S. cerevisiae ORF Coding DNA for YDL171C




The matching region is highlighted in the following retrieved sequence (in blue). Click on it to go to the Features Map around this region.





       1 ATGCCAGTGTTGAAATCAGACAATTTCGATCCATTGGAAGAAGCTTACGA
      51 AGGTGGGACAATTCAAAACTATAACGATGAACACCATCTTCATAAATCTT
     101 GGGCAAATGTGATTCCGGACAAACGAGGACTTTACGACCCTGATTATGAA
     151 CATGACGCTTGTGGTGTCGGTTTCGTAGCAAATAAGCATGGTGAACAGTC
     201 TCACAAGATTGTTACTGACGCTAGATATCTTTTAGTGAATATGACACATC
     251 GTGGTGCCGTCTCATCTGATGGGAACGGTGACGGTGCCGGTATTCTGCTA
     301 GGTATTCCTCACGAATTTATGAAAAGAGAATTCAAGTTAGATCTTGATCT
     351 AGACATACCTGAGATGGGCAAATACGCCGTAGGTAACGTCTTCTTCAAGA
     401 AGAACGAAAAAAATAACAAGAAAAATTTAATTAAGTGTCAGAAGATTTTC
     451 GAGGATTTAGCTGCATCCTTCAACTTATCCGTATTAGGTTGGAGAAACGT
     501 CCCCGTAGATTCTACTATTTTAGGAGACGTTGCATTATCTCGTGAACCTA
     551 CTATTCTACAGCCATTATTGGTTCCATTGTATGATGAAAAACAACCGGAG
     601 TTTAATGAAACTAAATTTAGAACTCAATTGTATCTTTTAAGGAAGGAGGC
     651 CTCTCTTCAAATAGGACTGGAAAACTGGTTCTATGTTTGTTCCCTAAACA
     701 ATACCACCATTGTTTACAAGGGTCAATTGACGCCAGCTCAAGTGTATAAC
     751 TACTATCCCGACTTGACTAATGCGCATTTCAAATCCCACATGGCGTTGGT
     801 CCATTCAAGATTTTCCACTAATACTTTCCCCTCTTGGGATAGAGCTCAAC
     851 CTTTACGTTGGCTAGCTCATAATGGTGAAATTAACACCTTAAGAGGTAAC
     901 AAGAATTGGATGCGCTCCAGAGAAGGTGTGATGAATTCAGCAACTTTCAA
     951 AGATGAGTTAGACAAACTATACCCAATTATCGAAGAAGGTGGTTCTGATT
    1001 CAGCTGCATTGGATAACGTTTTAGAACTATTGACTATTAATGGCACATTA
    1051 TCTCTACCTGAAGCTGTTATGATGATGGTTCCTGAAGCGTATCATAAGGA
    1101 TATGGATTCTGACCTAAAAGCATGGTACGACTGGGCTGCATGTCTGATGG
    1151 AACCTTGGGATGGTCCAGCTTTGTTAACTTTCACTGATGGACGTTACTGT
    1201 GGTGCTATATTGGATAGAAATGGTTTAAGACCTTGTCGTTATTACATCAC
    1251 TAGTGATGACAGAGTTATCTGTGCTTCAGAGGTAGGTGTCATTCCTATCG
    1301 AAAATTCATTGGTTGTTCAAAAAGGTAAACTGAAGCCAGGTGATTTATTC
    1351 CTAGTGGATACTCAATTGGGTGAAATGGTCGATACTAAAAAGTTAAAATC
    1401 TCAAATCTCAAAAAGACAAGATTTTAAGTCTTGGTTATCCAAAGTCATCA
    1451 AGTTAGACGACTTGTTATCAAAAACCGCTAATTTGGTTCCTAAAGAATTT
    1501 ATATCACAGGATTCATTGTCTTTGAAAGTTCAAAGTGACCCACGTCTATT
    1551 GGCCAATGGTTATACCTTCGAACAAGTCACATTTCTGTTAACTCCAATGG
    1601 CTTTAACAGGTAAAGAAGCTTTAGGTTCGATGGGTAACGATGCGCCACTG
    1651 GCTTGTTTAAATGAAAATCCTGTCTTACTTTATGATTATTTCAGACAATT
    1701 GTTTGCTCAAGTGACCAATCCTCCAATTGACCCAATTCGTGAAGCAAATG
    1751 TTATGTCGTTAGAATGTTATGTCGGACCTCAAGGCAACCTTTTGGAAATG
    1801 CATTCATCTCAATGTGATCGTTTATTATTGAAATCTCCTATTTTGCATTG
    1851 GAATGAGTTCCAAGCTTTGAAAAACATTGAAGCTGCTTACCCATCATGGT
    1901 CTGTAGCAGAAATTGATATCACATTCGACAAGAGTGAGGGTCTATTGGGC
    1951 TATACCGACACAATTGATAAAATCACTAAGTTAGCGAGCGAAGCAATTGA
    2001 TGATGGTAAAAAGATCTTAATAATTACTGACAGGAAAATGGGTGCCAACC
    2051 GTGTTTCCATCTCCTCTTTGATTGCAATTTCATGTATTCATCATCACCTA
    2101 ATCAGAAACAAGCAGCGTTCCCAAGTTGCTTTGATTTTGGAAACAGGTGA
    2151 AGCCAGAGAAATTCACCATTTCTGTGTCCTACTAGGTTATGGTTGTGATG
    2201 GTGTTTATCCATACTTAGCCATGGAAACTTTGGTCAGAATGAATAGAGAA
    2251 GGTCTACTTCGTAATGTCAACAATGACAATGATACACTTGAGGAAGGGCA
    2301 AATACTAGAAAATTACAAGCACGCTATTGATGCAGGTATCTTGAAGGTTA
    2351 TGTCTAAAATGGGTATCTCCACTCTAGCATCCTACAAAGGTGCTCAAATT
    2401 TTTGAAGCCCTAGGTTTAGATAACTCTATTGTTGATTTGTGTTTCACAGG
    2451 TACTTCTTCCAGAATTAGAGGTGTAACTTTCGAGTATTTGGCTCAAGATG
    2501 CCTTTTCTTTACATGAGCGTGGTTATCCATCCAGACAAACCATTAGTAAA
    2551 TCTGTTAACTTACCAGAAAGTGGTGAATACCACTTTAGGGATGGTGGTTA
    2601 CAAACACGTCAACGAACCAACCGCAATTGCTTCGTTACAAGATACTGTCA
    2651 GAAACAAAAATGATGTCTCTTGGCAATTATATGTAAAGAAGGAAATGGAA
    2701 GCAATTAGAGACTGTACACTAAGAGGACTGTTAGAATTAGATTTTGAAAA
    2751 TTCTGTCAGTATCCCTCTAGAACAAGTTGAACCATGGACTGAAATTGCCA
    2801 GAAGATTTGCGTCAGGTGCAATGTCTTATGGTTCTATTTCTATGGAAGCT
    2851 CACTCTACATTGGCTATTGCCATGAATCGTTTAGGGGCCAAATCCAATTG
    2901 TGGTGAAGGTGGTGAAGACGCAGAACGTTCTGCTGTTCAAGAAAACGGTG
    2951 ATACTATGAGATCTGCTATCAAACAAGTTGCTTCCGCTAGATTCGGTGTA
    3001 ACTTCATACTACTTGTCAGATGCTGATGAAATCCAAATTAAGATTGCTCA
    3051 GGGTGCTAAGCCGGGTGAAGGTGGTGAACTACCAGCCCACAAAGTGTCTA
    3101 AGGATATCGCAAAAACCAGGCACTCCACCCCTAATGTTGGGTTAATCTCT
    3151 CCTCCTCCTCATCACGATATTTATTCCATTGAAGATTTGAAACAACTGAT
    3201 TTATGATTTGAAATGTGCTAATCCAAGAGCGGGAATTTCTGTAAAGTTGG
    3251 TTTCCGAAGTTGGTGTTGGTATTGTTGCCTCTGGTGTAGCTAAGGCTAAA
    3301 GCCGATCATATCTTAGTTTCTGGTCATGATGGTGGTACAGGTGCTGCAAG
    3351 ATGGACGAGTGTCAAATATGCGGGTTTGCCATGGGAATTAGGTCTAGCTG
    3401 AAACTCACCAGACTTTAGTCTTGAATGATTTAAGACGTAATGTTGTTGTC
    3451 CAAACCGATGGTCAATTGAGAACTGGGTTTGATATTGCTGTTGCAGTTTT
    3501 ATTAGGGGCAGAATCTTTTACCTTGGCAACAGTTCCATTAATTGCTATGG
    3551 GTTGTGTTATGTTAAGAAGATGTCACTTGAACTCTTGTGCTGTTGGTATT
    3601 GCCACACAAGATCCATATTTGAGAAGTAAGTTTAAGGGTCAGCCCGAACA
    3651 TGTTATCAACTTCTTCTATTACTTGATCCAAGATTTAAGACAAATCATGG
    3701 CCAAGTTAGGATTCCGTACCATTGACGAAATGGTGGGTCATTCTGAAAAA
    3751 TTAAAGAAAAGGGACGACGTAAATGCCAAAGCCATAAATATCGATTTATC
    3801 TCCTATTTTGACCCCAGCACATGTTATTCGTCCAGGTGTTCCAACCAAGT
    3851 TCACTAAGAAACAAGACCACAAACTCCACACCCGTCTAGATAATAAGTTA
    3901 ATCGATGAGGCTGAAGTTACTTTGGATCGTGGCTTACCAGTGAATATTGA
    3951 CGCCTCTATAATCAATACTGATCGTGCACTCGGTTCTACTTTATCTTACA
    4001 GAGTCTCGAAGAAATTTGGTGAAGATGGTTTGCCAAAGGACACCGTTGTC
    4051 GTTAACATAGAAGGTTCAGCGGGTCAATCTTTTGGTGCTTTCCTAGCTTC
    4101 TGGTATCACTTTTATCTTGAATGGTGATGCTAATGATTATGTTGGTAAAG
    4151 GTTTATCCGGTGGTATTATTGTCATTAAACCACCAAAGGATTCTAAATTC
    4201 AAGAGTGATGAAAATGTAATTGTTGGTAACACTTGTTTCTATGGTGCTAC
    4251 TTCTGGTACTGCATTCATTTCAGGTAGTGCCGGTGAGCGTTTCGGTGTCA
    4301 GAAACTCTGGTGCCACCATCGTTGTTGAGAGAATTAAGGGTAACAATGCC
    4351 TTTGAGTATATGACTGGTGGTCGTGCCATTGTCTTATCACAAATGGAATC
    4401 CCTAAACGCCTTCTCTGGTGCTACTGGTGGTATTGCATACTGTTTAACTT
    4451 CCGATTACGACGATTTTGTTGGAAAGATTAACAAAGATACTGTTGAGTTA
    4501 GAATCATTATGTGACCCGGTCGAGATTGCGTTTGTTAAGAATTTGATCCA
    4551 GGAGCATTGGAACTACACACAATCTGATCTAGCAGCCAGGATTCTCGGTA
    4601 ATTTCAACCATTATTTGAAAGATTTCGTTAAAGTCATTCCAACTGATTAT
    4651 AAGAAAGTTTTGTTGAAGGAGAAAGCAGAAGCTGCCAAGGCAAAGGCTAA
    4701 GGCAACTTCAGAATACTTAAAGAAGTTTAGATCGAACCAAGAAGTTGATG
    4751 ACGAAGTCAATACTCTATTGATTGCTAATCAAAAAGCTAAAGAGCAAGAA
    4801 AAAAAGAAGAGTATTACTATTTCAAATAAGGCCACTTTGAAGGAGCCTAA
    4851 GGTTGTTGATTTAGAAGATGCAGTTCCAGATTCCAAACAGCTAGAGAAGA
    4901 ATAGCGAAAGGATTGAAAAAACACGTGGTTTTATGATCCACAAACGTCGT
    4951 CATGAGACACACAGAGATCCAAGAACCAGAGTTAATGACTGGAAAGAATT
    5001 TACTAACCCTATTACCAAGAAGGATGCCAAATATCAAACTGCGAGATGTA
    5051 TGGATTGTGGTACACCATTCTGTTTATCTGATACCGGTTGTCCCCTATCT
    5101 AACATTATCCCCAAGTTTAATGAATTGTTATTCAAGAACCAATGGAAGTT
    5151 GGCACTGGACAAATTGCTAGAGACAAACAATTTCCCAGAATTCACTGGAA
    5201 GAGTATGTCCAGCACCCTGTGAGGGAGCTTGTACACTAGGTATTATTGAA
    5251 GACCCAGTCGGCATAAAATCGGTTGAAAGAATTATCATTGACAATGCTTT
    5301 CAAGGAAGGATGGATTAAGCCTTGTCCACCAAGTACACGCACTGGCTTTA
    5351 CAGTGGGTGTCATTGGTTCTGGTCCAGCAGGTTTAGCGTGTGCTGATATG
    5401 TTGAACCGTGCCGGACATACGGTCACTGTTTATGAAAGATCCGACCGTTG
    5451 TGGTGGGTTATTGATGTATGGTATTCCAAACATGAAGTTGGATAAGGCTA
    5501 TAGTGCAACGTCGTATTGATCTATTGAGTGCCGAAGGTATTGACTTTGTT
    5551 ACCAACACCGAAATTGGTAAAACCATAAGCATGGATGAGCTAAAGAACAA
    5601 GCACAATGCAGTAGTGTATGCTATCGGTTCTACCATTCCACGTGACTTAC
    5651 CTATTAAGGGTCGTGAATTGAAGAATATTGATTTTGCCATGCAGTTGTTG
    5701 GAATCTAACACAAAAGCTTTATTGAACAAAGATCTGGAAATCATTCGTGA
    5751 AAAGATCCAAGGTAAGAAAGTAATTGTTGTCGGTGGTGGTGACACAGGTA
    5801 ACGATTGTTTAGGTACATCTGTAAGACACGGTGCAGCATCAGTTTTGAAT
    5851 TTCGAATTGTTGCCTGAGCCACCAGTGGAACGTGCCAAAGACAATCCATG
    5901 GCCTCAATGGCCGCGTGTCATGAGAGTGGACTACGGTCATGCTGAAGTGA
    5951 AAGAGCATTATGGTAGAGACCCTCGTGAATACTGCATCTTGTCCAAGGAA
    6001 TTTATCGGTAACGATGAGGGTGAAGTCACTGCCATCAGAACTGTGCGCGT
    6051 AGAATGGAAGAAGTCACAAAGTGGCGTATGGCAAATGGTAGAAATTCCCA
    6101 ACAGTGAAGAGATCTTTGAAGCCGATATCATTTTGTTGTCTATGGGTTTC
    6151 GTGGGTCCTGAATTGATCAATGGCAACGATAACGAAGTTAAGAAGACAAG
    6201 ACGTGGTACGATTGCCACACTCGACGACTCCTCATACTCTATTGATGGAG
    6251 GAAAGACTTTTGCATGTGGTGACTGTAGAAGAGGGCAATCTTTGATTGTC
    6301 TGGGCCATCCAAGAAGGTAGAAAATGTGCTGCCTCTGTCGATAAGTTCCT
    6351 AATGGACGGCACTACGTATCTACCAAGTAATGGTGGTATCGTTCAACGTG
    6401 ATTACAAACTATTGAAAGAATTAGCTAGTCAAGTCTAA