Restriction Map of DEP1/YAL013W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DEP1/YAL013W on chromosome I from coordinates 129270 to 130487.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.15449

AsuI* AvaII DraII PpuMI |BmgT120I || SetI || |MboI || |BclI PleI || || DpnI HinfI |MlyI Hpy166II || || |BstKTI \ \\ \ \\ \\ \\ ATGAGTCAGCAAACACCACAGGAAAGTGAACAGACCACAGCGAAAGAACAGGACCTTGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCAGTCGTTTGTGGTGTCCTTTCACTTGTCTGGTGTCGCTTTCTTGTCCTGGAACTA / / / /// // HinfI PleI Hpy166II ||| |DpnI MlyI ||| BstKTI ||PpuMI ||DraII ||AvaII ||AsuI* |BmgT120I SetI M S Q Q T P Q E S E Q T T A K E Q D L D * V S K H H R K V N R P Q R K N R T L I E S A N T T G K * T D H S E R T G P * S ----:----|----:----|----:----|----:----|----:----|----:----| X L * C V G C S L S C V V A F S C S R S X S D A F V V P F H V S W L S L V P G Q H T L L C W L F T F L G C R F F L V K I TspEI BsaBI |TspGWI |TfiI || ApoI Hpy178III* MwoI |HinfI || TspEI \ \ \\ \\ \ CAAGAGAGCGTGTTGAGCAACATTGACTTCAATACGGATTTGAATCACAATTTGAATTTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCTCGCACAACTCGTTGTAACTGAAGTTATGCCTAAACTTAGTGTTAAACTTAAAT / / / / / / / / | | MwoI | | | TspEI TspEI | Hpy178III* | | TspGWI ApoI BclI | HinfI MboI | TfiI BsaBI Q E S V L S N I D F N T D L N H N L N L K R A C * A T L T S I R I * I T I * I Y R E R V E Q H * L Q Y G F E S Q F E F I ----:----|----:----|----:----|----:----|----:----|----:----| * S L T N L L M S K L V S K F * L K F K D L S R T S C C Q S * Y P N S D C N S N L L A H Q A V N V E I R I Q I V I Q I * Hpy188I | Tsp4CI* Hin4I | | BsrI | MnlI | | | MaeIII | |BsaXI | | | Tsp45I HgaI | || MboII | | | | TspRI | BccI | || | Hpy99I \ \ \ \ \ \ \ \ \\ \ \ TCGGAATACTGTATATCCAGTGACGCAGGAACAGAGAAGATGGATAGCGACGAGGAGAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCTTATGACATATAGGTCACTGCGTCCTTGTCTCTTCTACCTATCGCTGCTCCTCTTC / / / / / / / // / | | TspRI Tsp45I | | | || Hpy99I | | BsrI MaeIII | | | || MboII | Tsp4CI* | | | |MnlI Hpy188I | | | BsaXI | | Hin4I | HgaI BccI S E Y C I S S D A G T E K M D S D E E K R N T V Y P V T Q E Q R R W I A T R R S G I L Y I Q * R R N R E D G * R R G E V ----:----|----:----|----:----|----:----|----:----|----:----| D S Y Q I D L S A P V S F I S L S S S F I P I S Y I W H R L F L S S P Y R R P S R F V T Y G T V C S C L L H I A V L L L CfrI BssKI | BalI CviJI | CviJI Hin4I AluI EcoRII Esp3I | BseRI |HpaII CviJI | ScrFI BsmAI | HaeIII |BsaXI | SetI | BseBI | HphI \ \ \\ \ \ \ \ \ \ TCGTTGGCCAATCTGCCGGAGTTGAAATACGCTCCCAAGCTATCCAGCCTGGTGAAGCAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAACCGGTTAGACGGCCTCAACTTTATGCGAGGGTTCGATAGGTCGGACCACTTCGTT / / // / / / / / / / // | | || | HpaII | CviJI | | EcoRII |MwoI | | || BsaXI | AluI | | BssKI BsmAI | | |Hin4I SetI | BseBI Esp3I | | CfrI | ScrFI HphI | HaeIII CviJI | CviJI | BalI BseRI S L A N L P E L K Y A P K L S S L V K Q R W P I C R S * N T L P S Y P A W * S K V G Q S A G V E I R S Q A I Q P G E A R ----:----|----:----|----:----|----:----|----:----|----:----| D N A L R G S N F Y A G L S D L R T F C T T P W D A P T S I R E W A I W G P S A R Q G I Q R L Q F V S G L * G A Q H L L AluI MwoI CviJI MslI MboII HphI HgaI | SetI | MnlI | MnlI \ \ \ \ \ \ \ \ GAGACGCTCACCGAGAGCTTGAAAAGACCACACGAAGATGAGAAAGAGGCGATAGATGAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGCGAGTGGCTCTCGAACTTTTCTGGTGTGCTTCTACTCTTTCTCCGCTATCTACTC / / / / / / / HphI | CviJI | MnlI | MnlI | HgaI MslI MboII | AluI SetI E T L T E S L K R P H E D E K E A I D E R R S P R A * K D H T K M R K R R * M R D A H R E L E K T T R R * E R G D R * G ----:----|----:----|----:----|----:----|----:----|----:----| S V S V S L K F L G C S S S F S A I S S L S A * R S S S F V V R L H S L P S L H L R E G L A Q F S W V F I L F L R Y I L BssKI MboII |HpaII ||ScrFI ||CauII* CviJI ||| MnlI Ksp632I* HinfI HaeIII ||| |TspDTI |MnlI |MboII \ \\\ \\ \\ \\ GCCAAGAAGATGAAAGTGCCGGGAGAGAACGAGGACGAAAGCAAGGAAGAGGAAAAGAGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTCTTCTACTTTCACGGCCCTCTCTTGCTCCTGCTTTCGTTCCTTCTCCTTTTCTCA / / / / / / / / HaeIII | | TspDTI | Ksp632I* | HinfI CviJI | | BssKI MnlI MboII | | MnlI | CauII* | HpaII | ScrFI MboII A K K M K V P G E N E D E S K E E E K S P R R * K C R E R T R T K A R K R K R V Q E D E S A G R E R G R K Q G R G K E S ----:----|----:----|----:----|----:----|----:----|----:----| A L F I F T G P S F S S S L L S S S F L P W S S S L A P L S R P R F C P L P F S G L L H F H R S L V L V F A L F L F L T SduI HgiAI* | AcyI | |MboII | ||BssKI | ||EcoRII | ||Hpy99I Hpy178III* | |||SecI* | PleI | |||BsiYI* | Ksp632I* MfeI | ||||ScrFI | |MnlI TspEI SapI | ||||BseBI | |MlyI BsrI | MboII Ksp632I* | ||||| HgaI \ \\ \ \ \ \ \ \\\\\ \ CAAGAACTGGAAGAGGCAATTGACAGCAAGGAGAAGAGCACCGACGCCAGGGACGAGCAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTGACCTTCTCCGTTAACTGTCGTTCCTCTTCTCGTGGCTGCGGTCCCTGCTCGTT / // // / / / / / / / / / / | || |BsrI MboII | | | | | | | | Hin4II* | || Ksp632I* TspEI | | | | | | | HgaI | |PleI MfeI | | | | | | EcoRII | |MlyI | | | | | | BssKI | MnlI | | | | | | SecI* Hpy178III* | | | | | BseBI | | | | | ScrFI | | | | AcyI | | | BsiYI* | | | MboII | | Hpy99I | HgiAI* | SduI Ksp632I* SapI Q E L E E A I D S K E K S T D A R D E Q K N W K R Q L T A R R R A P T P G T S K R T G R G N * Q Q G E E H R R Q G R A R ----:----|----:----|----:----|----:----|----:----|----:----| * S S S S A I S L L S F L V S A L S S C D L V P L P L Q C C P S S C R R W P R A L F Q F L C N V A L L L A G V G P V L L MnlI SetI MnlI Hin4II* | MnlI | MnlI | BslFI | |BslFI HphI | | BseRI BseRI TspDTI \ \ \ \\ \ \ \ \ \ \ GGGGACGAAGGTGATAATGAGGAGGAAAACAACGAGGAGGATAATGAAAACGAAAACGAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCTGCTTCCACTATTACTCCTCCTTTTGTTGCTCCTCCTATTACTTTTGCTTTTGCTC / / / // / / / / / | | MnlI |HphI | | BseRI BseRI TspDTI | MnlI BslFI | MnlI BslFI MnlI SetI G D E G D N E E E N N E E D N E N E N E G T K V I M R R K T T R R I M K T K T S G R R * * * G G K Q R G G * * K R K R A ----:----|----:----|----:----|----:----|----:----|----:----| P S S P S L S S S F L S S S L S F S F S L P R L H Y H P P F C R P P Y H F R F R P V F T I I L L F V V L L I I F V F V L AciI | MwoI | BstAPI TaqI | |SfaNI |MnlI | |Cac8I ||MslI | || Hin6I ||| BstXI | || |GlaI ||| |BccI BdaI | || ||HhaI MwoI HphI ||| || MnlI BdaI \ \\ \\\ \ \ \\\ \\ \ \ CATACAGCACCGCCTGCGCTGGTGATGCCCTCCCCCATCGAAATGGAGGAACAGAGGATG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGTCGTGGCGGACGCGACCACTACGGGAGGGGGTAGCTTTACCTCCTTGTCTCCTAC / / / /// / / / / / / / / | | | ||| MwoI HphI | | | MnlI BdaI BseGI | | | ||Hin6I | | BccI BdaI | | | ||SfaNI | MslI | | | |GlaI | TaqI | | | HhaI BstXI | | Cac8I MnlI | AciI BstAPI MwoI H T A P P A L V M P S P I E M E E Q R M I Q H R L R W * C P P P S K W R N R G * Y S T A C A G D A L P H R N G G T E D D ----:----|----:----|----:----|----:----|----:----|----:----| C V A G G A S T I G E G M S I S S C L I A Y L V A Q A P S A R G W R F P P V S S M C C R R R Q H H G G G D F H L F L P H Hin6I FnuDII* TaqI |GlaI BseGI | Eco57I ||HhaI |Hin4II* | Eco57MI |||MfeI ||Hin6I | |TatI |||TspEI |||GlaI | ||Csp6I |||| Hin6I ||||HhaI | |||RsaI |||| |GlaI ||||| HphI | |||BdaI |||| ||HhaI ||||| FokI PpiI | |||BdaI |||| |||PpiI \\\\\ \ \ \ \\\\ \\\\ \\\\ ACTGCGCTGAAGGAAATCACCGACATCGAGTACAAGTTCGCGCAATTGCGCCAAAAACTA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGCGACTTCCTTTAGTGGCTGTAGCTCATGTTCAAGCGCGTTAACGCGGTTTTTGAT / /// / // / // /// /// ///// | ||| HphI |PpiI | || ||TatI ||| ||||Hin6I | ||Hin6I FokI | || |Csp6I ||| |||GlaI | |GlaI | || RsaI ||| ||HhaI | HhaI | |BdaI ||| |TspEI Hin4II* | |BdaI ||| |MfeI | TaqI ||| PpiI Eco57MI ||Hin6I Eco57I |GlaI FnuDII* HhaI T A L K E I T D I E Y K F A Q L R Q K L L R * R K S P T S S T S S R N C A K N Y C A E G N H R H R V Q V R A I A P K T I ----:----|----:----|----:----|----:----|----:----|----:----| V A S F S I V S M S Y L N A C N R W F S S Q A S P F * R C R T C T R A I A G F V S R Q L F D G V D L V L E R L Q A L F * AciI | BbvI | | CviRI* | | | MwoI | | | | TseI | | | | AluI | | | | CviJI TspGWI | | | | |BisI Hin4II* | | | | |SfeI* | Hpy178III* | | | | ||BlsI | | MaeIII | | | | ||SetI | | Tsp45I MfeI | | | | |||CviRI* | | | BssKI TspEI | | | | |||| PstI | | | |BspMI \ \ \ \ \ \\\\ \ \ \ \ \\ TATGACAATCAATTGGTGCGGTTGCAAACGGAGCTGCAGATGTGTCTGGAAGGGTCACAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTGTTAGTTAACCACGCCAACGTTTGCCTCGACGTCTACACAGACCTTCCCAGTGTG / / / / / //// / // / / TspEI | | | | |||| | || | Tsp45I MfeI | | | | |||| | || | MaeIII | | | | |||| | || Hpy178III* | | | | |||| | |Hin4II* | | | | |||| | TspGWI | | | | |||| SfeI* | | | | |||CviRI* | | | | |||TseI | | | | ||BisI | | | | |BlsI | | | | |PstI | | | | CviJI | | | | AluI | | | SetI | | MwoI | CviRI* | BbvI AciI Y D N Q L V R L Q T E L Q M C L E G S H M T I N W C G C K R S C R C V W K G H T * Q S I G A V A N G A A D V S G R V T P ----:----|----:----|----:----|----:----|----:----|----:----| Y S L * N T R N C V S S C I H R S P D C I H C D I P A T A F P A A S T D P L T V I V I L Q H P Q L R L Q L H T Q F P * V TspGWI | BinI* | | AciI | | BisI HpaII | | |BlsI ScrFI | | ||TauI CauII* | | ||FnuDII* | TspEI | | |||MboI | | CviRI* | | ||||MboII | | | AccI | | |||||DpnI | | | SetI | | ||||||BstKTI AluI | | | |Hpy166II | | ||||||| MaeIII CviJI | | | || TaqI | | ||||||| Tsp45I | SetI \ \ \ \\ \ \ \ \\\\\\\ \ \ \ CCGGAATTGCAGGTCTACTACTCGAAGATTGCCGCGATCCGTGACTACAAGCTACACCGA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTTAACGTCCAGATGATGAGCTTCTAACGGCGCTAGGCACTGATGTTCGATGTGGCT /// /// // / / /////// / / / / ||| ||SetI |AccI | | ||||||| MboI | | CviJI ||| || Hpy166II | | ||||||DpnI | | AluI ||| |CviRI* | | |||||BstKTI | SetI ||| TspEI | | ||||MboII Tsp45I ||BssKI | | |||FnuDII* MaeIII ||BspMI | | |||AciI |HpaII | | ||BisI CauII* | | |BlsI ScrFI | | BinI* | | TauI | TspGWI TaqI P E L Q V Y Y S K I A A I R D Y K L H R R N C R S T T R R L P R S V T T S Y T E G I A G L L L E D C R D P * L Q A T P S ----:----|----:----|----:----|----:----|----:----|----:----| G S N C T * * E F I A A I R S * L S C R G P I A P R S S S S Q R S G H S C A V G R F Q L D V V R L N G R D T V V L * V S AluI CviJI | SetI | | FatI | | |CviAII TspDTI | | || CviRI* |BssKI TspDTI | | || NlaIII |EcoRII Csp6I |Csp6I | | || | EcoT22I || ScrFI |RsaI ||RsaI | | || | | SfaNI || BseBI \\ \\\ \ \ \\ \ \ \ \\ \ GCGTACCAGCGACAGAAGTACGAGCTTTCATGCATCAACACAGAAACAATCGCTACCAGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGCATGGTCGCTGTCTTCATGCTCGAAAGTACGTAGTTGTGTCTTTGTTAGCGATGGTCC // / // / / / /// / / / / |Csp6I | || | | | ||CviRI* SfaNI | | EcoRII RsaI | || | | | ||FatI | | BssKI | || | | | |CviAII | | HphI | || | | | EcoT22I | BseBI | || | | NlaIII | ScrFI | || | CviJI TspDTI | || | AluI | || SetI | |Csp6I | RsaI TspDTI A Y Q R Q K Y E L S C I N T E T I A T R R T S D R S T S F H A S T Q K Q S L P G V P A T E V R A F M H Q H R N N R Y Q D ----:----|----:----|----:----|----:----|----:----|----:----| A Y W R C F Y S S E H M L V S V I A V L L T G A V S T R A K M C * C L F L R * W R V L S L L V L K * A D V C F C D S G P BbvI | SetI | | Cac8I | | | BssKI | | | CviJI | | | EcoRII Hin4II* | | | |BspMI | HphI | | | ||MwoI | EcoP15I | | | ||ScrFI | | BsiYI* | | | ||BseBI BssKI | | | MaeIII | | | ||| TseI EcoRII | | | Tsp45I | | | ||| CviJI | ScrFI | | | BstEII | | | ||| |BisI HphI | BseBI | | | | SetI | | | ||| ||BlsI \ \ \ \ \ \ \ \ \ \ \ \\\ \\\ ACATTCATTCACCAGGACTTCCACAAGAAGGTCACCGACCTGCGAGCCAGGCTGCTGAAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAAGTAAGTGGTCCTGAAGGTGTTCTTCCAGTGGCTGGACGCTCGGTCCGACGACTTG / / / // / / / / / /// / //// | | | || | SetI | SetI | ||| | |||TseI | | | || EcoP15I BstEII | ||| | ||BisI | | | |BsiYI* Tsp45I | ||| | |BlsI | | | HphI MaeIII | ||| | EcoRII | | Hin4II* | ||| | BspMI | EcoRII | ||| | BssKI | BssKI | ||| | CviJI BseBI | ||| BseBI ScrFI | ||| ScrFI | ||CviJI | |MwoI | Cac8I BbvI T F I H Q D F H K K V T D L R A R L L N H S F T R T S T R R S P T C E P G C * T I H S P G L P Q E G H R P A S Q A A E Q ----:----|----:----|----:----|----:----|----:----|----:----| V N M * W S K W L F T V S R R A L S S F S M * E G P S G C S P * R G A L W A A S C E N V L V E V L L D G V Q S G P Q Q V Hin6I |GlaI ||HhaI BssKI |||AciI SexAI |||BisI EcoRII |||HaeII | ScrFI ||||BlsI | BseBI |||||TauI | |SetI |||||FnuDII* | || Csp6I |||||| FokI | || |RsaI EcoRV |||||| | BsiYI* BseGI \ \\ \\ \ \\\\\\ \ \ \ AGAACCACGCAGACCTGGTACGATATCAACAAGGAGCGCCGCGATATGGATATAGTCATC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTGGTGCGTCTGGACCATGCTATAGTTGTTCCTCGCGGCGCTATACCTATATCAGTAG / / /// / //////// / / | | ||| EcoRV |||||||| FokI BseGI | | ||Csp6I |||||||BsiYI* | | |RsaI ||||||FnuDII* | | EcoRII ||||||AciI | | SexAI |||||BisI | | BssKI ||||BlsI | BseBI |||Hin6I | ScrFI |||TauI SetI ||GlaI |HhaI HaeII R T T Q T W Y D I N K E R R D M D I V I E P R R P G T I S T R S A A I W I * S S N H A D L V R Y Q Q G A P R Y G Y S H P ----:----|----:----|----:----|----:----|----:----|----:----| L V V C V Q Y S I L L S R R S I S I T M C F W A S R T R Y * C P A G R Y P Y L * S G R L G P V I D V L L A A I H I Y D D DdeI EspI* MaeII BdaI | AluI |BtrI BdaI | CviJI BslFI || SetI |BseMII | |HgaI | TspEI || TaiI BccI ||BspCNI | ||SetI \ \ \\ \ \ \\\ \ \\\ CCAGATGTCAATTACCACGTCCCCATCAAACTTGATAACAAGACGCTGAGCTGTATCACG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTACAGTTAATGGTGCAGGGGTAGTTTGAACTATTGTTCTGCGACTCGACATAGTGC / / / // / /// /// / | | | |MaeII | ||BspCNI ||CviJI HgaI | | | BtrI | |BseMII ||AluI | | TaiI | BdaI |EspI* | | SetI | BdaI |DdeI | TspEI BccI SetI BslFI P D V N Y H V P I K L D N K T L S C I T Q M S I T T S P S N L I T R R * A V S R R C Q L P R P H Q T * * Q D A E L Y H G ----:----|----:----|----:----|----:----|----:----|----:----| G S T L * W T G M L S S L L V S L Q I V G L H * N G R G W * V Q Y C S A S S Y * W I D I V V D G D F K I V L R Q A T D R CviJI BssKI | AlfI | MwoI | AlfI | HpaII | | MwoI | ScrFI | | |Cac8I | CauII* | | ||BdaI | | Cac8I | | ||BdaI AluI | | | AlfI | | |||Hin6I OliI | | | AlfI AsuI* | | ||||GlaI MslI | | | CviJI AvaII | | |||||TseI CviJI | | | | SduI DraII | | |||||HhaI PvuII | | | | SecI* PpuMI | | |||||MwoI NspBII* | | | | DsaI* |BmgT120I | | ||||||BisI | SetI | | | | HgiJII* || SetI | | |||||||BlsI | | BbvI | | | | |MnlI || | Cac8I \ \ \\\\\\\\ \ \ \ \ \ \ \ \\ \\ \ \ GGCTACGCCAGCGCAGCACAGCTGTGCTATCCCGGCGAGCCCGTGGCAGAGGACCTCGCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCGATGCGGTCGCGTCGTGTCGACACGATAGGGCCGCTCGGGCACCGTCTCCTGGAGCGA // / ///////// / / / /// / / / / /// / || | ||||||||| | NspBII* | ||| | | | DsaI* ||PpuMI Cac8I || | ||||||||| | PvuII | ||| | | | SecI* ||DraII || | ||||||||| | CviJI | ||| | | MnlI ||AvaII || | ||||||||| | MslI | ||| | CviJI ||AsuI* || | ||||||||| | OliI | ||| HgiJII* |BmgT120I || | ||||||||| | AluI | ||| Cac8I SetI || | ||||||||| SetI | ||| AlfI || | ||||||||TseI | ||| AlfI || | |||||||BisI | ||| SduI || | ||||||BlsI | ||BssKI || | |||||Hin6I | |HpaII || | ||||GlaI | CauII* || | |||HhaI | ScrFI || | ||MwoI BbvI || | |Cac8I MwoI || | BdaI || | BdaI || MwoI |AlfI |AlfI CviJI G Y A S A A Q L C Y P G E P V A E D L A A T P A Q H S C A I P A S P W Q R T S L L R Q R S T A V L S R R A R G R G P R L ----:----|----:----|----:----|----:----|----:----|----:----| P * A L A A C S H * G P S G T A S S R A P S R W R L V A T S D R R A R P L P G R A V G A C C L Q A I G A L G H C L V E S CviJI | BssKI TaqI | | HpaII | Csp6I | | ScrFI | |RsaI | | CauII* | ||SfaNI | | | BstXI AsuI* | |||AciI | | | | Hpy166II AvaII MnlI | |||| SfeI* | | | | | TaqI Hpy166II \ \ \\\\ \ \ \ \ \ \ \ \ TGCGAAAGCATCGAGTACCGCTACAGAGCCAACCCGGTGGACAAACTCGAAGTCATTGTG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ACGCTTTCGTAGCTCATGGCGATGTCTCGGTTGGGCCACCTGTTTGAGCTTCAGTAACAC / / // // / / / /// / / / MnlI | || || | | | ||| Hpy166II TaqI Hpy166II | || || | | | ||BssKI | || || | | | |HpaII | || || | | | CauII* | || || | | | ScrFI | || || | | BstXI | || || | CviJI | || || SfeI* | || |SfaNI | || AciI | |Csp6I | RsaI TaqI C E S I E Y R Y R A N P V D K L E V I V A K A S S T A T E P T R W T N S K S L W R K H R V P L Q S Q P G G Q T R S H C G ----:----|----:----|----:----|----:----|----:----|----:----| Q S L M S Y R * L A L G T S L S S T M T K R F C R T G S C L W G P P C V R L * Q A F A D L V A V S G V R H V F E F D N H StuI CviJI HaeIII | MnlI | Cac8I | | Hin6I Hin4II* | | |GlaI BmgT120I CviJI | TaqI | | |MstI* |MnlI | TaqII | SetI | | ||HhaI SspI \\ \ \ \ \ \ \ \\\ \ GACCGAATGAGGCTCAATAACGAGATTAGCGACCTCGAAGGCCTGCGCAAATATTTCCAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGCTTACTCCGAGTTATTGCTCTAATCGCTGGAGCTTCCGGACGCGTTTATAAAGGTG /// / / // / /// /// / ||AvaII | TaqII |SetI | ||| ||| SspI ||AsuI* CviJI | | ||| ||Hin6I |BmgT120I | | ||| |MstI* MnlI | | ||| |GlaI | | ||| HhaI | | ||Cac8I | | |MnlI | | HaeIII | | CviJI | | StuI | TaqI Hin4II* D R M R L N N E I S D L E G L R K Y F H T E * G S I T R L A T S K A C A N I S T P N E A Q * R D * R P R R P A Q I F P L ----:----|----:----|----:----|----:----|----:----|----:----| S R I L S L L S I L S R S P R R L Y K W P G F S A * Y R S * R G R L G A C I N G V S H P E I V L N A V E F A Q A F I E V BssKI |AvaI |BssKI |SecI* |Cfr9I ||HpaII ||ScrFI ||CauII* ||BmeT110I |||SmaI |||ScrFI |||BseMII AciI |||CauII* |BsmAI ||||BspCNI || MlyI ||||| Hin4II* || PleI ||||| | SduI || DdeI ||||| | HgiAI* || | FauI ||||| | |Hpy178III* || | | HinfI ||||| | ||DdeI || | | | Hpy188I Hpy99I \\\\\ \ \\\ \\ \ \ \ \ \ TCCTTCCCGGGTGCTCCTGAGTTGAACCCGCTTAGAGACTCCGAAATCAACGACGACTTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAAGGGCCCACGAGGACTCAACTTGGGCGAATCTCTGAGGCTTTAGTTGCTGCTGAAG ////// / / ///// / // / |||||| | DdeI ||||| | |Hpy188I Hpy99I |||||| Hpy178III* ||||| | HinfI |||||Hin4II* ||||| FauI |||||HgiAI* ||||DdeI |||||BssKI |||BsmAI |||||SduI ||PleI ||||Cfr9I |MlyI ||||BssKI AciI ||||SecI* ||||AvaI |||BmeT110I |||CauII* |||HpaII |||ScrFI ||CauII* ||ScrFI ||SmaI |BspCNI BseMII S F P G A P E L N P L R D S E I N D D F P S R V L L S * T R L E T P K S T T T S L P G C S * V E P A * R L R N Q R R L P ----:----|----:----|----:----|----:----|----:----|----:----| E K G P A G S N F G S L S E S I L S S K S R G P H E Q T S G A * L S R F * R R S G E R T S R L Q V R K S V G F D V V V E BsrI | BfiI | BsiYI* | | AsuI* | | Bsp120I | | |AsuI* | | |BmgT120I | | ||CviJI | | ||NlaIV | | ||TspRI | | ||HaeIII | | ||BmgT120I | | ||| BsrI | | ||| ApaI | | ||| SduI | | ||| BseSI | | ||| HgiJII* \ \ \\\ \ CACCAGTGGGCCCAGTGA 1210 ----:----|----:--- GTGGTCACCCGGGTCACT / / / / /// | | | | ||Bsp120I | | | | ||AsuI* | | | | |BmgT120I | | | | |AsuI* | | | | BmgT120I | | | | HaeIII | | | | NlaIV | | | | CviJI | | | | BsrI | | | HgiJII* | | | BseSI | | | SduI | | | ApaI | | BfiI | BsiYI* TspRI BsrI H Q W A Q * T S G P S X P V G P V X ----:----|----:--- W W H A W H G G T P G T V L P G L S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 6 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AlfI 2 AluI 7 AluBI ApaI 1 ApoI 1 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 3 BseXI,BstV1I,Lsp1109I BccI 3 BclI 1 FbaI,Ksp22I BdaI 4 BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmeT110I 1 BmgT120I 5 BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BseRI 3 BseSI 1 BaeGI,BstSLI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp120I 1 PspOMI BspCNI 2 BspMI 2 BfuAI,Acc36I,BveI BsrI 4 BseNI,Bse1I,BsrSI BssKI 12 BstSCI,StyD4I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 2 BstXI 2 BtrI 1 BmgBI,AjiI Cac8I 6 BstC8I CauII* 6 BcnI,BpuMI,NciI,AsuC2I Cfr9I 1 TspMI,XmaCI,XmaI CfrI 1 AcoI,EaeI Csp6I 5 CviQI,RsaNI CviAII 1 CviJI 18 CviKI-1 CviRI* 4 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 2 MalI DraII 2 EcoO109I DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRII 6 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 1 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 7 HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 4 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 7 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 6 HpyAV Hin6I 7 HinP1I,HspAI HinfI 4 HpaII 6 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 2 Hpy99I 3 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeII 1 HpyCH4IV MaeIII 4 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 3 MunI MlyI 3 SchI MnlI 16 MslI 3 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 9 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I OliI 1 AleI PleI 3 PpsI PpiI 1 PpuMI 2 Psp5II,PspPPI PstI 1 PvuII 1 RsaI 5 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 12 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 16 SexAI 1 MabI SfaNI 3 LweI SfeI* 2 BstSFI,SfcI,BfmI SmaI 1 SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI TaiI 1 TaqI 6 TaqII 1 TatI 1 TauI 2 TfiI 1 PfeI TseI 3 ApeKI Tsp45I 4 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 7 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 2 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflII AflIII AgeI AhaIII* AjuI AloI AlwNI ApaLI AscI Asp718I AsuII AvrII BaeI BamHI BarI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BetI* BglI BglII BmtI BplI Bpu10I BsaAI BsePI BseYI BsgI BsiI* BsmI Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstZ17I BtgZI BtsI Cfr10I ClaI CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EgeI EheI FalI FseI FspAI GsaI GsuI HgiCI* HindII HindIII HpaI KasI KpnI MaeI MauBI McrI* MluI MmeI MroNI MseI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspI PacI PasI PflMI PfoI PmaCI PmeI PshAI PsiI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI SfiI SfoI SgfI SgrAI SgrDI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StyI SwaI TsoI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769