Restriction Map of REP1/R0020C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

REP1/R0020C on 2-micron plasmid from coordinates 3008 to 1887.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.13164

EMBOSS_001 BsrDI | TseI BbvI | CviRI* | SetI TspDTI | |BisI | PflMI BsmAI | Cac8I MseI | ||BlsI | BsiYI* \ \ \ \ \ \\\ \ \ ATGAATGGCGAGAGACTGCTTGCTTGTATTAAGCAATGTATTATGCAGCACTTCCAACCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTACCGCTCTCTGACGAACGAACATAATTCGTTACATAATACGTCGTGAAGGTTGGA / / / / / //// // | | Cac8I MseI BsrDI |||TseI |BsiYI* | TspDTI ||BisI |PflMI BsmAI |BlsI SetI CviRI* M N G E R L L A C I K Q C I M Q H F Q P * M A R D C L L V L S N V L C S T S N L E W R E T A C L Y * A M Y Y A A L P T Y ----:----|----:----|----:----|----:----|----:----|----:----| X F P S L S S A Q I L C H I I C C K W G X S H R S V A Q K Y * A I Y * A A S G V H I A L S Q K S T N L L T N H L V E L R MmeI | SetI | | Esp3I | | BsmAI | | |TspDTI | | || TaqI Csp6I | | || |FalI BslFI Hpy166II | | || |FalI |AlwNI |RsaI | | || |Hpy178III* BsrI |Hpy178III* \\ \ \ \\ \\ \ \\ ATGGTGTACGATGAAAGTAGGTGTGTAATCGAGACGACAAGGGGGACTTTTCCAGTTCCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TACCACATGCTACTTTCATCCACACATTAGCTCTGCTGTTCCCCCTGAAAAGGTCAAGGA / /// / / // / // / / / / BbvI ||Csp6I | SetI || | |Hpy178III* BsrI | | Hpy178III* |RsaI MmeI || | TaqI | FalI Hpy166II || BsmAI | FalI || Esp3I AlwNI |FalI |FalI TspDTI M V Y D E S R C V I E T T R G T F P V P W C T M K V G V * S R R Q G G L F Q F L G V R * K * V C N R D D K G D F S S S * ----:----|----:----|----:----|----:----|----:----|----:----| I T Y S S L L H T I S V V L P V K G T G * P T R H F Y T H L R S S L P S K E L E H H V I F T P T Y D L R C P P S K W N R FatI AflIII BspLU11I* |CviAII MmeI || TatI FalI |AclI || |NspI FalI |MaeII || |Csp6I |TspEI || SetI || |NlaIII || PsiI || TaiI CviRI* || ||RsaI \\ \ \\ \ \ \\ \\\ GACAATTATAAGAAATACAAAACGTTAGCATTTGCATTTGTTGGACATGTACTGAATACA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTAATATTCTTTATGTTTTGCAATCGTAAACGTAAACAACCTGTACATGACTTATGT / // / / / / / ///// BslFI |PsiI | | MaeII CviRI* | ||||TatI TspEI | | AclI | |||Csp6I | TaiI | ||RsaI | SetI | |BspLU11I* MmeI | |AflIII | |FatI | CviAII NlaIII NspI D N Y K K Y K T L A F A F V G H V L N T T I I R N T K R * H L H L L D M Y * I Q Q L * E I Q N V S I C I C W T C T E Y R ----:----|----:----|----:----|----:----|----:----|----:----| S L * L F Y L V N A N A N T P C T S F V Q C N Y S I C F T L M Q M Q Q V H V S Y V I I L F V F R * C K C K N S M Y Q I C BsgI | BsrI | | BinI* | | | CviJI | | | HaeIII | | | | MboI | | | | | DpnI | | | | | |BstKTI | | | | | || CviRI* | | | | | || | SpeI | | | | | || | |MaeI AgeI | | | | | || | || TatI BetI* | | | | | || | || Bsp1407I Cfr10I | | | | | || | || |Csp6I |HpaII | | | | | || | || |Hpy166II || TspEI | | | | | || | || ||RsaI \\ \ \ \ \ \ \ \\ \ \\ \\\ GACGACACACCGGTAATTGAAAAAGAACTGGATTGGCCTGATCCTGCACTAGTGTACAAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGTGTGGCCATTAACTTTTTCTTGACCTAACCGGACTAGGACGTGATCACATGTTA // / / / // // / / // //// || TspEI | BsrI || || | | || |||Bsp1407I |Cfr10I BsgI || || | | || |||TatI |BetI* || || | | || ||Csp6I |AgeI || || | | || |RsaI HpaII || || | | || Hpy166II || || | | |SpeI || || | | MaeI || || | CviRI* || || MboI || |DpnI || BstKTI |HaeIII |CviJI BinI* D D T P V I E K E L D W P D P A L V Y N T T H R * L K K N W I G L I L H * C T I R H T G N * K R T G L A * S C T S V Q Y ----:----|----:----|----:----|----:----|----:----|----:----| S S V G T I S F S S S Q G S G A S T Y L L R C V P L Q F L V P N A Q D Q V L T C V V C R Y N F F F Q I P R I R C * H V I TaqI |MboI || DpnI || |TaqI || |PvuI || |McrI* || |BstKTI || || TfiI MfeI || || HinfI TaqII TspEI || || | HphI TspEI Tsp4CI* CviRI* \ \\ \\ \ \ \ \ \ ACAATTGTCGATCGAATCATAAATCACCCAGAATTATCACAGTTTATATCGGTTGCATTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTAACAGCTAGCTTAGTATTTAGTGGGTCTTAATAGTGTCAAATATAGCCAACGTAAA / // /// / / // / | || ||| HinfI | |Tsp4CI* CviRI* | || ||| TfiI | TaqII | || ||HphI TspEI | || |TaqI | || MboI | |DpnI | BstKTI | McrI* | TaqI | PvuI TspEI MfeI T I V D R I I N H P E L S Q F I S V A F Q L S I E S * I T Q N Y H S L Y R L H L N C R S N H K S P R I I T V Y I G C I Y ----:----|----:----|----:----|----:----|----:----|----:----| V I T S R I M F * G S N D C N I D T A N Y L Q R D F * L D G L I I V T * I P Q M C N D I S D Y I V W F * * L K Y R N C K CviJI HaeIII | MnlI | | Hpy188I MseI MseI | | | BccI VspI Cac8I \ \ \ \ \ \ \ ATTAGTCAGTTAAAGGCCACCATCGGAGAGGGTTTAGATATTAATGTAAAAGGCACGCTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAATCAGTCAATTTCCGGTGGTAGCCTCTCCCAAATCTATAATTACATTTTCCGTGCGAT / / / / / / / | | | | BccI VspI Cac8I | | | Hpy188I MseI | | MnlI | HaeIII | CviJI MseI I S Q L K A T I G E G L D I N V K G T L L V S * R P P S E R V * I L M * K A R * * S V K G H H R R G F R Y * C K R H A K ----:----|----:----|----:----|----:----|----:----|----:----| I L * N F A V M P S P K S I L T F P V S * * D T L P W W R L P N L Y * H L L C A N T L * L G G D S L T * I N I Y F A R * Hin4II* FatI | Hpy188I |CviAII | | StuI || NlaIII | | CviJI || |TfiI AciI | | HaeIII || |HinfI \ \ \ \ \\ \\ AACCGCAGGGGAAAGGGTATCAGAAGGCCTAAAGGCGTATTTTTTAGATACATGGAATCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGCGTCCCCTTTCCCATAGTCTTCCGGATTTCCGCATAAAAAATCTATGTACCTTAGA / / / / / // / AciI | | HaeIII | || HinfI | | CviJI | || TfiI | | StuI | |FatI | Hpy188I | CviAII Hin4II* NlaIII N R R G K G I R R P K G V F F R Y M E S T A G E R V S E G L K A Y F L D T W N L P Q G K G Y Q K A * R R I F * I H G I S ----:----|----:----|----:----|----:----|----:----|----:----| F R L P F P I L L G L P T N K L Y M S D L G C P F P Y * F A * L R I K * I C P I V A P S L T D S P R F A Y K K S V H F R MaeIII Tsp45I | BtsI | SetI | |MboII | || BsmI | || CviRI* TaqI | || | TspRI |Hpy178III* | || | | MboII || PsiI TspEI \ \\ \ \ \ \\ \ \ CCATTTGTCAATACAAAGGTCACTGCATTCTTCTCTTATCTTCGAGATTATAATAAAATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAAACAGTTATGTTTCCAGTGACGTAAGAAGAGAATAGAAGCTCTAATATTATTTTAA / / / / / / // / / | | | | | MboII || PsiI TspEI | | | | CviRI* |Hpy178III* | | | Tsp45I TaqI | | | MaeIII | | | BsmI | | MboII | TspRI | BtsI SetI P F V N T K V T A F F S Y L R D Y N K I H L S I Q R S L H S S L I F E I I I K L I C Q Y K G H C I L L L S S R L * * N C ----:----|----:----|----:----|----:----|----:----|----:----| G N T L V F T V A N K E * R R S * L L I E M Q * Y L P * Q M R R K D E L N Y Y F W K D I C L D S C E E R I K S I I I F N TspDTI DdeI | MaeII | Hpy188I | | SetI | | MnlI | | TaiI | | | BspCNI | | | FatI | | | |BseMII ApoI | | | |CviAII | | | ||TspDTI TspEI | | | || NlaIII MwoI \ \ \ \\\ \ \ \ \ \\ \ \ GCCTCAGAATATCACAATAATACTAAATTCATTCTCACGTTTTCATGTCAAGCATATTGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGTCTTATAGTGTTATTATGATTTAAGTAAGAGTGCAAAAGTACAGTTCGTATAACC // / /// // / / / // / |DdeI | ||TspDTI || | | | |FatI MwoI | | |BseMII || | | | CviAII | | BspCNI || | | NlaIII | MnlI || | MaeII Hpy188I || TaiI || SetI |TspDTI TspEI ApoI A S E Y H N N T K F I L T F S C Q A Y W P Q N I T I I L N S F S R F H V K H I G L R I S Q * Y * I H S H V F M S S I L G ----:----|----:----|----:----|----:----|----:----|----:----| A E S Y * L L V L N M R V N E H * A Y Q Q R L I D C Y Y * I * E * T K M D L M N G * F I V I I S F E N E R K * T L C I P MboII | SetI | TspDTI | | SduI | | HgiAI* AsuI* | | | TspEI |CviJI | | | | FatI |HaeIII | | | | BspHI |BmgT120I | | | | |CviAII ||EciI | | | | |Hpy178III* |||SfaNI AciI | | | | || NlaIII \\\\ \ \ \ \ \ \\ \ GCATCTGGCCCAAACTTCTCCGCCTTGAAGAATGTTATTAGGTGCTCCATAATTCATGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGACCGGGTTTGAAGAGGCGGAACTTCTTACAATAATCCACGAGGTATTAAGTACTT //// / / // // / // |||| SfaNI AciI || |HgiAI* | |BspHI |||AsuI* || |SduI | |FatI ||BmgT120I || TspDTI | Hpy178III* |HaeIII |SetI | CviAII |CviJI MboII NlaIII EciI TspEI A S G P N F S A L K N V I R C S I I H E H L A Q T S P P * R M L L G A P * F M N I W P K L L R L E E C Y * V L H N S * I ----:----|----:----|----:----|----:----|----:----|----:----| A D P G F K E A K F F T I L H E M I * S P M Q G L S R R R S S H * * T S W L E H C R A W V E G G Q L I N N P A G Y N M F MboI | DpnI | |BstKTI | ||Hpy178III* | ||| AluI DdeI | ||| CviJI | TspDTI SetI | ||| | SetI \ \ \ \ \\\ \ \ TACATTTCTAAGTTTGTGGAAAGAGAACAGGATAAAGGTCATATAGGAGATCAGGAGCTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTAAAGATTCAAACACCTTTCTCTTGTCCTATTTCCAGTATATCCTCTAGTCCTCGAT / / / // / // / | DdeI SetI || | || CviJI TspDTI || | || AluI || | |SetI || | Hpy178III* || MboI |DpnI BstKTI Y I S K F V E R E Q D K G H I G D Q E L T F L S L W K E N R I K V I * E I R S Y H F * V C G K R T G * R S Y R R S G A T ----:----|----:----|----:----|----:----|----:----|----:----| Y M E L N T S L S C S L P * I P S * S S I C K * T Q P F L V P Y L D Y L L D P A V N R L K H F S F L I F T M Y S I L L * AsuI* AvaII DraII PpuMI |BmgT120I ||NlaIV ||| MboII TatI ||| |BsiI* Bsp1407I ||| || Hpy178III* |Csp6I ||| || | Hpy166II ||RsaI AciI ||| || | |Eco57I ||| FatI MseI |Ksp632I* ||| || | |Hin4II* ||| |CviAII |TspDTI ||MnlI ||| || | |Eco57MI ||| || NlaIII ||SfaNI \\\ \\\ \\ \ \\ \\\ \\ \ \\\ CCGCCTGAAGAGGACCCTTCTCGTGAACTAAACAATGTACAACATGAAGTCAATAGTTTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGCGGACTTCTCCTGGGAAGAGCACTTGATTTGTTACATGTTGTACTTCAGTTATCAAAT // / // / // /// / // / / || Ksp632I* || MboII |Hpy166II ||| | |FatI | MseI |AciI |PpuMI |Hin4II* ||| | CviAII TspDTI MnlI |DraII Hpy178III* ||| NlaIII |AvaII Eco57MI ||Bsp1407I |AsuI* Eco57I ||TatI BmgT120I BsiI* |Csp6I NlaIV RsaI P P E E D P S R E L N N V Q H E V N S L R L K R T L L V N * T M Y N M K S I V * A * R G P F S * T K Q C T T * S Q * F N ----:----|----:----|----:----|----:----|----:----|----:----| G G S S S G E R S S F L T C C S T L L K V A Q L P G K E H V L C H V V H L * Y N R R F L V R R T F * V I Y L M F D I T * MnlI | AciI | | TspGWI FokI TfiI | | | AciI EciI HinfI | | | Hin4II* BseGI | TspDTI | HphI \ \ \ \ \ \ \ \ \ ACGGAACAAGATGCGGAGGCGGATGAAGGATTGTGGGGTGAAATAGATTCATTATGTGAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCTTGTTCTACGCCTCCGCCTACTTCCTAACACCCCACTTTATCTAAGTAATACACTT / / // / / / / / / // | MnlI || | | BseGI | | FokI |HinfI SfaNI || | AciI | TspDTI |TfiI || Hin4II* EciI HphI |AciI TspGWI T E Q D A E A D E G L W G E I D S L C E R N K M R R R M K D C G V K * I H Y V K G T R C G G G * R I V G * N R F I M * K ----:----|----:----|----:----|----:----|----:----|----:----| V S C S A S A S S P N H P S I S E N H S L P V L H P P P H L I T P H F L N M I H R F L I R L R I F S Q P T F Y I * * T F Hpy188I | AciI | | BseMII | | |MboI | | |BspCNI | | || DpnI | | || |MnlI | | || |BstKTI | | || || DdeI | | || || | MboII | | || || | |Eco57I | | || || | |Eco57MI CviJI | | || || | || AciI | EciI TspEI \ \ \\ \\ \ \\ \ \ \ \ AAATGGCAGTCTGAAGCGGAAGATCAAACTGAGGCGGAGATAATAGCCGACAGGATAATT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACCGTCAGACTTCGCCTTCTAGTTTGACTCCGCCTCTATTATCGGCTGTCCTATTAA / // // / / / / // / | || || MboI | | AciI |EciI TspEI | || |DpnI | DdeI CviJI | || |MnlI Eco57MI | || BstKTI Eco57I | |BspCNI MboII | BseMII | AciI Hpy188I K W Q S E A E D Q T E A E I I A D R I I N G S L K R K I K L R R R * * P T G * L M A V * S G R S N * G G D N S R Q D N W ----:----|----:----|----:----|----:----|----:----|----:----| F H C D S A S S * V S A S I I A S L I I F I A T Q L P L D F Q P P S L L R C S L F P L R F R F I L S L R L Y Y G V P Y N PflMI BsiYI* | BseGI | | TsoI | | | SetI | | | |FokI | | | || ApoI | | | || TspEI | | | || | MnlI MnlI | | | || | | Csp6I | CviJI | | | || | | Hpy99I | |BccI | | | || | | |RsaI \ \\ \ \ \ \\ \ \ \\ GGAAATAGCCAGAGGATGGCGAACCTCAAAATTCGTCGTACAAAGTTCAAAAGTGTCTTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTATCGGTCTCCTACCGCTTGGAGTTTTAAGCAGCATGTTTCAAGTTTTCACAGAAC / / / / / / / / / // | | | | | | SetI | | |Csp6I | | | | | TsoI | | RsaI | | | | BseGI | Hpy99I | | | BsiYI* | TspEI | | | PflMI | MnlI | | BccI | ApoI | CviJI FokI MnlI G N S Q R M A N L K I R R T K F K S V L E I A R G W R T S K F V V Q S S K V S C K * P E D G E P Q N S S Y K V Q K C L V ----:----|----:----|----:----|----:----|----:----|----:----| P F L W L I A F R L I R R V F N L L T K Q F Y G S S P S G * F E D Y L T * F H R S I A L P H R V E F N T T C L E F T D Q NlaIV | Tsp4CI* | | BspCNI XmnI | | |BseMII AciI TspEI DdeI | | || SetI FnuDII* \ \ \ \ \\ \ \ TATCATATACTAAAGGAACTAATTCAATCTCAGGGAACCGTAAAGGTTTATCGCGGTAGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGTATATGATTTCCTTGATTAAGTTAGAGTCCCTTGGCATTTCCAAATAGCGCCATCA / / / / / // / / / | TspEI | | | || SetI | AciI XmnI | | | |BseMII FnuDII* | | | BspCNI | | Tsp4CI* | NlaIV DdeI Y H I L K E L I Q S Q G T V K V Y R G S I I Y * R N * F N L R E P * R F I A V V S Y T K G T N S I S G N R K G L S R * * ----:----|----:----|----:----|----:----|----:----|----:----| Y * I S F S S I * D * P V T F T * R P L T D Y V L P V L E I E P F R L P K D R Y I M Y * L F * N L R L S G Y L N I A T T HindIII | AluI | CviJI | | SetI | | | SapI | | | Ksp632I* | | | | BceAI FalI | | | | | TseI FalI | | | | | FalI MboII TfiI | | | | | FalI |TspDTI HinfI | | | | | |BisI || BbvI | TaqI | | | | | ||BlsI || |CviJI \ \ \ \ \ \ \ \\\ \\ \\ AGTTTTTCACACGATTCGATAAAGATAAGCTTACATTATGAAGAGCAGCATATTACAGCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAAAAGTGTGCTAAGCTATTTCTATTCGAATGTAATACTTCTCGTCGTATAATGTCGG / / / / / / / / //// / / FalI | TaqI | | | | FalI |||| TspDTI CviJI FalI HinfI | | | | FalI |||| MboII TfiI | | | | |||TseI | | | | ||BisI | | | | |BlsI | | | | BceAI | | | Ksp632I* | | | SapI | | HindIII | CviJI | AluI SetI S F S H D S I K I S L H Y E E Q H I T A V F H T I R * R * A Y I M K S S I L Q P F F T R F D K D K L T L * R A A Y Y S R ----:----|----:----|----:----|----:----|----:----|----:----| L K E C S E I F I L K C * S S C C I V A Y N K V R N S L S L S V N H L A A Y * L T K * V I R Y L Y A * M I F L L M N C G Tsp4CI* | ApoI | TspEI MwoI SfaNI AccI | |SapI |MboII |TaqI |Hpy166II | |Ksp632I* || CviJI MnlI |SetI \\ \ \\ \\ \ \ \\ GTATGGGTCTACTTGACAGTAAAATTTGAAGAGCATTGGAAGCCTGTTGATGTAGAGGTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CATACCCAGATGAACTGTCATTTTAAACTTCTCGTAACCTTCGGACAACTACATCTCCAG / // / / / / / / / BbvI |AccI Tsp4CI* Ksp632I* | | | MnlI SetI Hpy166II TspEI | | CviJI ApoI | MboII SapI MwoI V W V Y L T V K F E E H W K P V D V E V Y G S T * Q * N L K S I G S L L M * R S M G L L D S K I * R A L E A C * C R G R ----:----|----:----|----:----|----:----|----:----|----:----| T H T * K V T F N S S C Q F G T S T S T R I P R S S L L I Q L A N S A Q Q H L P Y P D V Q C Y F K F L M P L R N I Y L D BccI CviRI* | SetI BseGI \ \ \ \ GAGTTTAGATGCAAGTTCAAGGAGCGAAAGGTGGATGGGTAG 1090 1100 1110 1120 ----:----|----:----|----:----|----:----|-- CTCAAATCTACGTTCAAGTTCCTCGCTTTCCACCTACCCATC // / // / |SfaNI CviRI* |BccI BseGI TaqI SetI E F R C K F K E R K V D G * S L D A S S R S E R W M G X V * M Q V Q G A K G G W V X ----:----|----:----|----:----|----:----|-- S N L H L N L S R F T S P Y R T * I C T * P A F P P H T L K S A L E L L S L H I P L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 8 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 2 AluBI AlwNI 1 CaiI ApoI 3 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BccI 3 BceAI 1 BetI* 1 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 BseGI 3 BstF5I,BtsCI BseMII 3 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 2 BsrGI,BstAUI BspCNI 3 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BstKTI 4 BtsI 1 Cac8I 2 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 5 CviQI,RsaNI CviAII 5 CviJI 10 CviKI-1 CviRI* 6 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 4 MalI DraII 1 EcoO109I EciI 3 Eco57I 2 AcuI Eco57MI 2 Esp3I 1 BsmBI FalI 4 FatI 5 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I Hin4II* 3 HpyAV HindIII 1 HinfI 4 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 4 Hpy99I 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 1 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MmeI 2 MnlI 8 MseI 4 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 2 BasI,AccB7I,Van91I PpuMI 1 Psp5II,PspPPI PsiI 2 AanI PvuI 1 MvrI,Ple19I,BpvUI RsaI 5 AfaI SapI 2 LguI,PciSI,BspQI SduI 1 MhlI,Bsp1286I SetI 13 SfaNI 3 LweI SpeI 1 BcuI,AhlI StuI 1 Eco147I,PceI,SseBI,AatI TaiI 2 TaqI 6 TaqII 1 TatI 3 TfiI 4 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI VspI 1 PshBI,AseI XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BcgI BciVI BclI BdaI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseRI BseSI BseYI Bsp120I BspMI BspMII* BspOI BsrBI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI CauII* Cfr9I CfrI ClaI CspCI DinI DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI EspI* FauI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiCI* HgiJII* HhaI Hin4I Hin6I HindII HinP1I HpaI HspAI KasI KpnI MauBI MluI MlyI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SchI ScrFI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SspI StyD4I StyI SwaI TauI TspMI TstI Tth111I XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769