI | |Hin6I | ||GlaI Tsp4CI* SduI | |||HhaI |MnlI PleI BseSI | ||||HaeII || HinfI |MlyI | MboII | |||||MaeI \\ \ \\ \ \ \ \\\\\\ ACGGTAGAGTCGTTTGGTAGGGGCACACATTCCCAACTCTTCCCGCAAGAGCGCCTAGAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCATCTCAGCAAACCATCCCCGTGTGTAAGGGTTGAGAAGGGCGTTCTCGCGGATCTG // / / / / // //// / |MnlI HinfI PleI BseSI MboII || |||| MaeI Tsp4CI* MlyI SduI || |||Hin6I || ||FauI || ||GlaI || |HhaI || HaeII |Ksp632I* AciI T V E S F G R G T H S Q L F P Q E R L D R * S R L V G A H I P N S S R K S A * T G R V V W * G H T F P T L P A R A P R L ----:----|----:----|----:----|----:----|----:----|----:----| V T S D N P L P V C E W S K G C S R R S Y P L T T Q Y P C V N G V R G A L A G L R Y L R K T P A C M G L E E R L L A * V CviRI* | BssKI | |HpaII SduI | ||ScrFI HgiAI* Hin4II* BsiYI* | ||CauII* | Tsp4CI* | Hpy178III* \ \ \\\ \ \ \ \ TTCCCTATTGTCGGTGTTGCAACCGGGAGTGAGCACGGTATTCTAACTACTGCTAATCAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGATAACAGCCACAACGTTGGCCCTCACTCGTGCCATAAGATTGATGACGATTAGTT / / / / / / / / BsiYI* | | | | Tsp4CI* | Hpy178III* | | | HgiAI* Hin4II* | | | SduI | | BssKI | CauII* | HpaII | ScrFI CviRI* F P I V G V A T G S E H G I L T T A N Q S L L S V L Q P G V S T V F * L L L I K P Y C R C C N R E * A R Y S N Y C * S R ----:----|----:----|----:----|----:----|----:----|----:----| K G I T P T A V P L S C P I R V V A L * S G * Q R H Q L R S H A R Y E L * Q * D E R N D T N C G P T L V T N * S S S I L AccI |BssNAI |Hpy166II || BseYI BsmAI || | GsaI | MaeIII || | | BseYI FatI AciI | Tsp4CI* || | | CviJI |CviAII MwoI EcoP15I | | TspRI || | | | GsaI || NlaIII |BisI \ \ \ \ \\ \ \ \ \ \\ \ \\ GAAGGCAAGTCTCACTGTTACAATGTATACTGCTGGGGCTGGGGAGAGCATGGCAACTGC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCGTTCAGAGTGACAATGTTACATATGACGACCCCGACCCCTCTCGTACCGTTGACG / / / / / // / / / / / // / // | | | | | || | | | BseYI | || | |BlsI | | | | | || | | CviJI | || | TauI | | | | | || | | GsaI | || MwoI | | | | | || | BseYI | |FatI | | | | | || GsaI | CviAII | | | | | |AccI NlaIII | | | | | Hpy166II | | | | | BssNAI | | | | MaeIII | | | BsmAI | | Tsp4CI* | TspRI EcoP15I E G K S H C Y N V Y C W G W G E H G N C K A S L T V T M Y T A G A G E S M A T A R Q V S L L Q C I L L G L G R A W Q L R ----:----|----:----|----:----|----:----|----:----|----:----| S P L D * Q * L T Y Q Q P Q P S C P L Q L L C T E S N C H I S S P S P L A H C S F A L R V T V I Y V A P A P S L M A V A BlsI AsuI* |TauI |CviJI |HaeIII |BmgT120I || AciI || Cac8I || | BsiYI* || | |BsiYI* || | ||FauI || | ||| CviJI || | ||| |NlaIV || | ||| ||SduI || | ||| ||HgiJII* || | ||| |||Hin4I || | ||| |||BseYI || | ||| |||| GsaI || | ||| |||| BssKI || | ||| |||| CviJI || | ||| |||| EcoRII || | ||| |||| | ScrFI || | ||| |||| | BseBI || | ||| |||| | | MwoI || | ||| |||| | | |SfeI* || | ||| |||| | | || TseI || | ||| |||| | | || CviRI* || | ||| |||| | | || |BisI || | ||| |||| | | || ||BlsI || | ||| |||| | | || ||PstI || | ||| |||| | | || |||AluI || | ||| |||| | | || |||CviJI || | ||| |||| | | || ||||BsiI* || | ||| |||| | | || |||||SetI || | ||| |||| | | || |||||| AsuI* || | ||| |||| | | || |||||| |BmgT120I BstXI || | ||| |||| | | || |||||| ||CviJI Hin4I || | ||| |||| | | || |||||| ||HaeIII |Hpy178III* || | ||| |||| | | || |||||| |||BbvI || SetI \\ \ \\\ \\\\ \ \ \\ \\\\\\ \\\\ \\ \ GGCCCGCAAAAGGGCTCCCAGCCTGGACTGCAGCTCGTGGGCCAATACTCTGGAAAACCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGGCGTTTTCCCGAGGGTCGGACCTGACGTCGAGCACCCGGTTATGAGACCTTTTGGA //// // //// / / / / / //// / // /// / / |||| || |||| | | | | | |||| | || ||BbvI | SetI |||| || |||| | | | | | |||| | || |BstXI Hpy178III* |||| || |||| | | | | | |||| | || Hin4I |||| || |||| | | | | | |||| | |AsuI* |||| || |||| | | | | | |||| | BmgT120I |||| || |||| | | | | | |||| | HaeIII |||| || |||| | | | | | |||| | CviJI |||| || |||| | | | | | |||| BsiI* |||| || |||| | | | | | |||CviJI |||| || |||| | | | | | |||TseI |||| || |||| | | | | | |||AluI |||| || |||| | | | | | ||SfeI* |||| || |||| | | | | | ||BisI |||| || |||| | | | | | |BlsI |||| || |||| | | | | | |SetI |||| || |||| | | | | | CviRI* |||| || |||| | | | | PstI |||| || |||| | | | EcoRII |||| || |||| | | | BssKI |||| || |||| | | BseBI |||| || |||| | | ScrFI |||| || |||| | | MwoI |||| || |||| | BseYI |||| || |||| | CviJI |||| || |||| GsaI |||| || |||NlaIV |||| || ||CviJI |||| || |FauI |||| || HgiJII* |||| || Hin4I |||| || SduI |||| |BsiYI* |||| BsiYI* |||| AciI |||AsuI* |||Cac8I ||BmgT120I |HaeIII |CviJI BisI AciI G P Q K G S Q P G L Q L V G Q Y S G K P A R K R A P S L D C S S W A N T L E N L P A K G L P A W T A A R G P I L W K T S ----:----|----:----|----:----|----:----|----:----|----:----| P G C F P E W G P S C S T P W Y E P F G R G A F P S G A Q V A A R P G I S Q F V A R L L A G L R S Q L E H A L V R S F R MaeII |FokI |EciI |PmaCI |BsaAI |PflMI |DraIII |BsiYI* || SetI || TaiI || |MboI || || DpnI || || |BstKTI FnuDII* || || || BinI* | MwoI || || || |SduI | MnlI || || || |HgiAI* | | AciI BseGI || || || ||MaeI \ \ \ \ \\ \\ \\ \\\ CGCGTGTTTGGCGGATGTGCCACCACGTGGATCGTGCTCTAG 970 980 990 1000 ----:----|----:----|----:----|----:----|-- GCGCACAAACCGCCTACACGGTGGTGCACCTAGCACGAGATC / / / / / // // // // / / | | MnlI | BseGI || || || || | MaeI | MwoI AciI || || || || BinI* FnuDII* || || || |HgiAI* || || || |SduI || || || MboI || || |DpnI || || BstKTI || || FokI || |MaeII || BsaAI || PmaCI |EciI |TaiI |SetI BsiYI* DraIII PflMI R V F G G C A T T W I V L * A C L A D V P P R G S C S X R V W R M C H H V D R A L X ----:----|----:----|----:----|----:----|-- R T N P P H A V V H I T S * E R T Q R I H W W T S R A R A H K A S T G G R P D H E L # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 4 FblI,XmiI AciI 10 BspACI,SsiI AflIII 1 AluI 2 AluBI ApaLI 1 Alw44I,VneI ApoI 1 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 2 BseXI,BstV1I,Lsp1109I BccI 2 BceAI 3 BciVI 1 BfuI BetI* 1 BsaWI BfiI 3 BmrI,BmuI BinI* 2 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmeT110I 1 BmgT120I 4 BsaAI 2 BstBAI,Ppu21I BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 1 BsePI 1 BssHII,PauI BseRI 1 BseSI 3 BaeGI,BstSLI BseYI 5 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 6 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrI 5 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BssNAI 3 Bst1107I,BstZ17I BstAPI 2 BstKTI 3 BstXI 1 BtgZI 1 BtsI 1 Cac8I 7 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 4 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 6 CviJI 16 CviKI-1 CviRI* 7 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 3 MalI DraIII 3 AdeI DrdI 1 AasI,DseDI DsaI* 3 BtgI,BstDSI EciI 1 Ecl136II 1 EcoICRI Eco57MI 1 EcoP15I 1 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI FatI 6 FauI 2 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 5 GsaI 5 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 7 BsnI,BsuRI,BshFI,PhoI HgiAI* 4 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 4 Eco24I,EcoT38I,FriOI,BanII HhaI 5 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 1 HpyAV Hin6I 5 HinP1I,HspAI HinfI 2 HpaII 4 HapII,BsiSI,MspI Hpy166II 9 Hpy8I Hpy178III* 5 Hpy188III Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 1 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 McrI* 2 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 9 MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 7 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NotI 1 CciNI NspI 2 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PstI 1 RsaI 3 AfaI SacI 1 Psp124BI,SstI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 9 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 9 SfaNI 4 LweI SfeI* 1 BstSFI,SfcI,BfmI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 2 TauI 5 TfiI 1 PfeI TseI 2 ApeKI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 2 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 4 TscAI TstI 1 XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI AscI Asp718I AsuII AvrII BaeI BamHI BarI BbvCI BbvII* Bce83I* BcgI BclI BdaI BglI BglII BmtI BplI Bpu10I BsaBI BsgI Bsp120I Bsp1407I BspHI BspMII* BspOI BsrBI BsrDI BstEII BtrI Cfr9I ClaI CspCI DinI DraII Eam1105I Eco31I Eco47III Eco57I EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI HgaI HindII HindIII HpaI HphI Hpy188I Hpy99I KasI KpnI MauBI MluI Mph1103I MroNI MseI MslI NaeI NarI NdeI NgoMIV NheI NmeAIII NruI NsiI NspBII* OliI PacI PasI PfoI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TatI TsoI Tsp45I TspMI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769