Yeast Genome Pattern Matching Help




(In some browsers, you may also need to click the browser's "Stop loading" button, after clicking this button.)
Please wait. The search may take a while to run...

..

Total Hits : 432
Number of Unique Sequence Entries Hit : 305
Sequences Searched : 5916
Entered nucleotide pattern : CGG...WH.{3,5}HW...CCG
Dataset : S. cerevisiae ORF Coding DNA
Strand : both strands

A Table of Full Results is below the Graphic

The black | on each chromosome bar indicates the matching position

Full Search Result for Hits No. 1 - 25

Sequence NameHit NumberMatching PatternMatching PositionsMatching ResultRetrieveLocus Information
BeginEnd
YAL002W/VPS81CGGACATTGTATCCATAACCG26512671SequenceRestrictionMapMembrane-binding component of the CORVET complex
YAL031C/GIP41CGGCTGTGCTACATTATCCG20422061SequenceRestrictionMapCytoplasmic protein that regulates protein phosphatase 1 Glc7p
YAL046C/BOL31CGGAGGAGAAGATGATCACCG110130SequenceRestrictionMapProtein involved in Fe-S cluster transfer to mitochondrial clients
YAL063C/FLO91CGGATCTGGTGTGTGTTCCG34533472SequenceRestrictionMapLectin-like protein with similarity to Flo1p
YAL067W-A2CGGTCAAAAAGAATATCCG6886SequenceRestrictionMapPutative protein of unknown function
CGGTCAAAAAGAATATCCG6886Sequence
YBL044W1CGGGCGACGGACAAGACCCG210229SequenceRestrictionMapPutative protein of unknown function
YBL063W/KIP11CGGTGATGTGCAATCTACCG474493SequenceRestrictionMapKinesin-related motor protein
YBL101C/ECM211CGGCAGTATTTCGAATTCCG29642983SequenceRestrictionMapProtein involved in regulating endocytosis of plasma membrane proteins
YBR012W-A1CGGAAAACCCGTACGTCCG615633SequenceRestrictionMapRetrotransposon TYA Gag gene co-transcribed with TYB Pol
YBR012W-B1CGGAAAACCCGTACGTCCG615633SequenceRestrictionMapRetrotransposon TYA Gag and TYB Pol genes
YBR015C/MNN21CGGGCTTGGTCATGTGGCCCG860880SequenceRestrictionMapAlpha-1,2-mannosyltransferase
YBR068C/BAP22CGGATATATGGTTTACAACCG16561676SequenceRestrictionMapHigh-affinity leucine permease
CGGATATATGGTTTACAACCG16561676Sequence
YBR080C/SEC182CGGTAAAACAGCTTTAGCCG17041723SequenceRestrictionMapAAA ATPase and SNARE disassembly chaperone
CGGTAAAACAGCTTTAGCCG17041723Sequence
YBR108W/AIM31CGGTGCTGTCAACGAATGCCG17091729SequenceRestrictionMapProtein that inhibits barbed-end actin filament elongation
YBR109C/CMD11CGGTGATGGTTTAATCTCCG288307SequenceRestrictionMapCalmodulin
YBR123C/TFC12CGGGAATTTGATCTTAGACCG627647SequenceRestrictionMapSubunit of RNA polymerase III transcription initiation factor complex
CGGGAATTTGATCTTAGACCG627647Sequence
YBR131W/CCZ11CGGATTTAACAAGGACTTCCG381401SequenceRestrictionMapSubunit of a heterodimeric guanine nucleotide exchange factor (GEF)
YBR132C/AGP21CGGCCTTGTTTCATGTTCCG15241543SequenceRestrictionMapPlasma membrane regulator of polyamine and carnitine transport
YBR212W/NGR11CGGTGATGAAGATGAGCGCCG723743SequenceRestrictionMapRNA binding protein that negatively regulates growth rate
YBR239C/ERT11CGGTCCATTGCCGAATTCCG11291148SequenceRestrictionMapTranscriptional regulator
YBR245C/ISW11CGGTTCAGCTGGTACGCCG20672085SequenceRestrictionMapATPase subunit of imitation-switch (ISWI) class chromatin remodelers
YBR249C/ARO41CGGTGAAAACGCCATTACCG915934SequenceRestrictionMap3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) synthase
YBR251W/MRPS51CGGAAATCGAAAAGCGCCG352370SequenceRestrictionMapMitochondrial ribosomal protein of the small subunit
YBR264C/YPT101CGGAGTTACAGGGTCTGCCG416435SequenceRestrictionMapRab family GTP-binding protein
YBR279W/PAF12CGGACAAATGGCAACATCCG503522SequenceRestrictionMapComponent of the Paf1p complex involved in transcription elongation
CGGACAAATGGCAACATCCG503522Sequence

Retrieve Next Hits

Download Full Results