Restriction Map of OLI1/Q0130

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

OLI1/Q0130 on mitochondria from coordinates 46723 to 46953.


TseI |BisI ||BlsI |||AluI |||CviJI |||| SetI |||| | Hin4I CviRI* |||| | | BspMI MfeI BspMI |TspEI |||| | | | BbvI SetI TspEI Hin4I \\ \\\\ \ \ \ \ \ \ \ ATGCAATTAGTATTAGCAGCTAAATATATTGGAGCAGGTATCTCAACAATTGGTTTATTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTAATCATAATCGTCGATTTATATAACCTCGTCCATAGAGTTGTTAACCAAATAAT / / /// / / / // / | TspEI ||CviJI | | SetI |TspEI BspMI CviRI* ||TseI | BbvI |MfeI ||AluI BspMI Hin4I |Hin4I |BisI BlsI SetI M Q L V L A A K Y I G A G I S T I G L L C N * Y * Q L N I L E Q V S Q Q L V Y * A I S I S S * I Y W S R Y L N N W F I R ----:----|----:----|----:----|----:----|----:----|----:----| X C N T N A A L Y I P A P I E V I P K N X A I L I L L * I Y Q L L Y R L L Q N I H L * Y * C S F I N S C T D * C N T * * TseI |BisI ||BlsI |||AluI |||CviJI |||| SetI |||| |MseI |||| ||TspEI |||| ||| MseI |||| ||| VspI |||| ||| PacI SetI |||| ||| | BbvI Hpy178III* \ \\\\ \\\ \ \ \ GGAGCAGGTATTGGTATTGCTATCGTATTCGCAGCTTTAATTAATGGTGTATCAAGAAAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCGTCCATAACCATAACGATAGCATAAGCGTCGAAATTAATTACCACATAGTTCTTTG / /// / // / / SetI ||| | || BbvI Hpy178III* ||| | |VspI ||| | |MseI ||| | TspEI ||| PacI ||| MseI ||CviJI ||TseI ||AluI |BisI BlsI SetI G A G I G I A I V F A A L I N G V S R N E Q V L V L L S Y S Q L * L M V Y Q E T S R Y W Y C Y R I R S F N * W C I K K P ----:----|----:----|----:----|----:----|----:----|----:----| P A P I P I A I T N A A K I L P T D L F L L L Y Q Y Q * R I R L K L * H H I L F S C T N T N S D Y E C S * N I T Y * S V Hpy188I | AluI TspEI MaeI | CviJI | MseI |SetI | |SfeI* | |BccI || TsoI CviJI SetI | ||SetI \ \\ \\ \ \ \ \ \\\ CCATCAATTAAAGACCTAGTATTCCCTATGGCTATTTTAGGTTTCGCCTTATCAGAAGCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGTTAATTTCTGGATCATAAGGGATACCGATAAAATCCAAAGCGGAATAGTCTTCGA // / // / / / / / || | |MaeI CviJI SetI | | CviJI || | TsoI | | AluI || SetI | SetI |BccI Hpy188I |MseI TspEI P S I K D L V F P M A I L G F A L S E A H Q L K T * Y S L W L F * V S P Y Q K L I N * R P S I P Y G Y F R F R L I R S Y ----:----|----:----|----:----|----:----|----:----|----:----| G D I L S R T N G I A I K P K A K D S A G M L * L G L I G * P * K L N R R I L L W * N F V * Y E R H S N * T E G * * F S TspDTI SetI | MseI \ \ \ ACAGGTTTATTCTGTTTAATGGTTTCATTCTTATTATTATTCGGTGTATAA 190 200 210 220 230 ----:----|----:----|----:----|----:----|----:----|- TGTCCAAATAAGACAAATTACCAAAGTAAGAATAATAATAAGCCACATATT // / / |SfeI* | MseI SetI TspDTI T G L F C L M V S F L L L F G V * Q V Y S V * W F H S Y Y Y S V Y X R F I L F N G F I L I I I R C I X ----:----|----:----|----:----|----:----|----:----|- V P K N Q K I T E N K N N N P T Y * L N I R N L P K M R I I I R H I C T * E T * H N * E * * * E T Y L # Enzymes that cut Frequency Isoschizomers AluI 3 AluBI BbvI 2 BseXI,BstV1I,Lsp1109I BccI 1 BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BspMI 2 BfuAI,Acc36I,BveI CviJI 4 CviKI-1 CviRI* 1 HpyCH4V Hin4I 1 Hpy178III* 1 Hpy188III Hpy188I 1 MaeI 1 FspBI,BfaI,XspI MfeI 1 MunI MseI 4 Tru1I,Tru9I PacI 1 SetI 8 SfeI* 1 BstSFI,SfcI,BfmI TseI 2 ApeKI TsoI 1 TspDTI 1 TspEI 4 TasI,Tsp509I,Sse9I VspI 1 PshBI,AseI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI HpaII HphI Hpy166II Hpy8I Hpy99I HspAI KasI KpnI Ksp632I* MaeII MaeIII MauBI MboI MboII McrI* MluI MlyI MmeI MnlI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqI TaqII TatI TauI TfiI Tsp45I Tsp4CI* TspGWI TspMI TspRI TstI Tth111I XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769