Restriction Map of Q0297



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

Q0297 on mitochondria from coordinates 85554 to 85709.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.9900

HpaII | AsuI* | |CviJI | |HaeIII | |BmgT120I | || FauI | || |FauI | || ||AciI | || ||SecI* | || ||DsaI* | || |||BsiYI* | || ||||AciI | || ||||FnuDII* | || ||||NspBII* | || |||||BisI | || |||||SacII | || ||||||BlsI | || ||||||BsiYI* | || |||||||AciI | || |||||||TauI | || |||||||BsiYI* | || |||||||| FauI | || |||||||| Cac8I | || |||||||| | AciI MseI | || AciI |||||||| | | AsuI* | TspDTI | || Cac8I |||||||| | | AvaII \ \ \ \\ \ \\\\\\\\ \ \ \ ATGAAAATAAAACTTAATAAATATATAAATATAGTCCGGCCCGCCCCCCCGCGGCGGGCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTTATTTTGAATTATTTATATATTTATATCAGGCCGGGCGGGGGGGCGCCGCCCGC / / //// / / ///// / / / | MseI |||| | | ||||| | | Hin4II* TspDTI |||| | | ||||| | | AciI |||| | | ||||| | FauI |||| | | ||||| Cac8I |||| | | ||||| AciI |||| | | ||||DsaI* |||| | | ||||SecI* |||| | | ||||BisI |||| | | ||||AciI |||| | | |||BlsI |||| | | ||NspBII* |||| | | ||FnuDII* |||| | | ||BsiYI* |||| | | ||AciI |||| | | ||TauI |||| | | |BsiYI* |||| | | |SacII |||| | | |FauI |||| | | FauI |||| | BsiYI* |||| AciI |||AsuI* |||Cac8I ||BmgT120I |HaeIII |CviJI HpaII M K I K L N K Y I N I V R P A P P R R A * K * N L I N I * I * S G P P P R G G R E N K T * * I Y K Y S P A R P P A A G G ----:----|----:----|----:----|----:----|----:----|----:----| X F I F S L L Y I F I T R G A G G R R A X S F L V * Y I Y L Y L G A R G G A A P H F Y F K I F I Y I Y D P G G G R P P R AsuI* AvaII DraII PpuMI SanDI AsuI* BslFI Hin4II* |NlaIV MnlI AvaII Hin4II* BmgT120I |BmgT120I | BslFI |NlaIV | MseI |NlaIV MnlI EciI ||NlaIV | | MnlI |BmgT120I | | TaqII \\ \ \ \\\ \ \ \ \\ \ \ \ GACCCCGAAGGAGTGAGGGACCCCTCCCTAATGGGAGGGGGACCGAACCCCTTTTTAAGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGGGCTTCCTCACTCCCTGGGGAGGGATTACCCTCCCCCTGGCTTGGGGAAAAATTCT // / / /// / / / /// / / / || | EciI ||SanDI MnlI | BslFI ||AvaII | | BslFI || MnlI ||PpuMI MnlI ||AsuI* | | MseI |AvaII ||DraII |BmgT120I | TaqII |AsuI* ||AvaII NlaIV Hin4II* BmgT120I ||AsuI* NlaIV |BmgT120I |NlaIV NlaIV D P E G V R D P S L M G G G P N P F L R T P K E * G T P P * W E G D R T P F * E P R R S E G P L P N G R G T E P L F K K ----:----|----:----|----:----|----:----|----:----|----:----| S G S P T L S G E R I P P P G F G K K L P G R L L S P G R G L P L P V S G R K L V G F S H P V G G * H S P S R V G K * S PleI MseI HinfI |MlyI VspI \ \\ \ AGGAGTCCATATATATATATTAATAAAAAAAAGTAA 130 140 150 ----:----|----:----|----:----|----:- TCCTCAGGTATATATATATAATTATTTTTTTTCATT / / / HinfI PleI VspI MlyI MseI R S P Y I Y I N K K K * G V H I Y I L I K K S X E S I Y I Y * * K K V X ----:----|----:----|----:----|----:- L L G Y I Y I L L F F Y F S D M Y I Y * Y F F T P T W I Y I N I F F L L # Enzymes that cut Frequency Isoschizomers AciI 5 BspACI,SsiI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 4 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI Cac8I 2 BstC8I CviJI 1 CviKI-1 DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EciI 1 FauI 3 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII HaeIII 1 BsnI,BsuRI,BshFI,PhoI Hin4II* 2 HpyAV HinfI 1 HpaII 1 HapII,BsiSI,MspI MlyI 1 SchI MnlI 3 MseI 3 Tru1I,Tru9I NlaIV 4 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PleI 1 PpsI PpuMI 1 Psp5II,PspPPI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SanDI 1 SecI* 1 BseDI,BssECI,BsaJI TaqII 1 TauI 1 TspDTI 1 VspI 1 PshBI,AseI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsmAI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI CviRI* DdeI DinI DpnI DraIII DrdI Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FatI FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HindII HindIII HinP1I HpaI HphI Hpy166II Hpy178III* Hpy188I Hpy8I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MaeII MaeIII MauBI MboI MboII McrI* MfeI MluI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SalI SapI SauI* ScaI ScrFI SduI SetI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqI TatI TfiI TseI TsoI Tsp45I Tsp4CI* TspEI TspGWI TspMI TspRI TstI Tth111I XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769