Restriction Map of MDM10/YAL010C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MDM10/YAL010C on chromosome I from coordinates 135665 to 134184.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.27729

EMBOSS_001 AsuI* AvaII |BmgT120I || TatI || |Csp6I || ||RsaI Hpy188I || ||ScaI | SduI Csp6I || ||| DdeI | HgiAI* |RsaI \\ \\\ \ \ \ \\ ATGCTACCCTATATGGACCAAGTACTAAGGGCATTTTATCAGAGCACCCATTGGAGTACG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGATGGGATATACCTGGTTCATGATTCCCGTAAAATAGTCTCGTGGGTAACCTCATGC // /// / / / /// || ||| DdeI | HgiAI* ||TaqII || ||TatI | SduI |Csp6I || |Csp6I Hpy188I RsaI || ScaI || RsaI |AvaII |AsuI* BmgT120I M L P Y M D Q V L R A F Y Q S T H W S T C Y P I W T K Y * G H F I R A P I G V R A T L Y G P S T K G I L S E H P L E Y A ----:----|----:----|----:----|----:----|----:----|----:----| X S G * I S W T S L A N * * L V W Q L V X A V R Y P G L V L P M K D S C G N S Y H * G I H V L Y * P C K I L A G M P T R CfrI TaqII | CviJI | MnlI | HaeIII Hpy188I | | AluI | | TaqI |ApoI DdeI | | CviJI | | |Hpy178III* |TspEI BbvCI | | | SetI | | || BceAI |EcoRI Bpu10I \ \ \ \ \ \ \\ \ \\ \ CAAAATAGCTACGAGGATATAACGGCCACATCGAGAACATTATTAGATTTCCGAATTCCC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTATCGATGCTCCTATATTGCCGGTGTAGCTCTTGTAATAATCTAAAGGCTTAAGGG // / / / // / / / || CviJI | CfrI || BceAI | EcoRI || AluI HaeIII |Hpy178III* | TspEI |SetI CviJI TaqI | ApoI MnlI Hpy188I Q N S Y E D I T A T S R T L L D F R I P K I A T R I * R P H R E H Y * I S E F P K * L R G Y N G H I E N I I R F P N S L ----:----|----:----|----:----|----:----|----:----|----:----| C F L * S S I V A V D L V N N S K R I G A F Y S R P Y L P W M S F M I L N G F E L I A V L I Y R G C R S C * * I E S N G MnlI | BspCNI | |SetI | |BseMII | ||CviRI* | ||| ApoI | ||| TspEI | ||| | AarI MmeI | ||| | BspMI |TspEI \ \\\ \ \ \\ TCAGCAATACACCTGCAAATTTCCAACAAATCTACTCCCAATACATTCAATTCTTTAGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCGTTATGTGGACGTTTAAAGGTTGTTTAGATGAGGGTTATGTAAGTTAAGAAATCTA / / /// / / / / / | | ||| | | BspMI MmeI TspEI | | ||| | | AarI | | ||| | TspEI | | ||| | ApoI | | ||| CviRI* | | ||BseMII | | |BspCNI | | SetI | MnlI Bpu10I BbvCI DdeI S A I H L Q I S N K S T P N T F N S L D Q Q Y T C K F P T N L L P I H S I L * I S N T P A N F Q Q I Y S Q Y I Q F F R F ----:----|----:----|----:----|----:----|----:----|----:----| E A I C R C I E L L D V G L V N L E K S R L L V G A F K W C I * E W Y M * N K L * C Y V Q L N G V F R S G I C E I R * I AloI | AsuI* | AvaII | |BmgT120I | ||PfoI | ||SetI Hpy188I | ||BssKI DdeI | CviRI* | ||EcoRII |Hpy188I | | MfeI | ||| ScrFI BseMII || SfaNI | | TspEI MnlI | ||| BseBI |BspCNI || | AloI | | | TspDTI \ \ \\\ \ \\ \\ \ \ \ \ \ \ TTTTCTACGAGGTCCAGGATAAATGGTTCTCTGAGTTATTTATACTCCGATGCACAGCAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGATGCTCCAGGTCCTATTTACCAAGAGACTCAATAAATATGAGGCTACGTGTCGTT / / / // / / // / / / / / / / | AloI | || | | |BspCNI | | AloI | | | TspDTI MnlI | || | | BseMII | DdeI | | CviRI* | || | EcoRII Hpy188I | Hpy188I | || | BssKI SfaNI | || | PfoI | || BseBI | || ScrFI | |AvaII | |AsuI* | BmgT120I SetI F S T R S R I N G S L S Y L Y S D A Q Q F L R G P G * M V L * V I Y T P M H S N F Y E V Q D K W F S E L F I L R C T A I ----:----|----:----|----:----|----:----|----:----|----:----| K E V L D L I F P E R L * K Y E S A C C N K * S T W S L H N E S N N I S R H V A K R R P G P Y I T R Q T I * V G I C L L ApoI TspEI | FatI | |CviAII | || Hin6I | || NlaIII | || |GlaI | || |MstI* EcoRV | || ||HhaI | SfaNI \ \\ \\\ \ \ TTGGAGAAATTCATGCGCAACTCTACTGATATCCCATTACAAGATGCCACCGAAACATAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTCTTTAAGTACGCGTTGAGATGACTATAGGGTAATGTTCTACGGTGGCTTTGTATG / / //// / / TspEI | |||Hin6I EcoRV SfaNI MfeI | ||MstI* | ||GlaI | |FatI | |HhaI | CviAII NlaIII TspEI ApoI L E K F M R N S T D I P L Q D A T E T Y W R N S C A T L L I S H Y K M P P K H T G E I H A Q L Y * Y P I T R C H R N I Q ----:----|----:----|----:----|----:----|----:----|----:----| N S F N M R L E V S I G N C S A V S V Y I P S I * A C S * Q Y G M V L H W R F M Q L F E H A V R S I D W * L I G G F C V MfeI MaeII TspEI SetI | SetI MaeIII | CviRI* |TspEI MnlI TspRI | TaiI Tsp45I \ \ \\ \ \ \ \ \ AGACAATTGCAACCAAACCTCAATTTCAGTGTTAGTAGTGCGAATACGTTGAGTAGTGAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTAACGTTGGTTTGGAGTTAAAGTCACAATCATCACGCTTATGCAACTCATCACTG // / // / / / / |CviRI* SetI || MnlI | MaeII Tsp45I TspEI |TspEI TaiI MaeIII MfeI TspRI SetI R Q L Q P N L N F S V S S A N T L S S D D N C N Q T S I S V L V V R I R * V V T T I A T K P Q F Q C * * C E Y V E * * Q ----:----|----:----|----:----|----:----|----:----|----:----| L C N C G F R L K L T L L A F V N L L S C V I A V L G * N * H * Y H S Y T S Y H S L Q L W V E I E T N T T R I R Q T T V MlyI PleI | FatI Tsp4CI* | |CviAII |SalI | || HinfI ||TaqI | || NlaIII ||AccI | || | TaqI |||HindII | || | | ApoI |||Hpy166II TspEI | || | | TspEI MseI \\\\ \ \ \\ \ \ \ \ AACACCACAGTCGACAATGACAAGAAATTACTACATGACTCGAAATTTGTTAAAAAATCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGGTGTCAGCTGTTACTGTTCTTTAATGATGTACTGAGCTTTAAACAATTTTTTAGG / /// / /// // / / / / | ||SalI | ||| || | TaqI | MseI | |AccI | ||| || HinfI TspEI | |TaqI | ||| |FatI ApoI | Hpy166II | ||| CviAII | HindII | ||NlaIII Tsp4CI* | |PleI | MlyI TspEI N T T V D N D K K L L H D S K F V K K S T P Q S T M T R N Y Y M T R N L L K N P H H S R Q * Q E I T T * L E I C * K I P ----:----|----:----|----:----|----:----|----:----|----:----| L V V T S L S L F N S C S E F N T L F D C C W L R C H C S I V V H S S I Q * F I V G C D V I V L F * * M V R F K N F F G BseYI | AluI | GsaI TatI | CviJI |Csp6I | | SetI ||RsaI | | | Hpy188I BsrDI \\\ \ \ \ \ \ CTTTATTATGGTAGAATGTACTACCCCAGCTCTGATTTAGAAGCAATGATAATAAAACGA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GAAATAATACCATCTTACATGATGGGGTCGAGACTAAATCTTCGTTACTATTATTTTGCT /// / / / / / ||| | | | Hpy188I BsrDI ||| | | BseYI ||| | | CviJI ||| | | AluI ||| | SetI ||| GsaI ||TatI |Csp6I RsaI L Y Y G R M Y Y P S S D L E A M I I K R F I M V E C T T P A L I * K Q * * * N D L L W * N V L P Q L * F R S N D N K T T ----:----|----:----|----:----|----:----|----:----|----:----| R * * P L I Y * G L E S K S A I I I F R G K N H Y F T S G W S Q N L L L S L L V K I I T S H V V G A R I * F C H Y Y F S HindIII | AluI | CviJI | | MseI DdeI SmlI | | SetI |Tth111I AflII | | | AclI || Hpy166II TspEI |MseI | | | MaeII \\ \ \ \\ \ \ \ \ CTAAGTCCACAAACCCAATTTATGCTTAAGGGTGTCAGTAGTTTCAAAGAAAGCTTAAAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCAGGTGTTTGGGTTAAATACGAATTCCCACAGTCATCAAAGTTTCTTTCGAATTTG // / / // / / / // || Hpy166II TspEI |AflII | | | |TaiI |DdeI |SmlI | | | |SetI Tth111I MseI | | | MseI | | HindIII | CviJI | AluI SetI L S P Q T Q F M L K G V S S F K E S L N * V H K P N L C L R V S V V S K K A * T K S T N P I Y A * G C Q * F Q R K L K R ----:----|----:----|----:----|----:----|----:----|----:----| S L G C V W N I S L P T L L K L S L K F V L D V F G I * A * P H * Y N * L F S L * T W L G L K H K L T D T T E F F A * V SetI TaiI | MseI | | MaeII HphI | | | SetI | TfiI AciI | | | TaiI | HinfI | TspEI \ \ \ \ \ \ \ \ GTTTTAACGTGCTATTTTCAAAGAGATTCTCACCGCAATTTACAGGAGTGGATATTTTCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAATTGCACGATAAAAGTTTCTCTAAGAGTGGCGTTAAATGTCCTCACCTATAAAAGG / / / / / / / / | | MaeII HphI HinfI AciI TspEI TspRI | MseI TfiI BsrI | TaiI | SetI MaeII AclI V L T C Y F Q R D S H R N L Q E W I F S F * R A I F K E I L T A I Y R S G Y F P F N V L F S K R F S P Q F T G V D I F H ----:----|----:----|----:----|----:----|----:----|----:----| T K V H * K * L S E * R L K C S H I N E R K L T S N E F L N E G C N V P T S I K N * R A I K L S I R V A I * L L P Y K G BsrI | MboI | | TsoI | | DpnI | | |TspRI | | |BstKTI TspEI \ \ \\ \ ACCAGTGATCTATTATGTGGTTATAGAGTATTACACAATTTCCTTACCACGCCTTCCAAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTCACTAGATAATACACCAATATCTCATAATGTGTTAAAGGAATGGTGCGGAAGGTTC /// / / ||| MboI TspEI ||DpnI |BstKTI TsoI T S D L L C G Y R V L H N F L T T P S K P V I Y Y V V I E Y Y T I S L P R L P S Q * S I M W L * S I T Q F P Y H A F Q V ----:----|----:----|----:----|----:----|----:----|----:----| V L S R N H P * L T N C L K R V V G E L W W H D I I H N Y L I V C N G * W A K W G T I * * T T I S Y * V I E K G R R G L SetI | TatI | Tsp4CI* | Bsp1407I | |Csp6I | ||RsaI | |||MboII | |||TspRI TsoI MseI | ||||MnlI | ApoI Hin4II* | ||||| TspEI | TspEI \ \ \\\\\ \ \ \ TTTAACACCTCACTGTACAATAATTCTTCGTTGTCGCTTGGTGCTGAATTTTGGTTAGGG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTGTGGAGTGACATGTTATTAAGAAGCAACAGCGAACCACGACTTAAAACCAATCCC / / / / / /// / / / | | | | | ||| TspEI TsoI TspEI | | | | | ||Bsp1407I ApoI | | | | | ||TatI | | | | | |Csp6I | | | | | |MnlI | | | | | MboII | | | | | RsaI | | | | Tsp4CI* | | | TspRI | | SetI | MseI Hin4II* F N T S L Y N N S S L S L G A E F W L G L T P H C T I I L R C R L V L N F G * G * H L T V Q * F F V V A W C * I L V R V ----:----|----:----|----:----|----:----|----:----|----:----| N L V E S Y L L E E N D S P A S N Q N P T * C R V T C Y N K T T A Q H Q I K T L K V G * Q V I I R R Q R K T S F K P * P MseI | CviJI | |BssKI | |SecI* | || HpaII | || ScrFI | || CauII* TaqI MseI CspCI \ \\ \ \ \ \ TTAGTAAGTTTAAGCCCCGGTTGTTCGACAACTTTAAGATATTACACACATTCTACAAAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AATCATTCAAATTCGGGGCCAACAAGCTGTTGAAATTCTATAATGTGTGTAAGATGTTTG / / /// / / / | | ||BssKI TaqI MseI CspCI | | |SecI* | | |HpaII | | CauII* | | ScrFI | CviJI MseI L V S L S P G C S T T L R Y Y T H S T N * * V * A P V V R Q L * D I T H I L Q T S K F K P R L F D N F K I L H T F Y K H ----:----|----:----|----:----|----:----|----:----|----:----| N T L K L G P Q E V V K L Y * V C E V F T L L N L G R N N S L K L I N C V N * L * Y T * A G T T R C S * S I V C M R C V BsiYI* TfiI | CfrI HinfI | | CviJI |CspCI | | HaeIII \\ \ \ \ ACAGGACGACCACTAACTTTGACATTATCTTGGAATCCATTATTCGGCCATATATCCTCC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCCTGCTGGTGATTGAAACTGTAATAGAACCTTAGGTAATAAGCCGGTATATAGGAGG / / / / / | | BsiYI* | CfrI | HinfI HaeIII | TfiI CviJI CspCI T G R P L T L T L S W N P L F G H I S S Q D D H * L * H Y L G I H Y S A I Y P P R T T T N F D I I L E S I I R P Y I L H ----:----|----:----|----:----|----:----|----:----|----:----| V P R G S V K V N D Q F G N N P W I D E C L V V V L K S M I K S D M I R G Y I R C S S W * S Q C * R P I W * E A M Y G G BslFI MnlI | Hin6I | CfrI | |GlaI | | CviJI ApoI | ||HhaI MseI | | HaeIII BsiYI* TspEI | ||FnuDII* BsaBI \ \ \ \ \ \ \\\ \ ACATATTCGGCCAAGACAGGGACAAATTCTACTTTTTGCGCGAAGTATGATTTTAATCTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATAAGCCGGTTCTGTCCCTGTTTAAGATGAAAAACGCGCTTCATACTAAAATTAGAA / / / / / //// / / MnlI | | BsiYI* TspEI |||FnuDII* | MseI | CfrI ApoI |||Hin6I BsaBI HaeIII ||GlaI CviJI |HhaI BslFI T Y S A K T G T N S T F C A K Y D F N L H I R P R Q G Q I L L F A R S M I L I F I F G Q D R D K F Y F L R E V * F * S L ----:----|----:----|----:----|----:----|----:----|----:----| V Y E A L V P V F E V K Q A F Y S K L R W M N P W S L S L N * K K R S T H N * D C I R G L C P C I R S K A R L I I K I K TfiI HinfI MwoI |TspDTI ApoI BstAPI TaqI || TaqII MslI TspEI MwoI | SfaNI \ \\ \ \ \ \ \ \ TATTCGATTGAATCAAATCTTTCATTTGGGTGCGAATTTTGGCAAAAAAAGCATCATTTG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGCTAACTTAGTTTAGAAAGTAAACCCACGCTTAAAACCGTTTTTTTCGTAGTAAAC / / / / / / / / | | | TaqII MslI TspEI MwoI BstAPI | | HinfI ApoI MwoI | | TfiI | TspDTI TaqI Y S I E S N L S F G C E F W Q K K H H L I R L N Q I F H L G A N F G K K S I I C F D * I K S F I W V R I L A K K A S F A ----:----|----:----|----:----|----:----|----:----|----:----| * E I S D F R E N P H S N Q C F F C * K K N S Q I L D K M Q T R I K A F F A D N I R N F * I K * K P A F K P L F L M M Q Hpy188I | TspEI TspEI | Hpy99I \ \ \ CTTGAAACCAATAAAAACAATAATGATAAATTAGAACCAATCTCCGACGAATTGGTTGAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTTGGTTATTTTTGTTATTACTATTTAATCTTGGTTAGAGGCTGCTTAACCAACTA / / / / SfaNI TspEI Hpy188I TspEI Hpy99I L E T N K N N N D K L E P I S D E L V D L K P I K T I M I N * N Q S P T N W L I * N Q * K Q * * * I R T N L R R I G * Y ----:----|----:----|----:----|----:----|----:----|----:----| S S V L L F L L S L N S G I E S S N T S A Q F W Y F C Y H Y I L V L R R R I P Q K F G I F V I I I F * F W D G V F Q N I CviRI* | MslI | | EcoP15I | | |Csp6I | | ||RsaI | | |||BetI* | | ||||HpaII | | ||||| MboI | | ||||| XhoII | | ||||| | DpnI | | ||||| | |BstKTI | | ||||| | || Hpy188I | | ||||| | || |ApoI | | ||||| | || |TspEI | | ||||| | || |EcoRI BsaBI MmeI BsgI | | ||||| | || || BinI* \ \ \ \ \ \\\\\ \ \\ \\ \ ATAAATCCAAACAGCAGAGCGACTAAACTACTGCACGAAAATGTACCGGATCTGAATTCA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTAGGTTTGTCGTCTCGCTGATTTGATGACGTGCTTTTACATGGCCTAGACTTAAGT / / / / / // /// / /// | MmeI BsgI | MslI || ||| | ||SetI BsaBI CviRI* || ||| | |EcoRI || ||| | |TspEI || ||| | |ApoI || ||| | BinI* || ||| Hpy188I || ||| XhoII || ||| MboI || ||DpnI || |BstKTI || |BetI* || HpaII |Csp6I EcoP15I RsaI I N P N S R A T K L L H E N V P D L N S * I Q T A E R L N Y C T K M Y R I * I Q K S K Q Q S D * T T A R K C T G S E F S ----:----|----:----|----:----|----:----|----:----|----:----| I F G F L L A V L S S C S F T G S R F E Y L D L C C L S * V V A R F H V P D S N Y I W V A S R S F * Q V F I Y R I Q I * AluI CviJI PvuII NspBII* | SetI | | MseI AluI | | |HpaI CviJI | | |HindII MaeI SetI | SetI | | |Hpy166II |Hin4II* | Hpy166II | | MseI \ \ \\ \\ \ \ \ \ \ GCTGTTAACGATATTCCTTCTACACTAGATATACCTGTTCACAAACAAAAGCTATTAAAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CGACAATTGCTATAAGGAAGATGTGATCTATATGGACAAGTGTTTGTTTTCGATAATTTA / // / / / / / / / / | |MseI | MaeI SetI Hpy166II | CviJI | BcgI | Hpy166II Hin4II* | AluI MseI | HindII SetI | HpaI NspBII* PvuII CviJI AluI A V N D I P S T L D I P V H K Q K L L N L L T I F L L H * I Y L F T N K S Y * M C * R Y S F Y T R Y T C S Q T K A I K * ----:----|----:----|----:----|----:----|----:----|----:----| A T L S I G E V S S I G T * L C F S N F L Q * R Y E K * V L Y V Q E C V F A I L S N V I N R R C * I Y R N V F L L * * I MboI BglII XhoII BcgI | DpnI | TaqI | |BstKTI BsmI | ClaI | || MboII BcgI CviRI* Hpy99I | | Hin4I | || |TspDTI | MseI | EcoT22I | MseI | | Hin4I | || || TaqI \ \ \ \ \ \ \ \ \ \ \\ \\ \ GATTTAACTTATGCATTCTCGTCGTCATTAAGAAAAATCGATGAAGAAAGATCTACCATC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATTGAATACGTAAGAGCAGCAGTAATTCTTTTTAGCTACTTCTTTCTAGATGGTAG / / / / / / / / // // MseI | | Hpy99I | | | ClaI || |TspDTI | CviRI* | | | TaqI || |MboII EcoT22I | | Hin4I || XhoII BsmI | | Hin4I || BglII | BcgI || MboI MseI |DpnI BstKTI D L T Y A F S S S L R K I D E E R S T I I * L M H S R R H * E K S M K K D L P S F N L C I L V V I K K N R * R K I Y H R ----:----|----:----|----:----|----:----|----:----|----:----| S K V * A N E D D N L F I S S S L D V M H N L K H M R T T M L F F R H L F I * W I * S I C E R R * * S F D I F F S R G D PflMI BsiYI* ApoI |TspRI BccI Hin4I || TspEI MaeII TspEI Hin4I BsrI || | MseI |BtrI \ \ \ \\ \ \ \\ GAAAAATTTGATAACAAAATAAATAGTTCCATTTTTACCAGTGTTTGGAAATTAAGCACG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTAAACTATTGTTTTATTTATCAAGGTAAAAATGGTCACAAACCTTTAATTCGTGC / / / / / // / // | | Hin4I | BsiYI* || | |MaeII | | Hin4I | PflMI || | BtrI | | TspEI TspRI || TaiI | | ApoI BsrI || SetI | BccI |MseI TaqI TspEI E K F D N K I N S S I F T S V W K L S T K N L I T K * I V P F L P V F G N * A R K I * * Q N K * F H F Y Q C L E I K H V ----:----|----:----|----:----|----:----|----:----|----:----| S F N S L L I F L E M K V L T Q F N L V R F I Q Y C F L Y N W K * W H K S I L C F F K I V F Y I T G N K G T N P F * A R MaeII |BsaAI |MaeIII |Tsp45I SetI || SetI MseI TaiI || TaiI |AhaIII* Hin4II* MnlI MseI \ \\ \ \\ \ \ \ TCATTACGTGACAAGACTTTAAAACTATTATGGGAAGGCAAATGGAGGGGATTTTTAATA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAATGCACTGTTCTGAAATTTTGATAATACCCTTCCGTTTACCTCCCCTAAAAATTAT / // / // / / / | || Tsp45I |MseI Hin4II* MnlI MseI | || MaeIII AhaIII* | |MaeII | BsaAI TaiI SetI S L R D K T L K L L W E G K W R G F L I H Y V T R L * N Y Y G K A N G G D F * Y I T * Q D F K T I M G R Q M E G I F N I ----:----|----:----|----:----|----:----|----:----|----:----| D N R S L V K F S N H S P L H L P N K I T M V H C S K L V I I P L C I S P I K L * * T V L S * F * * P F A F P P S K * Y AluI CviJI BssKI | SetI |HpaII | | BslFI ||ScrFI | | |MnlI CviJI ||CauII* | | || MaeI | Hpy178III* Hpy188I \\\ \ \ \\ \ \ \ \ TCTGCCGGGACAGAGCTGGTATTCACTAGAGGCTTTCAAGAAAGTTTATCCGATGATGAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGGCCCTGTCTCGACCATAAGTGATCTCCGAAAGTTCTTTCAAATAGGCTACTACTT / / / / / / / / / / | | | CviJI | | | CviJI Hpy178III* Hpy188I | | | AluI | | MaeI | | SetI | BslFI | BssKI MnlI CauII* HpaII ScrFI S A G T E L V F T R G F Q E S L S D D E L P G Q S W Y S L E A F K K V Y P M M K C R D R A G I H * R L S R K F I R * * K ----:----|----:----|----:----|----:----|----:----|----:----| D A P V S S T N V L P K * S L K D S S S I Q R S L A P I * * L S E L F N I R H H R G P C L Q Y E S S A K L F T * G I I F TspDTI | CviRI* AlwNI BsrI BceAI \ \ \ \ \ AAGAATGATAATGCAATATCTATATCAGCAACTGATACAGAAAACGGCAATATACCAGTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTACTATTACGTTATAGATATAGTCGTTGACTATGTCTTTTGCCGTTATATGGTCAA / / / / | CviRI* AlwNI BsrI TspDTI K N D N A I S I S A T D T E N G N I P V R M I M Q Y L Y Q Q L I Q K T A I Y Q F E * * C N I Y I S N * Y R K R Q Y T S F ----:----|----:----|----:----|----:----|----:----|----:----| F F S L A I D I D A V S V S F P L I G T F S H Y H L I * I L L Q Y L F R C Y V L L I I I C Y R Y * C S I C F V A I Y W N TspEI | BsrI BssKI | | TatI | HpaII | | |Csp6I FatI | ScrFI | | ||RsaI |CviAII | CauII* | | ||ScaI || NlaIII \ \ \ \ \\\ \\ \ TTCCCGGCAAAGTTTGGCATACAATTCCAGTACTCCACATGA 1450 1460 1470 1480 ----:----|----:----|----:----|----:----|-- AAGGGCCGTTTCAAACCGTATGTTAAGGTCATGAGGTGTACT / /// // /// / // | ||BssKI || ||| | |FatI | |HpaII || ||| | CviAII | CauII* || ||| NlaIII | ScrFI || ||TatI BceAI || |Csp6I || ScaI || RsaI |TspEI BsrI F P A K F G I Q F Q Y S T * S R Q S L A Y N S S T P H X P G K V W H T I P V L H M X ----:----|----:----|----:----|----:----|-- K G A F N P M C N W Y E V H K G P L T Q C V I G T S W M E R C L K A Y L E L V G C S # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AclI 1 Psp1406I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 1 DraI AloI 1 AluI 6 AluBI AlwNI 1 CaiI ApoI 9 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvCI 1 BccI 1 BceAI 2 BcgI 1 BetI* 1 BsaWI BglII 1 BinI* 1 AlwI,BspPI,AclWI BmgT120I 2 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseMII 2 BseYI 1 BsgI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 1 BstKTI 3 BtrI 1 BmgBI,AjiI CauII* 3 BcnI,BpuMI,NciI,AsuC2I CfrI 3 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CspCI 1 CviAII 3 CviJI 11 CviKI-1 CviRI* 6 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 3 MalI EcoP15I 1 EcoRI 2 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 3 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 2 GsaI 1 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 3 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 4 HpaI 1 KspAI HpaII 4 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 8 Hpy99I 2 MaeI 2 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 2 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MfeI 2 MunI MlyI 1 SchI MmeI 2 MnlI 8 MseI 15 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 2 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 1 PpsI PvuII 1 RsaI 6 AfaI SalI 1 ScaI 2 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 16 SfaNI 3 LweI SmlI 1 SmoI TaiI 5 TaqI 7 TaqII 2 TatI 4 TfiI 3 PfeI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 22 TasI,Tsp509I,Sse9I TspRI 4 TscAI Tth111I 1 PflFI,PsyI,AspI XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AcyI AflIII AgeI AjuI AlfI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvI BbvII* Bce83I* BciVI BclI BdaI BfiI BglI BisI BlsI BmeT110I BmtI BplI BsaXI BseGI BsePI BseRI BseSI BsiI* BsmAI Bsp120I BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstF5I BstXI BstZ17I BtgZI BtsCI BtsI Cac8I Cfr10I Cfr9I DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EgeI EheI Esp3I EspI* FalI FauI Fnu4HI FokI FseI FspAI GsuI HaeII HgaI HgiCI* HgiJII* KasI KpnI Ksp632I* MauBI McrI* MluI MroNI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NspI OliI PacI PasI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SanDI SapI SauI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TauI TseI TspGWI TspMI TstI VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769